INT’L. J. PSYCHIATRY IN MEDICINE, Vol. 47(2) 153-168, 2014
ASSOCIATION OF microRNA137 GENE POLYMORPHISMS WITH AGE AT ONSET AND POSITIVE SYMPTOMS OF SCHIZOPHRENIA IN A HAN CHINESE POPULATION* SHUAI WANG† WENQIANG LI† HONGXING ZHANG XIUJUAN WANG Henan Mental Hospital, The Second Affiliated Hospital of Xinxiang Medical University, Xinxiang, China; and Xinxiang Medical University, Xinxiang, China GE YANG JINGYUAN ZHAO Henan Mental Hospital, The Second Affiliated Hospital of Xinxiang Medical University, Xinxiang, China YONGFENG YANG LUXIAN LV Henan Mental Hospital, The Second Affiliated Hospital of Xinxiang Medical University, Xinxiang, China; and Xinxiang Medical University, Xinxiang, China
*Funding for this study was provided by the National Natural Science Foundation of China (No. 81071091, to L-LX; No. 81201040, to L-WQ), the Natural Science Foundation of Henan (No. 112300413226 to L-LX, 122300413212 to L-WQ), the Postgraduate Scientific Research Innovative Program of Xinxiang Medical University (No. YJSCX201109Z to W-S), the Program for New Century Excellent Talents in University (NCET-10-0137 to Z-HX), and the Scientific Research Program of Xinxiang Medical University (No. ZD2011-20 to L-WQ). †Contributed equally. 153 Ó 2014, Baywood Publishing Co., Inc. doi: http://dx.doi.org/10.2190/PM.47.2.f http://baywood.com
154 / WANG ET AL. ABSTRACT
Objectives: MicroRNA137 (miRNA137) regulates several gene expressions involved in brain development, and a recent large genome wide association study (GWAS) revealed a possible association between miRNA137 and schizophrenia. Methods: The allelic variants of rs66642155, a variable number tandem repeat polymorphism, and the single nucleotide polymorphism rs1625579 A/C in the miRNA137 host gene fragment were compared between 300 schizophrenic patients and 300 healthy controls from the Han Chinese population. The association of these polymorphisms with clinical characteristics of schizophrenia was also tested. Results: Genotype and allele frequencies of these polymorphisms were not significantly different between patient and control populations. In patients, however, age at onset was much later in wild type rs66642155 carriers than in mutation carriers. Total positive score on the Positive and Negative Symptom Scale (PANSS), total five-factor model positive score, and the delusions symptom score were all significantly higher in wild type rs66642155 carriers with schizophrenia, while the disturbance of volition symptom score was significantly higher in the mutation carriers with schizophrenia. Conclusions: MiRNA137 may not be a significant susceptibility gene for schizophrenia, but in patients, rs66642155 allelic variant of miRNA137 appears to influence age at onset and the severity of positive symptoms. (Int’l. J. Psychiatry in Medicine 2014;47:153-168)
Key Words: MiRNA137, association, schizophrenia, age at onset, positive symptom
INTRODUCTION Schizophrenia is characterized by a variety of perceptual, cognitive, social, emotional, linguistic, and motivational disturbances that are differentially expressed in individual patients [1]. While schizophrenia has a major genetic component, it is both etiologically and clinically complex. Genetic studies of schizophrenia have long focused on protein coding genes, and while over 1000 schizophrenia susceptibility genes have been proposed, there remains no set of confirmed “causal” schizophrenic genes [2]. In addition to protein coding genes, the genome encodes a multitude of reguatory RNAs that have also been linked to disease, including schizophrenia and schizo-affective disorder [3]. MicroRNAs (miRNAs) are small non-coding gene transcripts involved in post-transcriptional gene regulation [4]. A primary miRNA (pri-miRNA) is first transcribed from the miRNA host gene by Pol II, forms a smaller hairpin-like structure called a precursor miRNA (pre-miRNA), and finally is processed by Dicer to the 21 to 25 nucleotide functional miRNA [5]. MicroRNAs control mRNA stability and translation by binding to complementary sequence motifs in the 3’-UTR of target mRNAs [6]. Individual miRNAs regulate
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
155
the expression of multiple genes and so have pleiotrophic effects on many cellular processes [7, 8]. This pleiotropy may also confer a highly complex relationship between miRNA expression, allelic variation or mutation, and disease characteristics. New miRNAs are continually being discovered [9] and shown to modulate critical biological functions, such as insulin secretion [10] and apoptosis [11]. Often referred to as the “micromanagers of gene expression,” miRNAs have also been linked to several human diseases [12]. These associations may stem from either variations in the miRNA sequence [13, 14] or the target mRNA sequence [15, 16]. For example, Tourette’s syndrome has been linked to deletions and mutations in the 3’-UTR of the SLITRK1 mRNA, a target site for regulation by miR-189 [17]. Approximately one-third of all known miRNAs are expressed in the brain [18] where they regulate brain development [19, 20], synaptic plasticity [21], and neuronal differentiation [22]. Allelic variation or mutations in these miRNAs may alter brain development or plasticity, leading to the neurological deficits associated with schizophrenia. Indeed, Sun et al. [23] reported an association between schizophrenia and the miR-502-C/G and miR-510-T/C polymorphisms. The largest genome wide association study (GWAS) to date, which included over 40,000 individuals, identified a strong association between schizophrenia and rs1625579, a polymorphism located within an intron of the miRNA137 host gene (1p21.3) [24]. MicroRNA137 has been seen as a regulator of neural stem cell maturation, migration, and gliogenesis [25]. Furthermore, it might be associated with cognitive function, and targeted many schizophrenia risk genes, such as ZNF804A, TCF4, CSMD1, and so on [26]. Thus, miRNA137 would have a critical role for the phenotypic expression of schizophrenia. In this study, we investigated potential associations between schizophrenia and miRNA137 allelic variants. We also tested whether these polymorphisms were associated with specific clinical characteristics of schizophrenia. MATERIALS AND METHODS Subjects Three hundred confirmed schizophrenic inpatients, including 212 first episode patients, were recruited from the Second Affiliated Hospital of Xinxiang Medical University. The patients were diagnosed in accordance with DSM-IV criteria by at least two experienced psychiatrists on the basis of structured clinical interviews or medical records. Antipsychotic drug treatment consisted mainly of monotherapy with aripiprazole (Abilify) (n = 165) or risperidone (Risperdal) (n = 135) at an average daily dose of 5.1 ± 1.9 mg/day (mean ± SD) in risperidone equivalents. Three hundred healthy controls without personal or family histories of psychiatric illness or other complex disorders, including diabetes, hypertension,
156 / WANG ET AL.
immunological diseases, and tumors, were the students from Xinxiang Medical University and healthy subjects from Hospitals in Xinxiang, and selected through a screening using the Structured Clinical Interview (SCID) for DSM-IV. The controls were well matched to the patient group for gender ratio, age, and ethnicity (all participants in the study were unrelated Han Chinese born and living in North Henan province, and all of their biological grandparents were Han Chinese). General demographic and basic clinical characteristics of participants are shown in Table 1. There were no significant differences in demographic or clinical variables between groups or genders. All subjects gave their written informed consent prior to participation in this study after they fully understood the purpose and procedures. The patients’ capacity to sign the informed consent was based on the judgment of their clinician. If a patient was unable to give informed consent, it was signed by his/her caregiver. All study protocols were approved by the Institutional Review Board of the Second Affiliated Hospital of Xinxiang Medical University. Clinical Measures The age at which an individual was first diagnosed or experienced the first symptoms of schizophrenia was defined as the age at onset. The Positive and Negative Symptom Scale (PANSS) was administered by two experienced psychiatrists to assess the severity of psychopathology. The severity of each symptom was scored from 1 to 7 (1 = absent, 2 = minimal, 3 = mild, 4 = moderate, 5 = moderate/severe, 6 = severe, 7 = extreme). The PANSS scores (total, positive, negative, and general) and five-factor model scores derived from PANSS (positive [P1, P3, P5, P6, G9], negative [N1, N2, N3, N4, N6, G7], excitement [P4, P7,
Table 1. General Characteristics of Study Groups Group Characteristics
Case
Control
150/150
150/150
Age (years)
31.70 ± 9.62
31.52 ± 8.93
BMI (kg/m2)
23.57 ± 6.28
23.11 ± 4.80
CHO (mm/L)
3.94 ± 0.81
3.76 ± 0.79
TG (mm/L)
1.13 ± 0.63
1.24 ± 0.34
HDL (mm/L)
1.22 ± 0.32
1.17 ± 0.29
LDL (mm/L)
2.32 ± 0.63
2.20 ± 0.68
Glu (mm/L)
4.58 ± 0.62
4.46 ± 0.65
Sex (male/female)
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
157
G4, G8, G14], depression [G2, G3, G6], and cognitive [P2, N5, N7, G10, G11]) [27, 28] were measured at baseline (week 0) and during antipsychotic treatment. Therapeutic efficacy was defined by the percent reduction in PANSS and fivefactor model scores over 8 weeks of antipsychotic treatment. Raters (JY-Z, YF-Y) were trained to administer the PANSS using the structured clinical interview for the PANSS [29] and achieved an inter-rater reliability of 0.80 or greater. Genotyping Genomic DNA was extracted from peripheral blood leucocytes using standard protocols. The miRNA137 host gene fragments containing the pri-miRNA137 gene fragment (part of exon 3, including pre-miRNA137) and the span containing the rs1625579 polymorphism were amplified by polymerase chain reaction (PCR) using two distinguishing primer pairs (Table 2). The conditions used for PCR amplification included an initial denaturation step at 95°C for 5 min, followed by 35 cycles of 95°C for 45 s, 58°C (pri-miRNA137) or 65°C (rs1625579) for 30 s, and 72°C for 30 s. The PCR products were separated on 1.5% agarose gels, and the fragments extracted with the TIANgel Midi Purification Kit (supplied by Tian Gen). The purified PCR products were directly sequenced using the same primers by an Applied Biosystems 3730xl DNA Sequencer. Genotype of rs1625579 and polymorphisms in pri-miRNA137 gene fragment containing a variable number of tandem repeats (VNTR, rs66642155) were analyzed by GENEWIZ Inc. in Peking. The location of rs1625579 and rs66642155 in miRNA137 host gene was shown in Figure 1. Statistical Analyses Differences in the genotype frequency distribution between case and control groups were tested for statistical significance by the Pearson chi-square (c2) test. The Kaplan-Meier method and the log-rank test for analysis of survival were used to examine the association of age at onset with genotype [30, 31]. The relationships between genotype and clinical variables were tested using student’s
Table 2. The Primers and Amplification Conditions for PCR Fragment
Sequence (5’-3’)
pri-miRNA137 F
ATAGAGCGGCCATTTGGATT
pri-miRNA137 R
TCAAGGCCTTTCAGTCGTTC
rs1625579 F
GATTCCAAAGGTCTCTAGTGTGC
rs1625579 R
TGAGAACATCATGGGGTCAC
Figure 1. The location of rs1625579 and rs66642155 in miRNA137 host gene. The locus of rs1625579 and rs66642155 was 98502934 and 98511734 of chromosome 1, respectively. The rs66642155 polymorphism, nearby the pre-miRNA137, located in exon 3 of the miRNA137 host gene.
158 / WANG ET AL.
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
159
t-tests. Pearson chi-square and t-tests were calculated using the SPSS 18.0 statistical package. To control for the possible confounding effect of gender and therapeutic drug, the groups were divided by gender and treatment and all factors retested. The interaction between genotype and gender was evaluated using the multifactor dimensionality reduction (MDR version1.1.0) software package (http://www.epistasis.org). All data including sample characteristics, age at onset, baseline symptoms, and therapeutic effect scores were expressed as mean ± SD. The Bonferroni correction was applied to avoid a type I error in the multiple tests [31]. All statistical tests were two-tailed, and P < 0.05 was the threshold level for statistical significance. RESULTS Association between miRNA137 Polymorphisms and Schizophrenia A total of eight polymorphisms were detected by alignment and mutation analyses in the two miRNA host gene fragments. However, the rs66642155 and rs1625579 polymorphisms were analyzed in this study because only the former had a minor allele frequency (MAF) greater than 0.05 in our sample and the latter was associated with schizophrenia in previous studies. The rs66642155 polymorphism, located in exon 3 of the miRNA137 host gene, is a VNTR of 15 bp (TAGCAGCGGCAGCGG). Different numbers of repeats were found in our samples (Table 3). Subjects were classified as wild type carriers (WT, no tandem repeats) or mutation carriers (MU) for at least one VNTR. The frequencies of the WT and MU genotypes were not significantly different between cases and controls (c2 = 0.739, P = 0.390), even when groups were divided by gender (data not shown). Only two genotypes of rs1625579 were detected in our samples (AA and CA), and the frequency distributions were not significantly different between cases (AA/CA = 269/31) and controls (AA/CA = 265/35, c2 = 0.272, P = 0.602). Tests for the Association between miRNA137 Polymorphisms and Age at Onset of Schizophrenia For the 212 patients (WT/MU = 135/77, male/female = 92/120) enrolled in this study with first-episode schizophrenia, age at onset was significantly older in WT rs66642155 carriers (WT: 28.56 ± 9.14 years; MU: 25.47 ± 8.16 years; t = 2.464, corrected P = 0.030; Figure 2). The age at onset was also significantly different between male and female patients (male: 25.97 ± 7.58 years; female: 28.56 ± 9.67 years; t = –2.118, P = 0.035), so we retested the rs66642155-age at onset association in separate male (WT/MU = 55/37) and female (WT/MU = 80/40) subgroups. There was no significant difference in age at onset between WT carriers and MU carriers in either sex (males: P = 0.166; females: P = 0.061).
160 / WANG ET AL.
Table 3. Rs66642155 Variable Number Tandem Repeats (VNTRs) of miRNA137 in Schizophrenic Patients and Controls N VNTRa
Case
Control
Classification
0, 0
191
202
WTb
0, 1
55
48
MUc
0, 2
29
25
MUc
0, 3
8
12
MUc
0, 4
4
0
MUc
0, 5
4
9
MUc
1, 1
6
1
MUc
1, 2
1
3
MUc
1, 4
2
0
MUc
aBoth of the alleles are expressed as the number of VNTRs, bWild type group, cMutation group.
Figure 2. The Kaplan-Meier plot showing the age at onset of schizophrenia. MU genotype of rs66642155 carriers has earlier age at onset of schizophrenia than WT carriers.
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
161
There was also no significant difference in age at onset between AA and CA genotypes of rs1625579 (P = 0.414). Associations between miRNA137 Polymorphisms and Both Symptom Profiles and Therapeutic Responses Genes related to age at onset are often also associated with symptom profiles or therapeutic responses [32, 33]. To investigate possible associations between rs6662155 and both baseline symptom severity and therapeutic response, we measured the PANSS and five-factor model scores before (baseline) and after 8 weeks of antipsychotic drug treatment. We found significant associations between the rs6662155 genotype (WT/MU) and both baseline (pre-treatment) PANSS total positive score and baseline five-factor model positive score (Table 4), with WT carriers exhibiting higher baseline positive scores than MU carriers. In addition, the delusions symptom (P1) score of the PANSS was also significantly higher in WT carriers (WT: 5.41 ± 0.95, MU: 4.61 ± 1.47; t = 4.276, corrected P < 0.001). In contrast, the baseline disturbance of volition symptom (G13) score was lower in WT carriers (WT: 3.76 ± 1.70, MU: 4.51 ± 1.46;
Table 4. Association rs66642155 Variant (WT/MU) with Baseline Symptoms Genotype WT (N = 135)
MU (N = 77)
t
Total
92.19 ± 13.24
90.60 ± 12.52
0.856
0.393
Positive symptom
26.67 ± 4.49
23.95 ± 6.09
3.425
0.001
Negative symptom
22.39 ± 6.24
22.78 ± 5.68
0.967
0.649
General symptom
43.13 ± 7.40
43.87 ± 7.04
0.870
0.479
Positive factor
19.85 ± 3.94
17.04 ± 4.59
4.704
< 0.001
Negative factor
20.59 ± 5.99
21.19 ± 5.81
–0.720
0.472
Excitement factor
15.76 ± 4.79
15.66 ± 5.53
0.139
0.890
Depression factor
5.72 ± 2.37
5.42 ± 2.26
0.910
0.364
12.24 ± 3.51
12.26 ± 3.11
–0.032
0.975
Characteristics
P-value
PANSS scores
Five-factor model scores
Cognitive factor
Note: Boldface letters represent that the Bonferroni corrected P-values are less than 0.05.
162 / WANG ET AL.
t = –3.380, corrected P = 0.002). These associations were then retested after dividing the patient group by sex or therapeutic drug. In male patients, there were still significant differences in baseline total PANSS positive score (WT: 26.44 ± 3.90, MU: 22.89 ± 6.27; t = 3.064, corrected P = 0.006), five-factor positive score (WT: 20.11 ± 3.86, MU: 16.38 ± 4.40; t = 4.298, corrected P < 0.001), and P1 (WT: 5.38 ± 0.89, MU: 4.46 ± 1.50; t = 3.358, corrected P = 0.002) between WT and MU genotypes. However, only P1 (WT: 5.43 ± 0.99, MU: 4.75 ± 1.45; t = 2.658, corrected P = 0.020) and G13 (WT: 3.76 ± 1.77, MU: 4.54 ± 1.59; t = –2.317, corrected P = 0.044) were significantly different between female WT and MU carriers. The percent reductions in PANSS and five-factor model scores were not significantly different between WT and MU carriers following 8 weeks of drug treatment (Table 5), indicating that the rs6662155 genotype had no effect on antipsychotic efficacy. No association was found when patients were divided by treatment. Finally, no significant differences were found in either symptom profile or therapeutic response between AA and CA genotypes of rs1625579 (data not shown).
Table 5. Association rs66642155 Variant (WT/MU) with Therapeutic Effects in 8-Week Therapy Genotype WT (N = 135)
MU (N = 77)
t
P-value
Total
0.66 ± 0.20
0.67 ± 0.22
–0.124
0.901
Positive symptom
0.76 ± 0.20
0.73 ± 0.29
0.769
0.443
Negative symptom
0.56 ± 0.30
0.61 ± 0.27
–1.193
0.234
General symptom
0.65 ± 0.21
0.67 ± 0.22
–0.607
0.545
Positive factor
0.53 ± 0.18
0.47 ± 0.22
2.165
0.032
Negative factor
0.38 ± 0.21
0.41 ± 0.22
–0.962
0.337
Excitement factor
0.54 ± 0.18
0.49 ± 0.29
1.295
0.198
Depression factor
0.22 ± 0.25
0.22 ± 0.28
–0.086
0.932
Cognitive factor
0.37 ± 0.19
0.40 ± 0.17
–1.257
0.210
Characteristics Percentage reduction in PANSS scores
Percentage reduction in Five-factor model scores
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
163
Interaction Analysis The analyses above demonstrated that both rs66642155 polymorphism and gender were associated with age at onset of schizophrenia. We further examined the interaction between genotype and gender using MDR analysis, but no evidence for an interaction was detected (OR = 1.608, 95% CI = (0.919, 2.813), c2 = 2.789, P = 0.095). DISCUSSION MicroRNA137 has a well-established role in carcinogenesis [34-37], and a recent GWAS also implicated miRNA137 in psychiatric disorders. A microdeletion of chromosome 1p21.3, which includes miRNA137, is associated with intellectual disability [38] and a GWAS found an association between miRNA137 and schizophrenia in a multiregional population [24]. In contrast, we found no significant association between schizophrenia and either miRNA137 polymorphism analyzed, possibly due to the different ethnic populations studied (Americans, Europeans, and Australians versus Han Chinese). In fact, the International HapMap Project found significant differences in schizophrenia susceptibility and the distributions of the various miRNA137 genotypes among these populations. However, many genes that do not alter the susceptibility to schizophrenia may still influence clinical features in schizophrenia patients [39, 40]. Age at onset is considered the single most valuable clue to the etiology of schizophrenia [30]. A genome-wide linkage study conducted by Cardno et al. [41] confirmed a genetic contribution to the age at onset of schizophrenia and our study identified one possible contributor, the rs66642155 polymorphism in miRNA137. Although we did not find an independent association in males or females, or an interaction between miRNA137 polymorphisms and gender, this finding suggests that rs66642155 is a potential genetic factor influencing the prodromal changes that result in schizophrenia. In addition to our results demonstrating an association between the rs66642155 variant of miRNA137 and positive schizophrenic symptoms, Green et al. [42] provided evidence for an association between the miRNA137 SNP rs1625579 and another schizophrenia phenotype characterized by severe cognitive deficits and negative symptoms. In the present study, we found that the positive and delusional symptoms (P1) were more severe in schizophrenic patients carrying the WT allele of rs66642155, while the disturbance in volition was milder in WT carriers. Thus, different allelic variants of miRNA137 may have distinct effects on symptom expression. However, both the symptom assessment scales used and the demographic characteristics of the patient populations differed between these two studies. From our results, we infer that the MU genotype of rs66642155 may actually protect against the onset of positive symptom, while the WT genotype
164 / WANG ET AL.
protects against disturbances of volition. Identifying the full spectrum of miRNA137 targets and how these different miRNA137 variants alter the expression of target genes may provide mechanistic insight into the positive, delusional, volitional, and cognitive symptoms of schizophrenia. The VNTR, rs66642155, within miRNA137 alter the secondary structure of the pri-miRNA137 and interfere with the processing and function of mature miRNA137 transcripts [37]. MicroRNA137 regulates neuronal maturation and adult neurogenesis [43, 44], so deficits in miRNA137 function could contribute to the developmental abnormalities observed in the schizophrenic brain [24]. We speculate that miRNA137 polymorphisms may influence the clinical characteristics of schizophrenia by disrupting the regulation of at least three target genes. First, changes in miRNA137 structure/function may alter the transcriptional activity of transcription factor 4 (TCF4) gene, which has been implicated in neurogenesis [45, 46]. Second, miRNA137 regulates neuronal maturation and dendritic morphogenesis by targeting the ubiquitin ligase mind bomb-1 (Mib1) mRNA [44]. Third, the histone lysine-specific demethylase 1 (LSD1) gene is also a target of miRNA137, and changes in LSD1 expression can alter the proliferation and differentiation of neural stem cells [47]. In fact, reduced neural stem cell proliferation has been implicated in the pathogenesis of schizophrenia [48]. Furthermore, polymorphisms in miRNA137-targeted genes such as TCF4 have also been associated with schizophrenia [49]. Schizophrenia has a complex and variable clinical phenotype, so the specific makeup of the patient population, including clinical subtypes, gender ratio, age distribution, and treatment histories, can substantially impact the results of association studies [50]. In this study, we report the first evidence for significant associations between the rs66642155 VNTR polymorphism of miRNA137 and both age at onset and positive symptom expression. However, this study focused on only two polymorphisms, while eight distinct miRNA137 polymorphisms were found in our samples, any of which could potentially influence disease phenotype. Furthermore, while the time-consuming structured clinical interviews confirmed the mental health status of our subjects, they also limited the feasible sample size. Finally, although we stratified the control and patient populations by gender and therapeutic drug, many other unaccounted factors may also interact with rs66642155 to influence phenotype, again underscoring the need for larger-scale studies. Whether rs66642155 and other miRNA137 variants are reliable genetic markers for specific clinical features of schizophrenia warrants further study, especially as such data may help improve early treatment decisions. Despite the aforementioned uncertainties, this study adds to a growing body of work suggesting that miRNA137 polymorphisms influence the clinical characteristics of schizophrenia. The effects of these miRNA variants on target gene expression and function may yield considerable insight into the pathogenesis of schizophrenic symptoms.
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
165
ACKNOWLEDGMENTS The authors thank Yi He (Sichuan University, Chengdu, China), who assisted with data analysis and the proof-reading of this manuscript. REFERENCES 1. Andreasen NC. Symptoms, signs, and diagnosis of schizophrenia. Lancet 1995; 346(8973):477-481. 2. Shi J, Levinson DF, Duan J, Sanders AR, Zheng Y, Peâ I. Common variants on chromosome 6p22.1 are associated with schizophrenia. Nature 2009;460(7256): 753-757. 3. Perkins D, Jeffries C, Sullivan P. Expanding the “central dogma”: The regulatory role of nonprotein coding genes and implications for the genetic liability to schizophrenia. Molecular Psychiatry 2004;10(1):69-78. 4. He L, Hannon GJ. MicroRNAs: Small RNAs with a big role in gene regulation. National Review of Genetics 2004;5(7):522-531. 5. Perkins DO, Jeffries CD, Jarskog LF, Thomson JM, Woods K, Newman MA, Parker JS, Jin J, Hammond SM. microRNA expression in the prefrontal cortex of individuals with schizophrenia and schizoaffective disorder. Genome Biology 2007;8(2):R27. 6. Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Development 2006;20(5):515-524. 7. Farh KKH, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Science 2005;310(5755):1817-1821. 8. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005;120(1): 15-20. 9. Griffiths-Jones S, Grocock RJ, Van Dongen S, Bateman A, Enright AJ. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Research 2006; 34(suppl 1):D140-D144. 10. Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, MacDonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P. A pancreatic islet-specific microRNA regulates insulin secretion. Nature 2004;432(7014):226-230. 11. Xu P, Guo M, Hay BA. MicroRNAs and the regulation of cell death. Trends in Genetics 2004;20(12):617-624. 12. Hammond SM. MicroRNA therapeutics: A new niche for antisense nucleic acids. Trends in Molecular Medicine 2006;12(3):99-101. 13. Gottwein E, Cai X, Cullen BR. A novel assay for viral microRNA function identifies a single nucleotide polymorphism that affects Drosha processing. Journal of Virology 2006;80(11):5321-5326. 14. Duan R, Pak CH, Jin P. Single nucleotide polymorphism associated with mature miR-125a alters the processing of pri-miRNA. Human Molecular Genetics 2007; 16(9):1124-1131. 15. Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K. Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. Science 2007;315(5815):1137-1140.
166 / WANG ET AL.
16. Saunders MA, Liang H, Li WH. Human polymorphism at microRNAs and microRNA target sites. Proceedings of the National Academy of Science USA 2007; 104(9):3300-3305. 17. Abelson JF, Kwan KY, O’Roak BJ, Baek DY, Stillman AA, Morgan TM, Mathews CA, Pauls DL, Rašin MR, Gunel M. Sequence variants in SLITRK1 are associated with Tourette’s syndrome. Science 2005;310(5746):317-320. 18. Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, Ambros V. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biology 2004;5(3):R13. 19. Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF. MicroRNAs regulate brain morphogenesis in zebrafish. Science 2005;308(5723):833-838. 20. Krichevsky AM, King KS, Donahue CP, Khrapko K, Kosik KS. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA 2003;9(10):1274-1281. 21. Schratt GM, Tuebing F, Nigh EA, Kane CG, Sabatini ME, Kiebler M, Greenberg ME. A brain-specific microRNA regulates dendritic spine development. Nature 2006; 439(7074):283-289. 22. Vo N, Klein ME, Varlamova O, Keller DM, Yamamoto T, Goodman RH, Impey S. A cAMP-response element binding protein-induced microRNA regulates neuronal morphogenesis. Proceedings of the National Academy of Science USA 2005;102(45): 16426-16431. 23. Sun G, Yan J, Noltner K, Feng J, Li H, Sarkis DA, Sommer SS, Rossi JJ. SNPs in human miRNA genes affect biogenesis and function. RNA 2009;15(9):1640-1651. 24. Ripke S, Sanders AR, Kendler KS, Levinson DF, Sklar P, Holmans PA, Lin DY, Duan J, Ophoff RA, Andreassen OA. Genome-wide association study identifies five new schizophrenia loci. National Genetics 2011;43(10):969-976. 25. Lett TA, Chakavarty MM, Felsky D, Brandl EJ, Tiwari AK, Gonçalves VF, Rajji TK, Daskalakis ZJ, Meltzer HY, Lieberman JA. The genome-wide supported microRNA-137 variant predicts phenotypic heterogeneity within schizophrenia. Molecular Psychiatry 2013;18(4):443-450. 26. Wright C, Turner JA, Calhoun VD, Perrone-Bizzozero N. Potential impact of miR-137 and its targets in schizophrenia. Front Genetics 2013;4(58):1-16. 27. Xiao B, Li W, Zhang H, Lv L, Song X, Yang Y, Yang G, Jiang C, Zhao J. To the Editor: Association of ZNF804A polymorphisms with schizophrenia and antipsychotic drug efficacy in a Chinese Han population. Psychiatry Research 2011; 190(2):379-381. 28. Lykouras L, Oulis P, Psarros K, Daskalopoulou E, Botsis A, Christodoulou GN, Stefanis C. Five-factor model of schizophrenic psychopathology: How valid is it? European Archives of Psychiatry and Clinical Neuroscience 2000;250(2):93-100. 29. Kay SR, Opler LA, Lindenmayer JP. Reliability and validity of the positive and negative syndrome scale for schizophrenics. Psychiatry Research 1988;23(1): 99-110. 30. Anttila S, Kampman O, Illi A, Roivas M, Mattila KM, Lassila V, Lehtimäki T, Leinonen E. NOTCH4 gene promoter polymorphism is associated with the age of onset in schizophrenia. Psychiatry and Genetics 2003;13(2):61-64.
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
167
31. Wang S, Li W, Zhao J, Zhang H, Yang Y, Wang X, Yang G, Lv L. Association of estrogen receptor alpha gene polymorphism with age at onset, general psychopathology symptoms, and therapeutic effect of schizophrenia. Behavior and Brain Function 2013;9(1):1-12. 32. Krebs M, Guillin O, Bourdell M, Schwartz J, Olie J, Poirier M, Sokoloff P. Brain derived neurotrophic factor (BDNF) gene variants association with age at onset and therapeutic response in schizophrenia. Molecular Psychiatry 2000;5(5): 558-562. 33. Numata S, Ueno S, Iga J, Yamauchi K, Hongwei S, Ohta K, Kinouchi S, Shibuya-Tayoshi S, Tayoshi S, Aono M. Brain-derived neurotrophic factor (BDNF) Val66Met polymorphism in schizophrenia is associated with age at onset and symptoms. Neuroscience Letters 2006;401(1-2):1-5. 34. Silber J, Lim DA, Petritsch C, Persson AI, Maunakea AK, Yu M, Vandenberg SR, Ginzinger DG, James CD, Costello JF. miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells. BMC Medicine 2008. doi: 10.1186/1741-7015-6-14 35. Liu M, Lang N, Qiu M, Xu F, Li Q, Tang Q, Chen J, Chen X, Zhang S, Liu Z. miR-137 targets Cdc42 expression, induces cell cycle G1 arrest and inhibits invasion in colorectal cancer cells. International Journal of Cancer 2010;128(6):1269-1279. 36. Balaguer F, Link A, Lozano JJ, Cuatrecasas M, Nagasaka T, Boland CR, Goel A. Epigenetic silencing of miR-137 is an early event in colorectal carcinogenesis. Cancer Research 2010;70(16):6609-6618. 37. Bemis LT, Chen R, Amato CM, Classen EH, Robinson SE, Coffey DG, Erickson PF, Shellman YG, Robinson WA. MicroRNA-137 targets microphthalmiaassociated transcription factor in melanoma cell lines. Cancer Research 2008;68(5): 1362-1368. 38. Willemsen MH, Vallès A, Kirkels LAMH, Mastebroek M, Loohuis NO, Kos A, Wissink-Lindhout WM, de Brouwer APM, Nillesen WM, Pfundt R. Chromosome 1p21. 3 microdeletions comprising DPYD and MIR137 are associated with intellectual disability. Journal of Medicine and Genetics 2011;48(12):810-818. 39. Fanous A, Kendler K. Genetic heterogeneity, modifier genes, and quantitative phenotypes in psychiatric illness: Searching for a framework. Molecular Psychiatry 2005;10(1):6-13. 40. Li WJ, Kou CG, Yu Y, Sun S, Zhang X, Kosten TR, Zhang XY. Association of Catechol-O-methyltransferase gene polymorphisms with schizophrenia and negative symptoms in a Chinese population. American Journal of Medical Genetics: Series B Neuropsychiatric Genetics 2012;159B(4):370-375. 41. Cardno AG, Holmans PA, Rees MI, Jones LA, McCarthy GM, Hamshere MI, Williams MN, Norton N, Williams HJ, Fenton I. A. Genomewide linkage study of age at onset in schizophrenia. American Journal of Medical Genetics 2001;105:439-445. 42. Green M, Cairns M, Wu J, Dragovic M, Jablensky A, Tooney P, Scott R, Carr V. Genome-wide supported variant MIR137 and severe negative symptoms predict membership of an impaired cognitive subtype of schizophrenia. Molecular Psychiatry 2012. doi: 10.1038/mp.2012.84 43. Szulwach KE, Li X, Smrt RD, Li Y, Luo Y, Lin L, Santistevan NJ, Li W, Zhao X, Jin P. Cross talk between microRNA and epigenetic regulation in adult neurogenesis. Journal of Cellular Biology 2010;189(1):127-141.
168 / WANG ET AL.
44. Smrt RD, Szulwach KE, Pfeiffer RL, Li X, Guo W, Pathania M, Teng ZQ, Luo Y, Peng J, Bordey A. MicroRNA miR-137 regulates neuronal maturation by targeting Ubiquitin Ligase Mind Bomb-1. Stem Cells 2010;28(6):1060-1070. 45. Kwon E, Wang W, Tsai L. Validation of schizophrenia-associated genes CSMD1, C10orf26, CACNA1C and TCF4 as miR-137 targets. Molecular Psychiatry 2011. doi: 10.1038/mp.2011.170 46. Blake DJ, Forrest M, Chapman RM, Tinsley CL, O’Donovan MC, Owen MJ. TCF4, schizophrenia, and Pitt-Hopkins syndrome. Schizophrenia Bulletin 2010; 36(3):443-447. 47. Sun GQ, Ye P, Murai K, Lang MF, Li S, Zhang H, Li W, Fu C, Yin J, Wang A. miR-137 forms a regulatory loop with nuclear receptor TLX and LSD1 in neural stem cells. National Community 2011. doi: 10.1038/ncomms1532 48. Reif A, Fritzen S, Finger M, Strobel A, Lauer M, Schmitt A, Lesch K. Neural stem cell proliferation is decreased in schizophrenia, but not in depression. Molecular Psychiatry 2006;11(5):514-522. 49. Stefansson H, Ophoff RA, Steinberg S, Andreassen OA, Cichon S, Rujescu D, Werge T, Pietiläinen OPH, Mors O, Mortensen PB. Common variants conferring risk of schizophrenia. Nature 2009;460(7256):744-747. 50. Li W, Wang X, Zhao J, Lin J, Song XQ, Yang Y, Jiang C, Xiao B, Yang G, Zhang HX. Association study of myelin transcription factor 1-like polymorphisms with schizophrenia in Han Chinese population. Genes and Brain Behavior 2012;11(1):87-93.
Direct reprint requests to: Dr. Luxian Lv Department of Psychiatry of the Second Affiliated Hospital of Xinxiang Medical University No. 388, Jianshe Middle Road Xinxiang, 453002, China e-mail: [email protected]
ASSOCIATION OF microRNA137 GENE POLYMORPHISMS WITH AGE AT ONSET AND POSITIVE SYMPTOMS OF SCHIZOPHRENIA IN A HAN CHINESE POPULATION* SHUAI WANG† WENQIANG LI† HONGXING ZHANG XIUJUAN WANG Henan Mental Hospital, The Second Affiliated Hospital of Xinxiang Medical University, Xinxiang, China; and Xinxiang Medical University, Xinxiang, China GE YANG JINGYUAN ZHAO Henan Mental Hospital, The Second Affiliated Hospital of Xinxiang Medical University, Xinxiang, China YONGFENG YANG LUXIAN LV Henan Mental Hospital, The Second Affiliated Hospital of Xinxiang Medical University, Xinxiang, China; and Xinxiang Medical University, Xinxiang, China
*Funding for this study was provided by the National Natural Science Foundation of China (No. 81071091, to L-LX; No. 81201040, to L-WQ), the Natural Science Foundation of Henan (No. 112300413226 to L-LX, 122300413212 to L-WQ), the Postgraduate Scientific Research Innovative Program of Xinxiang Medical University (No. YJSCX201109Z to W-S), the Program for New Century Excellent Talents in University (NCET-10-0137 to Z-HX), and the Scientific Research Program of Xinxiang Medical University (No. ZD2011-20 to L-WQ). †Contributed equally. 153 Ó 2014, Baywood Publishing Co., Inc. doi: http://dx.doi.org/10.2190/PM.47.2.f http://baywood.com
154 / WANG ET AL. ABSTRACT
Objectives: MicroRNA137 (miRNA137) regulates several gene expressions involved in brain development, and a recent large genome wide association study (GWAS) revealed a possible association between miRNA137 and schizophrenia. Methods: The allelic variants of rs66642155, a variable number tandem repeat polymorphism, and the single nucleotide polymorphism rs1625579 A/C in the miRNA137 host gene fragment were compared between 300 schizophrenic patients and 300 healthy controls from the Han Chinese population. The association of these polymorphisms with clinical characteristics of schizophrenia was also tested. Results: Genotype and allele frequencies of these polymorphisms were not significantly different between patient and control populations. In patients, however, age at onset was much later in wild type rs66642155 carriers than in mutation carriers. Total positive score on the Positive and Negative Symptom Scale (PANSS), total five-factor model positive score, and the delusions symptom score were all significantly higher in wild type rs66642155 carriers with schizophrenia, while the disturbance of volition symptom score was significantly higher in the mutation carriers with schizophrenia. Conclusions: MiRNA137 may not be a significant susceptibility gene for schizophrenia, but in patients, rs66642155 allelic variant of miRNA137 appears to influence age at onset and the severity of positive symptoms. (Int’l. J. Psychiatry in Medicine 2014;47:153-168)
Key Words: MiRNA137, association, schizophrenia, age at onset, positive symptom
INTRODUCTION Schizophrenia is characterized by a variety of perceptual, cognitive, social, emotional, linguistic, and motivational disturbances that are differentially expressed in individual patients [1]. While schizophrenia has a major genetic component, it is both etiologically and clinically complex. Genetic studies of schizophrenia have long focused on protein coding genes, and while over 1000 schizophrenia susceptibility genes have been proposed, there remains no set of confirmed “causal” schizophrenic genes [2]. In addition to protein coding genes, the genome encodes a multitude of reguatory RNAs that have also been linked to disease, including schizophrenia and schizo-affective disorder [3]. MicroRNAs (miRNAs) are small non-coding gene transcripts involved in post-transcriptional gene regulation [4]. A primary miRNA (pri-miRNA) is first transcribed from the miRNA host gene by Pol II, forms a smaller hairpin-like structure called a precursor miRNA (pre-miRNA), and finally is processed by Dicer to the 21 to 25 nucleotide functional miRNA [5]. MicroRNAs control mRNA stability and translation by binding to complementary sequence motifs in the 3’-UTR of target mRNAs [6]. Individual miRNAs regulate
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
155
the expression of multiple genes and so have pleiotrophic effects on many cellular processes [7, 8]. This pleiotropy may also confer a highly complex relationship between miRNA expression, allelic variation or mutation, and disease characteristics. New miRNAs are continually being discovered [9] and shown to modulate critical biological functions, such as insulin secretion [10] and apoptosis [11]. Often referred to as the “micromanagers of gene expression,” miRNAs have also been linked to several human diseases [12]. These associations may stem from either variations in the miRNA sequence [13, 14] or the target mRNA sequence [15, 16]. For example, Tourette’s syndrome has been linked to deletions and mutations in the 3’-UTR of the SLITRK1 mRNA, a target site for regulation by miR-189 [17]. Approximately one-third of all known miRNAs are expressed in the brain [18] where they regulate brain development [19, 20], synaptic plasticity [21], and neuronal differentiation [22]. Allelic variation or mutations in these miRNAs may alter brain development or plasticity, leading to the neurological deficits associated with schizophrenia. Indeed, Sun et al. [23] reported an association between schizophrenia and the miR-502-C/G and miR-510-T/C polymorphisms. The largest genome wide association study (GWAS) to date, which included over 40,000 individuals, identified a strong association between schizophrenia and rs1625579, a polymorphism located within an intron of the miRNA137 host gene (1p21.3) [24]. MicroRNA137 has been seen as a regulator of neural stem cell maturation, migration, and gliogenesis [25]. Furthermore, it might be associated with cognitive function, and targeted many schizophrenia risk genes, such as ZNF804A, TCF4, CSMD1, and so on [26]. Thus, miRNA137 would have a critical role for the phenotypic expression of schizophrenia. In this study, we investigated potential associations between schizophrenia and miRNA137 allelic variants. We also tested whether these polymorphisms were associated with specific clinical characteristics of schizophrenia. MATERIALS AND METHODS Subjects Three hundred confirmed schizophrenic inpatients, including 212 first episode patients, were recruited from the Second Affiliated Hospital of Xinxiang Medical University. The patients were diagnosed in accordance with DSM-IV criteria by at least two experienced psychiatrists on the basis of structured clinical interviews or medical records. Antipsychotic drug treatment consisted mainly of monotherapy with aripiprazole (Abilify) (n = 165) or risperidone (Risperdal) (n = 135) at an average daily dose of 5.1 ± 1.9 mg/day (mean ± SD) in risperidone equivalents. Three hundred healthy controls without personal or family histories of psychiatric illness or other complex disorders, including diabetes, hypertension,
156 / WANG ET AL.
immunological diseases, and tumors, were the students from Xinxiang Medical University and healthy subjects from Hospitals in Xinxiang, and selected through a screening using the Structured Clinical Interview (SCID) for DSM-IV. The controls were well matched to the patient group for gender ratio, age, and ethnicity (all participants in the study were unrelated Han Chinese born and living in North Henan province, and all of their biological grandparents were Han Chinese). General demographic and basic clinical characteristics of participants are shown in Table 1. There were no significant differences in demographic or clinical variables between groups or genders. All subjects gave their written informed consent prior to participation in this study after they fully understood the purpose and procedures. The patients’ capacity to sign the informed consent was based on the judgment of their clinician. If a patient was unable to give informed consent, it was signed by his/her caregiver. All study protocols were approved by the Institutional Review Board of the Second Affiliated Hospital of Xinxiang Medical University. Clinical Measures The age at which an individual was first diagnosed or experienced the first symptoms of schizophrenia was defined as the age at onset. The Positive and Negative Symptom Scale (PANSS) was administered by two experienced psychiatrists to assess the severity of psychopathology. The severity of each symptom was scored from 1 to 7 (1 = absent, 2 = minimal, 3 = mild, 4 = moderate, 5 = moderate/severe, 6 = severe, 7 = extreme). The PANSS scores (total, positive, negative, and general) and five-factor model scores derived from PANSS (positive [P1, P3, P5, P6, G9], negative [N1, N2, N3, N4, N6, G7], excitement [P4, P7,
Table 1. General Characteristics of Study Groups Group Characteristics
Case
Control
150/150
150/150
Age (years)
31.70 ± 9.62
31.52 ± 8.93
BMI (kg/m2)
23.57 ± 6.28
23.11 ± 4.80
CHO (mm/L)
3.94 ± 0.81
3.76 ± 0.79
TG (mm/L)
1.13 ± 0.63
1.24 ± 0.34
HDL (mm/L)
1.22 ± 0.32
1.17 ± 0.29
LDL (mm/L)
2.32 ± 0.63
2.20 ± 0.68
Glu (mm/L)
4.58 ± 0.62
4.46 ± 0.65
Sex (male/female)
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
157
G4, G8, G14], depression [G2, G3, G6], and cognitive [P2, N5, N7, G10, G11]) [27, 28] were measured at baseline (week 0) and during antipsychotic treatment. Therapeutic efficacy was defined by the percent reduction in PANSS and fivefactor model scores over 8 weeks of antipsychotic treatment. Raters (JY-Z, YF-Y) were trained to administer the PANSS using the structured clinical interview for the PANSS [29] and achieved an inter-rater reliability of 0.80 or greater. Genotyping Genomic DNA was extracted from peripheral blood leucocytes using standard protocols. The miRNA137 host gene fragments containing the pri-miRNA137 gene fragment (part of exon 3, including pre-miRNA137) and the span containing the rs1625579 polymorphism were amplified by polymerase chain reaction (PCR) using two distinguishing primer pairs (Table 2). The conditions used for PCR amplification included an initial denaturation step at 95°C for 5 min, followed by 35 cycles of 95°C for 45 s, 58°C (pri-miRNA137) or 65°C (rs1625579) for 30 s, and 72°C for 30 s. The PCR products were separated on 1.5% agarose gels, and the fragments extracted with the TIANgel Midi Purification Kit (supplied by Tian Gen). The purified PCR products were directly sequenced using the same primers by an Applied Biosystems 3730xl DNA Sequencer. Genotype of rs1625579 and polymorphisms in pri-miRNA137 gene fragment containing a variable number of tandem repeats (VNTR, rs66642155) were analyzed by GENEWIZ Inc. in Peking. The location of rs1625579 and rs66642155 in miRNA137 host gene was shown in Figure 1. Statistical Analyses Differences in the genotype frequency distribution between case and control groups were tested for statistical significance by the Pearson chi-square (c2) test. The Kaplan-Meier method and the log-rank test for analysis of survival were used to examine the association of age at onset with genotype [30, 31]. The relationships between genotype and clinical variables were tested using student’s
Table 2. The Primers and Amplification Conditions for PCR Fragment
Sequence (5’-3’)
pri-miRNA137 F
ATAGAGCGGCCATTTGGATT
pri-miRNA137 R
TCAAGGCCTTTCAGTCGTTC
rs1625579 F
GATTCCAAAGGTCTCTAGTGTGC
rs1625579 R
TGAGAACATCATGGGGTCAC
Figure 1. The location of rs1625579 and rs66642155 in miRNA137 host gene. The locus of rs1625579 and rs66642155 was 98502934 and 98511734 of chromosome 1, respectively. The rs66642155 polymorphism, nearby the pre-miRNA137, located in exon 3 of the miRNA137 host gene.
158 / WANG ET AL.
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
159
t-tests. Pearson chi-square and t-tests were calculated using the SPSS 18.0 statistical package. To control for the possible confounding effect of gender and therapeutic drug, the groups were divided by gender and treatment and all factors retested. The interaction between genotype and gender was evaluated using the multifactor dimensionality reduction (MDR version1.1.0) software package (http://www.epistasis.org). All data including sample characteristics, age at onset, baseline symptoms, and therapeutic effect scores were expressed as mean ± SD. The Bonferroni correction was applied to avoid a type I error in the multiple tests [31]. All statistical tests were two-tailed, and P < 0.05 was the threshold level for statistical significance. RESULTS Association between miRNA137 Polymorphisms and Schizophrenia A total of eight polymorphisms were detected by alignment and mutation analyses in the two miRNA host gene fragments. However, the rs66642155 and rs1625579 polymorphisms were analyzed in this study because only the former had a minor allele frequency (MAF) greater than 0.05 in our sample and the latter was associated with schizophrenia in previous studies. The rs66642155 polymorphism, located in exon 3 of the miRNA137 host gene, is a VNTR of 15 bp (TAGCAGCGGCAGCGG). Different numbers of repeats were found in our samples (Table 3). Subjects were classified as wild type carriers (WT, no tandem repeats) or mutation carriers (MU) for at least one VNTR. The frequencies of the WT and MU genotypes were not significantly different between cases and controls (c2 = 0.739, P = 0.390), even when groups were divided by gender (data not shown). Only two genotypes of rs1625579 were detected in our samples (AA and CA), and the frequency distributions were not significantly different between cases (AA/CA = 269/31) and controls (AA/CA = 265/35, c2 = 0.272, P = 0.602). Tests for the Association between miRNA137 Polymorphisms and Age at Onset of Schizophrenia For the 212 patients (WT/MU = 135/77, male/female = 92/120) enrolled in this study with first-episode schizophrenia, age at onset was significantly older in WT rs66642155 carriers (WT: 28.56 ± 9.14 years; MU: 25.47 ± 8.16 years; t = 2.464, corrected P = 0.030; Figure 2). The age at onset was also significantly different between male and female patients (male: 25.97 ± 7.58 years; female: 28.56 ± 9.67 years; t = –2.118, P = 0.035), so we retested the rs66642155-age at onset association in separate male (WT/MU = 55/37) and female (WT/MU = 80/40) subgroups. There was no significant difference in age at onset between WT carriers and MU carriers in either sex (males: P = 0.166; females: P = 0.061).
160 / WANG ET AL.
Table 3. Rs66642155 Variable Number Tandem Repeats (VNTRs) of miRNA137 in Schizophrenic Patients and Controls N VNTRa
Case
Control
Classification
0, 0
191
202
WTb
0, 1
55
48
MUc
0, 2
29
25
MUc
0, 3
8
12
MUc
0, 4
4
0
MUc
0, 5
4
9
MUc
1, 1
6
1
MUc
1, 2
1
3
MUc
1, 4
2
0
MUc
aBoth of the alleles are expressed as the number of VNTRs, bWild type group, cMutation group.
Figure 2. The Kaplan-Meier plot showing the age at onset of schizophrenia. MU genotype of rs66642155 carriers has earlier age at onset of schizophrenia than WT carriers.
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
161
There was also no significant difference in age at onset between AA and CA genotypes of rs1625579 (P = 0.414). Associations between miRNA137 Polymorphisms and Both Symptom Profiles and Therapeutic Responses Genes related to age at onset are often also associated with symptom profiles or therapeutic responses [32, 33]. To investigate possible associations between rs6662155 and both baseline symptom severity and therapeutic response, we measured the PANSS and five-factor model scores before (baseline) and after 8 weeks of antipsychotic drug treatment. We found significant associations between the rs6662155 genotype (WT/MU) and both baseline (pre-treatment) PANSS total positive score and baseline five-factor model positive score (Table 4), with WT carriers exhibiting higher baseline positive scores than MU carriers. In addition, the delusions symptom (P1) score of the PANSS was also significantly higher in WT carriers (WT: 5.41 ± 0.95, MU: 4.61 ± 1.47; t = 4.276, corrected P < 0.001). In contrast, the baseline disturbance of volition symptom (G13) score was lower in WT carriers (WT: 3.76 ± 1.70, MU: 4.51 ± 1.46;
Table 4. Association rs66642155 Variant (WT/MU) with Baseline Symptoms Genotype WT (N = 135)
MU (N = 77)
t
Total
92.19 ± 13.24
90.60 ± 12.52
0.856
0.393
Positive symptom
26.67 ± 4.49
23.95 ± 6.09
3.425
0.001
Negative symptom
22.39 ± 6.24
22.78 ± 5.68
0.967
0.649
General symptom
43.13 ± 7.40
43.87 ± 7.04
0.870
0.479
Positive factor
19.85 ± 3.94
17.04 ± 4.59
4.704
< 0.001
Negative factor
20.59 ± 5.99
21.19 ± 5.81
–0.720
0.472
Excitement factor
15.76 ± 4.79
15.66 ± 5.53
0.139
0.890
Depression factor
5.72 ± 2.37
5.42 ± 2.26
0.910
0.364
12.24 ± 3.51
12.26 ± 3.11
–0.032
0.975
Characteristics
P-value
PANSS scores
Five-factor model scores
Cognitive factor
Note: Boldface letters represent that the Bonferroni corrected P-values are less than 0.05.
162 / WANG ET AL.
t = –3.380, corrected P = 0.002). These associations were then retested after dividing the patient group by sex or therapeutic drug. In male patients, there were still significant differences in baseline total PANSS positive score (WT: 26.44 ± 3.90, MU: 22.89 ± 6.27; t = 3.064, corrected P = 0.006), five-factor positive score (WT: 20.11 ± 3.86, MU: 16.38 ± 4.40; t = 4.298, corrected P < 0.001), and P1 (WT: 5.38 ± 0.89, MU: 4.46 ± 1.50; t = 3.358, corrected P = 0.002) between WT and MU genotypes. However, only P1 (WT: 5.43 ± 0.99, MU: 4.75 ± 1.45; t = 2.658, corrected P = 0.020) and G13 (WT: 3.76 ± 1.77, MU: 4.54 ± 1.59; t = –2.317, corrected P = 0.044) were significantly different between female WT and MU carriers. The percent reductions in PANSS and five-factor model scores were not significantly different between WT and MU carriers following 8 weeks of drug treatment (Table 5), indicating that the rs6662155 genotype had no effect on antipsychotic efficacy. No association was found when patients were divided by treatment. Finally, no significant differences were found in either symptom profile or therapeutic response between AA and CA genotypes of rs1625579 (data not shown).
Table 5. Association rs66642155 Variant (WT/MU) with Therapeutic Effects in 8-Week Therapy Genotype WT (N = 135)
MU (N = 77)
t
P-value
Total
0.66 ± 0.20
0.67 ± 0.22
–0.124
0.901
Positive symptom
0.76 ± 0.20
0.73 ± 0.29
0.769
0.443
Negative symptom
0.56 ± 0.30
0.61 ± 0.27
–1.193
0.234
General symptom
0.65 ± 0.21
0.67 ± 0.22
–0.607
0.545
Positive factor
0.53 ± 0.18
0.47 ± 0.22
2.165
0.032
Negative factor
0.38 ± 0.21
0.41 ± 0.22
–0.962
0.337
Excitement factor
0.54 ± 0.18
0.49 ± 0.29
1.295
0.198
Depression factor
0.22 ± 0.25
0.22 ± 0.28
–0.086
0.932
Cognitive factor
0.37 ± 0.19
0.40 ± 0.17
–1.257
0.210
Characteristics Percentage reduction in PANSS scores
Percentage reduction in Five-factor model scores
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
163
Interaction Analysis The analyses above demonstrated that both rs66642155 polymorphism and gender were associated with age at onset of schizophrenia. We further examined the interaction between genotype and gender using MDR analysis, but no evidence for an interaction was detected (OR = 1.608, 95% CI = (0.919, 2.813), c2 = 2.789, P = 0.095). DISCUSSION MicroRNA137 has a well-established role in carcinogenesis [34-37], and a recent GWAS also implicated miRNA137 in psychiatric disorders. A microdeletion of chromosome 1p21.3, which includes miRNA137, is associated with intellectual disability [38] and a GWAS found an association between miRNA137 and schizophrenia in a multiregional population [24]. In contrast, we found no significant association between schizophrenia and either miRNA137 polymorphism analyzed, possibly due to the different ethnic populations studied (Americans, Europeans, and Australians versus Han Chinese). In fact, the International HapMap Project found significant differences in schizophrenia susceptibility and the distributions of the various miRNA137 genotypes among these populations. However, many genes that do not alter the susceptibility to schizophrenia may still influence clinical features in schizophrenia patients [39, 40]. Age at onset is considered the single most valuable clue to the etiology of schizophrenia [30]. A genome-wide linkage study conducted by Cardno et al. [41] confirmed a genetic contribution to the age at onset of schizophrenia and our study identified one possible contributor, the rs66642155 polymorphism in miRNA137. Although we did not find an independent association in males or females, or an interaction between miRNA137 polymorphisms and gender, this finding suggests that rs66642155 is a potential genetic factor influencing the prodromal changes that result in schizophrenia. In addition to our results demonstrating an association between the rs66642155 variant of miRNA137 and positive schizophrenic symptoms, Green et al. [42] provided evidence for an association between the miRNA137 SNP rs1625579 and another schizophrenia phenotype characterized by severe cognitive deficits and negative symptoms. In the present study, we found that the positive and delusional symptoms (P1) were more severe in schizophrenic patients carrying the WT allele of rs66642155, while the disturbance in volition was milder in WT carriers. Thus, different allelic variants of miRNA137 may have distinct effects on symptom expression. However, both the symptom assessment scales used and the demographic characteristics of the patient populations differed between these two studies. From our results, we infer that the MU genotype of rs66642155 may actually protect against the onset of positive symptom, while the WT genotype
164 / WANG ET AL.
protects against disturbances of volition. Identifying the full spectrum of miRNA137 targets and how these different miRNA137 variants alter the expression of target genes may provide mechanistic insight into the positive, delusional, volitional, and cognitive symptoms of schizophrenia. The VNTR, rs66642155, within miRNA137 alter the secondary structure of the pri-miRNA137 and interfere with the processing and function of mature miRNA137 transcripts [37]. MicroRNA137 regulates neuronal maturation and adult neurogenesis [43, 44], so deficits in miRNA137 function could contribute to the developmental abnormalities observed in the schizophrenic brain [24]. We speculate that miRNA137 polymorphisms may influence the clinical characteristics of schizophrenia by disrupting the regulation of at least three target genes. First, changes in miRNA137 structure/function may alter the transcriptional activity of transcription factor 4 (TCF4) gene, which has been implicated in neurogenesis [45, 46]. Second, miRNA137 regulates neuronal maturation and dendritic morphogenesis by targeting the ubiquitin ligase mind bomb-1 (Mib1) mRNA [44]. Third, the histone lysine-specific demethylase 1 (LSD1) gene is also a target of miRNA137, and changes in LSD1 expression can alter the proliferation and differentiation of neural stem cells [47]. In fact, reduced neural stem cell proliferation has been implicated in the pathogenesis of schizophrenia [48]. Furthermore, polymorphisms in miRNA137-targeted genes such as TCF4 have also been associated with schizophrenia [49]. Schizophrenia has a complex and variable clinical phenotype, so the specific makeup of the patient population, including clinical subtypes, gender ratio, age distribution, and treatment histories, can substantially impact the results of association studies [50]. In this study, we report the first evidence for significant associations between the rs66642155 VNTR polymorphism of miRNA137 and both age at onset and positive symptom expression. However, this study focused on only two polymorphisms, while eight distinct miRNA137 polymorphisms were found in our samples, any of which could potentially influence disease phenotype. Furthermore, while the time-consuming structured clinical interviews confirmed the mental health status of our subjects, they also limited the feasible sample size. Finally, although we stratified the control and patient populations by gender and therapeutic drug, many other unaccounted factors may also interact with rs66642155 to influence phenotype, again underscoring the need for larger-scale studies. Whether rs66642155 and other miRNA137 variants are reliable genetic markers for specific clinical features of schizophrenia warrants further study, especially as such data may help improve early treatment decisions. Despite the aforementioned uncertainties, this study adds to a growing body of work suggesting that miRNA137 polymorphisms influence the clinical characteristics of schizophrenia. The effects of these miRNA variants on target gene expression and function may yield considerable insight into the pathogenesis of schizophrenic symptoms.
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
165
ACKNOWLEDGMENTS The authors thank Yi He (Sichuan University, Chengdu, China), who assisted with data analysis and the proof-reading of this manuscript. REFERENCES 1. Andreasen NC. Symptoms, signs, and diagnosis of schizophrenia. Lancet 1995; 346(8973):477-481. 2. Shi J, Levinson DF, Duan J, Sanders AR, Zheng Y, Peâ I. Common variants on chromosome 6p22.1 are associated with schizophrenia. Nature 2009;460(7256): 753-757. 3. Perkins D, Jeffries C, Sullivan P. Expanding the “central dogma”: The regulatory role of nonprotein coding genes and implications for the genetic liability to schizophrenia. Molecular Psychiatry 2004;10(1):69-78. 4. He L, Hannon GJ. MicroRNAs: Small RNAs with a big role in gene regulation. National Review of Genetics 2004;5(7):522-531. 5. Perkins DO, Jeffries CD, Jarskog LF, Thomson JM, Woods K, Newman MA, Parker JS, Jin J, Hammond SM. microRNA expression in the prefrontal cortex of individuals with schizophrenia and schizoaffective disorder. Genome Biology 2007;8(2):R27. 6. Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Development 2006;20(5):515-524. 7. Farh KKH, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Science 2005;310(5755):1817-1821. 8. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005;120(1): 15-20. 9. Griffiths-Jones S, Grocock RJ, Van Dongen S, Bateman A, Enright AJ. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Research 2006; 34(suppl 1):D140-D144. 10. Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, MacDonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P. A pancreatic islet-specific microRNA regulates insulin secretion. Nature 2004;432(7014):226-230. 11. Xu P, Guo M, Hay BA. MicroRNAs and the regulation of cell death. Trends in Genetics 2004;20(12):617-624. 12. Hammond SM. MicroRNA therapeutics: A new niche for antisense nucleic acids. Trends in Molecular Medicine 2006;12(3):99-101. 13. Gottwein E, Cai X, Cullen BR. A novel assay for viral microRNA function identifies a single nucleotide polymorphism that affects Drosha processing. Journal of Virology 2006;80(11):5321-5326. 14. Duan R, Pak CH, Jin P. Single nucleotide polymorphism associated with mature miR-125a alters the processing of pri-miRNA. Human Molecular Genetics 2007; 16(9):1124-1131. 15. Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K. Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. Science 2007;315(5815):1137-1140.
166 / WANG ET AL.
16. Saunders MA, Liang H, Li WH. Human polymorphism at microRNAs and microRNA target sites. Proceedings of the National Academy of Science USA 2007; 104(9):3300-3305. 17. Abelson JF, Kwan KY, O’Roak BJ, Baek DY, Stillman AA, Morgan TM, Mathews CA, Pauls DL, Rašin MR, Gunel M. Sequence variants in SLITRK1 are associated with Tourette’s syndrome. Science 2005;310(5746):317-320. 18. Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, Ambros V. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biology 2004;5(3):R13. 19. Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF. MicroRNAs regulate brain morphogenesis in zebrafish. Science 2005;308(5723):833-838. 20. Krichevsky AM, King KS, Donahue CP, Khrapko K, Kosik KS. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA 2003;9(10):1274-1281. 21. Schratt GM, Tuebing F, Nigh EA, Kane CG, Sabatini ME, Kiebler M, Greenberg ME. A brain-specific microRNA regulates dendritic spine development. Nature 2006; 439(7074):283-289. 22. Vo N, Klein ME, Varlamova O, Keller DM, Yamamoto T, Goodman RH, Impey S. A cAMP-response element binding protein-induced microRNA regulates neuronal morphogenesis. Proceedings of the National Academy of Science USA 2005;102(45): 16426-16431. 23. Sun G, Yan J, Noltner K, Feng J, Li H, Sarkis DA, Sommer SS, Rossi JJ. SNPs in human miRNA genes affect biogenesis and function. RNA 2009;15(9):1640-1651. 24. Ripke S, Sanders AR, Kendler KS, Levinson DF, Sklar P, Holmans PA, Lin DY, Duan J, Ophoff RA, Andreassen OA. Genome-wide association study identifies five new schizophrenia loci. National Genetics 2011;43(10):969-976. 25. Lett TA, Chakavarty MM, Felsky D, Brandl EJ, Tiwari AK, Gonçalves VF, Rajji TK, Daskalakis ZJ, Meltzer HY, Lieberman JA. The genome-wide supported microRNA-137 variant predicts phenotypic heterogeneity within schizophrenia. Molecular Psychiatry 2013;18(4):443-450. 26. Wright C, Turner JA, Calhoun VD, Perrone-Bizzozero N. Potential impact of miR-137 and its targets in schizophrenia. Front Genetics 2013;4(58):1-16. 27. Xiao B, Li W, Zhang H, Lv L, Song X, Yang Y, Yang G, Jiang C, Zhao J. To the Editor: Association of ZNF804A polymorphisms with schizophrenia and antipsychotic drug efficacy in a Chinese Han population. Psychiatry Research 2011; 190(2):379-381. 28. Lykouras L, Oulis P, Psarros K, Daskalopoulou E, Botsis A, Christodoulou GN, Stefanis C. Five-factor model of schizophrenic psychopathology: How valid is it? European Archives of Psychiatry and Clinical Neuroscience 2000;250(2):93-100. 29. Kay SR, Opler LA, Lindenmayer JP. Reliability and validity of the positive and negative syndrome scale for schizophrenics. Psychiatry Research 1988;23(1): 99-110. 30. Anttila S, Kampman O, Illi A, Roivas M, Mattila KM, Lassila V, Lehtimäki T, Leinonen E. NOTCH4 gene promoter polymorphism is associated with the age of onset in schizophrenia. Psychiatry and Genetics 2003;13(2):61-64.
ASSOCIATION OF miRNA137 WITH SCHIZOPHRENIA /
167
31. Wang S, Li W, Zhao J, Zhang H, Yang Y, Wang X, Yang G, Lv L. Association of estrogen receptor alpha gene polymorphism with age at onset, general psychopathology symptoms, and therapeutic effect of schizophrenia. Behavior and Brain Function 2013;9(1):1-12. 32. Krebs M, Guillin O, Bourdell M, Schwartz J, Olie J, Poirier M, Sokoloff P. Brain derived neurotrophic factor (BDNF) gene variants association with age at onset and therapeutic response in schizophrenia. Molecular Psychiatry 2000;5(5): 558-562. 33. Numata S, Ueno S, Iga J, Yamauchi K, Hongwei S, Ohta K, Kinouchi S, Shibuya-Tayoshi S, Tayoshi S, Aono M. Brain-derived neurotrophic factor (BDNF) Val66Met polymorphism in schizophrenia is associated with age at onset and symptoms. Neuroscience Letters 2006;401(1-2):1-5. 34. Silber J, Lim DA, Petritsch C, Persson AI, Maunakea AK, Yu M, Vandenberg SR, Ginzinger DG, James CD, Costello JF. miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells. BMC Medicine 2008. doi: 10.1186/1741-7015-6-14 35. Liu M, Lang N, Qiu M, Xu F, Li Q, Tang Q, Chen J, Chen X, Zhang S, Liu Z. miR-137 targets Cdc42 expression, induces cell cycle G1 arrest and inhibits invasion in colorectal cancer cells. International Journal of Cancer 2010;128(6):1269-1279. 36. Balaguer F, Link A, Lozano JJ, Cuatrecasas M, Nagasaka T, Boland CR, Goel A. Epigenetic silencing of miR-137 is an early event in colorectal carcinogenesis. Cancer Research 2010;70(16):6609-6618. 37. Bemis LT, Chen R, Amato CM, Classen EH, Robinson SE, Coffey DG, Erickson PF, Shellman YG, Robinson WA. MicroRNA-137 targets microphthalmiaassociated transcription factor in melanoma cell lines. Cancer Research 2008;68(5): 1362-1368. 38. Willemsen MH, Vallès A, Kirkels LAMH, Mastebroek M, Loohuis NO, Kos A, Wissink-Lindhout WM, de Brouwer APM, Nillesen WM, Pfundt R. Chromosome 1p21. 3 microdeletions comprising DPYD and MIR137 are associated with intellectual disability. Journal of Medicine and Genetics 2011;48(12):810-818. 39. Fanous A, Kendler K. Genetic heterogeneity, modifier genes, and quantitative phenotypes in psychiatric illness: Searching for a framework. Molecular Psychiatry 2005;10(1):6-13. 40. Li WJ, Kou CG, Yu Y, Sun S, Zhang X, Kosten TR, Zhang XY. Association of Catechol-O-methyltransferase gene polymorphisms with schizophrenia and negative symptoms in a Chinese population. American Journal of Medical Genetics: Series B Neuropsychiatric Genetics 2012;159B(4):370-375. 41. Cardno AG, Holmans PA, Rees MI, Jones LA, McCarthy GM, Hamshere MI, Williams MN, Norton N, Williams HJ, Fenton I. A. Genomewide linkage study of age at onset in schizophrenia. American Journal of Medical Genetics 2001;105:439-445. 42. Green M, Cairns M, Wu J, Dragovic M, Jablensky A, Tooney P, Scott R, Carr V. Genome-wide supported variant MIR137 and severe negative symptoms predict membership of an impaired cognitive subtype of schizophrenia. Molecular Psychiatry 2012. doi: 10.1038/mp.2012.84 43. Szulwach KE, Li X, Smrt RD, Li Y, Luo Y, Lin L, Santistevan NJ, Li W, Zhao X, Jin P. Cross talk between microRNA and epigenetic regulation in adult neurogenesis. Journal of Cellular Biology 2010;189(1):127-141.
168 / WANG ET AL.
44. Smrt RD, Szulwach KE, Pfeiffer RL, Li X, Guo W, Pathania M, Teng ZQ, Luo Y, Peng J, Bordey A. MicroRNA miR-137 regulates neuronal maturation by targeting Ubiquitin Ligase Mind Bomb-1. Stem Cells 2010;28(6):1060-1070. 45. Kwon E, Wang W, Tsai L. Validation of schizophrenia-associated genes CSMD1, C10orf26, CACNA1C and TCF4 as miR-137 targets. Molecular Psychiatry 2011. doi: 10.1038/mp.2011.170 46. Blake DJ, Forrest M, Chapman RM, Tinsley CL, O’Donovan MC, Owen MJ. TCF4, schizophrenia, and Pitt-Hopkins syndrome. Schizophrenia Bulletin 2010; 36(3):443-447. 47. Sun GQ, Ye P, Murai K, Lang MF, Li S, Zhang H, Li W, Fu C, Yin J, Wang A. miR-137 forms a regulatory loop with nuclear receptor TLX and LSD1 in neural stem cells. National Community 2011. doi: 10.1038/ncomms1532 48. Reif A, Fritzen S, Finger M, Strobel A, Lauer M, Schmitt A, Lesch K. Neural stem cell proliferation is decreased in schizophrenia, but not in depression. Molecular Psychiatry 2006;11(5):514-522. 49. Stefansson H, Ophoff RA, Steinberg S, Andreassen OA, Cichon S, Rujescu D, Werge T, Pietiläinen OPH, Mors O, Mortensen PB. Common variants conferring risk of schizophrenia. Nature 2009;460(7256):744-747. 50. Li W, Wang X, Zhao J, Lin J, Song XQ, Yang Y, Jiang C, Xiao B, Yang G, Zhang HX. Association study of myelin transcription factor 1-like polymorphisms with schizophrenia in Han Chinese population. Genes and Brain Behavior 2012;11(1):87-93.
Direct reprint requests to: Dr. Luxian Lv Department of Psychiatry of the Second Affiliated Hospital of Xinxiang Medical University No. 388, Jianshe Middle Road Xinxiang, 453002, China e-mail: [email protected]
