Autoubiquitination of TRIM26 links TBK1 to NEMO in RLR-mediated innate antiviral immune response.

Journal of Molecular Cell Biology Advance Access published November 26, 2015 1

Autoubiquitination of TRIM26 links TBK1 to NEMO in RLR-mediated innate antiviral immune response

Yong Ran1, Jing Zhang2, Li-Li Liu1, Zhao-Yi Pan1, Ying Nie1, Hong-Yan Zhang1, and Yan-Yi Wang1,* 1

Wuhan Institute of Virology, State Key Laboratory of Virology, Chinese Academy of

2

College of Life Sciences, Wuhan University, Wuhan 430072, China

*

Correspondence to: Yan-Yi Wang, Tel/Fax: 86-27-87198095, E-mail:

[email protected]

© The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.

Downloaded from http://jmcb.oxfordjournals.org/ at University of Liverpool on November 30, 2015

Sciences, Wuhan 430072, China

2

Abstract The transcription factors IRF3 and NF-B are required for the expression of many genes involved in antiviral innate immune response, including type I interferons (IFNs) and proinflammatory cytokines. It is well established that TBK1 is an essential kinase engaged downstream of multiple pattern-recognition receptors (PRRs) to mediate IRF3 phosphorylation and activation, whereas the precise mechanisms of TBK1

(TRIM26) as an important regulator for RNA virus-triggered innate immune response. Knockdown of TRIM26 impaired virus-triggered IRF3, NF-B activation, IFN- induction, and cellular antiviral response. TRIM26 was physically associated with TBK1 independent of viral infection. As an E3 ligase, TRIM26 underwent autoubiquitination upon viral infection. Ubiquitinated TRIM26 subsequently associated with NEMO, thus bridging TBK1−NEMO interaction, which is critical for the recruitment of TBK1 to the VISA signalsome and activation of TBK1. Our findings suggest that TRIM26 is an important regulator of innate immune responses against RNA viruses, which functions by bridging TBK1 to NEMO and mediating the activation of TBK1.

Keywords: TRIM26, TBK1, NEMO, ubiquitination, antiviral response


activation have not been fully elucidated yet. Here, we identified tripartite motif 26

3

Introduction The innate immune response acts as the first line of host defense against viral infection. Germ line-encoded pattern-recognition receptors (PRRs) of the innate immune system recognize pathogen-associated molecular patterns (PAMPs) derived from invading viruses, such as nucleic acids, which triggers a series of cellular events, leading to the induction of type I interferons (IFNs) and proinflammatory cytokines

expressions of a range of downstream antiviral IFN-stimulated genes (ISGs) through the JAK−STAT signaling pathways, leading to the establishment of an antiviral status (Janeway and Medzhitov, 2002; Stetson and Medzhitov, 2006). In the case of RNA virus infection, viral RNAs generated during replication are recognized by at least two classes of PRRs, including membrane-bound Toll-like receptors (TLRs) that mainly function in immune cells such as dendritic cells, macrophages, and B cells, and cytosolic RIG-I-like receptors (RLRs) that function in much broader cell types (Akira et al., 2006). In most cell types, cytosolic viral RNA is recognized by RIG-I-like receptors (RLRs), including RIG-I, MDA5, and LGP2 (Pichlmair and Reis e Sousa, 2007). Upon binding to viral RNAs, RIG-I and MDA5 are recruited to the mitochondrial adaptor protein VISA (also known as MAVS, IPS-1, and Cardif), which serves as a platform to assemble a signalsome containing multiple proteins, including E3 ligases such as TRAF2/3/5/6 and TRIM14 (Zhou et al., 2014b; Kawai et al., 2005; Seth et al., 2005; Xu et al., 2005). These E3 ligases undergo autoubiquitination or mediate ubiquitination of other signaling factors, resulting in


(Akira et al., 2006; Janeway and Medzhitov, 2002). Type I IFNs further induce

4

formation of polyubiquitination chains. It has been demonstrated that polyubiquitination chains are critical for the recruitment of NEMO (NF-κB essential modulator, also known as IKK), a member of the IKK complex (Ea et al., 2006). NEMO further recruits IKK complex as well as the kinases TBK1/IKK, leading to the activation of the transcription factors NF-B and IRF3, respectively (Zhao et al., 2007). Activated NF-B and IRF3 then collaborate to induce the productions of type I

The production of type I IFNs is delicately regulated by the host to ensure immune homeostasis. Ubiquitination and deubiquitination play important roles in the regulation of virus-triggered induction of type I IFNs (Malynn and Ma, 2010). Ubiquitination is a series of reactions mainly mediated by three kinds of enzymes: the E1 activating enzyme, E2 conjugating enzyme, and the E3 ligase. It is the particular combination of an E2 and an E3 that determines the substrate specificity and the type of polyubiquitin chains formed (Pickart, 2001). It has been demonstrated that different types of polyubiquitin chains predict different fates of the substrate. In most cases, K48-linked polyubiquitin chain targets the substrates for proteasome-dependent degradation, whereas K63-linked polyubiquitin chain exerts positive regulatory effects (Bibeau-Poirier and Servant, 2008; Malynn and Ma, 2010). Increasing evidence suggest that other types of polyubiquitin chains also participate in antiviral innate immunity, such as K11-, K27-linked, as well as linear polyubiquitin chains (Skaug et al., 2009; Arimoto et al., 2010; Belgnaoui et al., 2012; Qin et al., 2014; Wang et al., 2014).


IFNs and proinflammatory cytokines.

5

The tripartite motif (TRIM) family proteins contain RING domain, thus are theoretically E3 ubiquitin ligases (Skaug et al., 2009). In recent years, an increasing number of studies have demonstrated that the TRIM family proteins are engaged in a broad range of biological processes involved in innate immunity, including viral restriction and regulation of immune signaling pathways (Ozato et al., 2008; Rajsbaum et al., 2008; McNab et al., 2011; Versteeg et al., 2013, 2014; Hu et al., 2014;

expressions of many TRIMs are induced by type I and type II interferons (Ozato et al., 2008; Rajsbaum et al., 2008; Versteeg et al., 2014). Most of TRIMs function as E3 ligases and mediate ubiquitination-related regulations. For example, TRIM25mediated, K63-linked ubiquitination of RIG-I arguments IFN- production and antiviral responses, whereas TRIM30α-mediated ubiquitination and degradation of TAB2 and TAB3 negatively regulates TLR-mediated NF-B activation (Shi et al., 2008). Other TRIMs, such as TRIM14, TRIM15, TRIM21, TRIM32, TRIM44, and TRIM56, have also been reported to regulate adaptors VISA- or MITA-mediated IRF3 activation (Bibeau-Poirier and Servant, 2008; Arimoto et al., 2010; Tsuchida et al., 2010; Zhang et al., 2012; Zhou et al., 2014b). Ubiquitination plays as critical regulatory mechanism for virus-triggered induction of type I IFNs. In this study, to identify undefined ubiquitination-related mechanisms involved in the regulation of virus-triggered induction of type I IFNs, we screened a cDNA array containing 352 expression clones of ubiquitination-related enzymes. We identified tripartite motif protein 26 (TRIM26) as a positive regulator of virus


Yan et al., 2014). In line with their important roles in immune regulation, the

6

triggered signaling. TRIM26 potentiates virus-triggered IRF3, NF-B activation, IFN induction, and cellular antiviral responses. Further investigation suggests that TRIM26 plays an important role in the antiviral innate immune response by bridging TBK1 to NEMO and mediating TBK1 activation.

Results

type I IFNs To further elucidate the mechanisms of ubiquitination-related regulation of virustriggered induction of type I IFNs, we performed expression screening to identify ubiquitin-related enzymes involved in the induction of type I IFNs. We screened a cDNA array containing 352 expression clones of ubiquitin-related enzymes by IFN- promoter reporter assays. These efforts led to the identification of TRIM26, a member of the TRIM family protein, as a positive regulator (Figure 1A). Overexpression of TRIM26 potentiated IFN- promoter activation induced by transfected intracellular poly(I:C) (Figure 1A). Interestingly, TRIM26 dose-dependently potentiated cytoplasmic poly(I:C)- and SeV-induced activation of the IFN- promoter when transfected at low dosages (no more than 50 ng) (Figure 1B). However, when transfected at higher dosages (100 ng and above), TRIM26 inhibited cytoplasmic poly(I:C)-, SeV-, as well as RIG-I-, MDA5-, and VISA-induced activation of the IFN promoter (Supplementary Figure S1A and B). In the same experiments, TRIM26(C31S), a mutant which lacks the E3 ligase activity, failed to augment these


Identification of TRIM26 as a positive regulator of RNA virus-triggered induction of

7

antiviral response at any tried dosages, suggesting the E3 ligase activity of TRIM26 is required for its full ability to positively regulate virus-triggered induction of type I IFNs (Figure 1B). In HeLa cells, overexpression of TRIM26 only potentiated SeVbut not HSV-1-induced the IFN- promoter activation, indicating TRIM26 specifically regulates RNA virus-induced IFN- production (Figure 1C). In addition, TRIM26 had no effects on TLR3-mediated signaling transduction (Figure 1D).

2008; Rajsbaum et al., 2008). In our experiments, we found that the mRNA level of TRIM26 was markedly induced by SeV-, HSV-1-infection as well as treatment with recombinant IFN- in different cell types, suggesting that TRIM26 is a type I IFNstimulated gene (Figure 1E). Taken together, these data suggest that TRIM26 is an ISG which functions as a positive regulator of RNA virus-triggered induction of IFN.

TRIM26 is essential for RNA virus-triggered signaling To determine whether endogenous TRIM26 is essential for virus-triggered type I IFN production, we constructed three RNAi plasmids for TRIM26. These RNAi plasmids reduced the expression of transfected and endogenous TRIM26 in 293T cells to different levels as shown in Figure 2A. Reporter assays indicated that knockdown of endogenous TRIM26 inhibited SeV- and cytoplasmic poly(I:C)-triggered activation of the IFN- promoter (Figure 2B). The degrees of inhibition were correlated with the efficiencies of TRIM26 knockdown by the three RNAi plasmids (Figure 2A and B).


Previously, it has been reported that many TRIMs are IFN-inducible (Ozato et al.,

8

Notably, the #3 TRIM26-RNAi which barely knocked down the expression of TRIM26 somehow affected the basal activity of the IFN- promoter, resulting in a 1.56-fold increase of the activity of the IFN- promoter in untreated cells. Upon poly(I:C) transfection, although the activity of the IFN- promoter in #3 TRIM26RNAi transfected cells appeared higher than that of the control, the induction fold of the IFN- promoter activity did not increase. Since induction of IFN- requires the

examined the effects of TRIM26 on NF-B and IRF3 activation respectively. Reporter assays indicated that knockdown of TRIM26 inhibited both NF-B and ISRE activation triggered by SeV infection (Figure 2C). However, knockdown of TRIM26 had no effects on TNF-induced NF-B activation (Figure 2D). Since the #1 TRIM26-RNAi plasmid displayed the highest knockdown efficiency, it was used for all the following experiments and similar results were obtained with the #2 TRIM26RNAi plasmid. Consistently, knockdown of TRIM26 also significantly inhibited SeVand cytoplasmic poly(I:C)-triggered transcription of endogenous IFNB1, ISG56 and TNFa genes in 293T cells (Figure 2E). Similar results were obtained in THP-1, a human monocytic cell line (Figure 2F). In addition, knockdown of TRIM26 markedly inhibited SeV-induced phosphorylation of TBK1and IRF3 (Figure 2G), as well as SeV-induced nuclear translocation of IRF3 (Figure 2H and Supplementary Figure S2A), which are the hallmarks of their activation. TRIM26 consists of 539 aa residues and shares 88% sequence identity with its murine ortholog. Knockdown of TRIM26 in MEFs also impaired SeV-induced transcription of Ifnb1 and Ifna1 (Supplementary


cooperation of transcription factors NF-B and IRF3 (Maniatis et al., 1998), we then

9

Figure S2B). Intriguingly, reconstitution of the TRIM26-RNAi resistant mutant of TRIM26 could reverse the inhibitory effect on SeV-induced IFN- promoter activation caused by depletion of TRIM26 (Supplementary Figure S2C). To test whether TRIM26 participates in other signaling pathways, we examined the effects of TRIM26-RNAi on other PRR-mediated signaling. Depletion of TRIM26 had no effects on HSV-1-induced transcription of IFNB1 and ISG56 genes (Figure 2F).

induced signaling (Supplementary Figure S2D-F). These data suggest that TRIM26 is specifically involved in RNA virus-triggered, RLR-mediated induction of type I IFNs. Since TRIM26 is important for viral infection-induced expression of the type I IFNs and its downstream ISGs, we next investigated the possible contribution of TRIM26 in cellular antiviral responses. Consistent with decreased type I IFN production, knockdown of TRIM26 significantly enhanced VSV and NDV replication in 293T cells (Figure 3A and B). In addition, cytoplasmic poly(I:C)-stimulated secretion of antiviral cytokines was also impaired in TRIM26 knockdown cells (Figure 3C). These observations suggest that TRIM26 is important in cellular antiviral responses against RNA viruses.

TRIM26 regulates virus-triggered signaling at the TBK1 level A series of signaling components are involved in the induction of type I IFNs. To investigate at which levels does TRIM26 regulate virus-triggered signal transduction, we co-transfected TRIM26 with various signaling components and examined the


In addition, knockdown of TRIM26 had no marked effects on LPS-, IFN-- or IFN--

10

effects of TRIM26 on their functions. As shown in Figure 4A and B, overexpression of TRIM26 potentiated activation of IFN- promoter and ISRE mediated by TBK1 and its upstream components RIG-I, MDA5 and VISA, but not that of IRF3 or its constitutive active mutant IRF3-5D. Consistently, knockdown of TRIM26 had opposite effects (Figure 4C and D). Since RIG-I, MDA5 and VISA act upstream whereas IRF3 acts downstream of TBK1, the simplest explanation for these

TRIM26 interacts with TBK1 Since TRIM26 functions at the TBK1 level, we then examined whether TRIM26 interacts with TBK1. In both 293T and THP-1 cells, endogenous coimmunoprecipitation experiments showed that TRIM26 interacted with TBK1 in the absence of viral infection (Figure 5A). Surprisingly, SeV infection impaired TRIM26-TBK1 interaction at 5 and 10 h post infection (Figure 5A). One possible explanation for this observation is that, upon viral infection, wild-type TBK1 undergoes auto-phosphorylation and activation and then dissociates from its binding partner TRIM26. To further test this hypothesis, we examined the interaction of TRIM26 and TBK1(K38A), a TBK1 mutant which lacks kinase activity therefore is unable to be activated. Consistent with our hypothesis, the interaction of TRIM26 with TBK1(K38A) was much stronger than that with the wild type TBK1 (Figure 5B). Confocal microscopy also showed that colocalization of TRIM26 and TBK1(K38A) was well detected, whereas colocalization of TRIM26 and wild type TBK1 was too


observations is that TRIM26 functions at the TBK1 level.

11

transient or weak to be detected (Supplementary Figure S3A). Further investigation revealed that, the interaction between TRIM26 and TBK1(K38A) could be enhanced by SeV infection (Figure 5C), which also confirmed the hypothesis. It is well established that IKK another important kinase which functions cooperatively or redundantly with TBK1, could also mediate the phosphorylation and activation of IRF3. We next investigated whether TRIM26 also interacts with IKK When

S3B), suggesting that TRIM26 interacts with TBK1 specifically. Further domain-mapping investigations indicated that the C-terminal PRY-SPRY domain of TRIM26 was important for its interaction with TBK1 (Figure 5D), and the N-terminal kinase domain (KD) and ubiquitin like domain (ULD) of TBK1, were required for TBK1-TRIM26 interaction (Figure 5E). Notably, TRIM26(C31S), a mutant lacking the E3 ligase activity, interacted with TBK1 and TBK1(K38A) as well as wild-type TRIM26 (Figure 5F). Taken together, these data indicate that TRIM26 interacts with TBK1 independently of its E3 ligase activity under physiological conditions. After infection, TBK1 undergoes auto-phosphorylation and activation and then dissociates from its binding partner TRIM26.

TRIM26 undergoes autoubiquitination upon viral infection Since TRIM26 is an E3 ligase and the TRIM26(C31S) mutant which lacks the E3 ligase activity lost its ability to positively regulate virus-triggered induction of type I IFNs (Figure 1B), we examined whether TRIM26 mediates ubiquitination of TBK1


overexpressed, TRIM26 interacted with TBK1 but not IKK (Supplementary Figure

12

and other components of the VISA signalsome. In ubiquitination assays, cotransfection of TRIM26 had no obvious effects on the ubiquituination of TBK1 as well as RIG-I, MDA5, VISA, or NEMO (Supplementary Figure S4A, B, and data not shown). Intriguingly, we found that in similar experiments, wild type TRIM26 was heavily ubiquitinated, whereas the ubiquitination of TRIM26(C31S) was undetectable, suggesting TRIM26 may undergo self-ubiquitination. To further test this, we

that in presence of wild-type TRIM26, the ubiquitination of TRIM26(C31S) was restored (Figure 6A). Notably, in the same experiment, non-tagged TRIM26 was immunopricipitated with Flag-tagged TRIM26 (Figure 6A), indicating that TRIM26 could undergo oligomerization. To exclude the possibility that the observed ubiquitination of Flag-TRIM26(C31S) occurred on the associated wild-type TRIM26, we denatured the cell lysates by treatment with 1% SDS containing lysis buffer at 95°C for 10 min to disturb protein interaction before ubiquitination assay was performed. The results confirmed that in presence of wild-type TRIM26, TRIM26(C31S) was indeed ubiquitinated (Figure 6A). In vitro ubiquitination assays also confirmed the autoubiquitination of TRIM26 (Supplementary Figure S4C). We next examined the ubiquitination of endogenous TRIM26. We found that TRIM26 was slightly ubiquitinated under physiological conditions, whereas SeV infection markedly increased its ubiquitination (Figure 6B). Although the expression of TRIM26 could be induced by viral infection, the protein level of TRIM26 barely changed at 4 h post SeV infection, suggesting the increased ubiquitination of TRIM26


cotransfected non-tagged wild-type TRIM26 with Flag-TRIM26(C31S) and found

13

was not due to the induced expression of TRIM26. We next investigated the type of ubiquitination mediated by TRIM26 and found that TRIM26 promoted mainly K27-, and slightly K29- and K33-linked polyubiquitination of itself (Figure 6C). Consistently, the K27-linked polyubiquitination of endogenous TRIM26 was found to be increased 4 h after viral infection (Figure 6D). Taken together, these results suggest that TRIM26 undergoes K27-linked autoubiquitination after viral infection.

As an E3 ligase, TRIM26 has not been found to mediate ubiquitination of any known members of the signalsome in our experiments. Yet the E3 ligase activity was required for its function as a positive regulator. Therefore, we speculated that instead of mediating ubiquitination of other signaling components which leads to their activation, the polyubiquitin chains generated in the process of TRIM26 autoubiquitination may serve as a platform to facilitate the assembly of the signalsome. It has been well demonstrated that NEMO, an important member of the signalsome, has the ability of polyubiquitin binding. Therefore, we next examined whether TRIM26 interacted with NEMO. When overexpressed, TRIM26 interacted with NEMO and their interaction was further enhanced by SeV infection (Figure 7A). Endogenous coimmunoprecipitation experiments showed that TRIM26 barely interacted with NEMO under physiological conditions. However, their interaction was induced at 5 and 10 h after viral infection (Figure 7B). We further examined whether


Ubiquitinated TRIM26 interacts with NEMO

14

the E3 ligase activity of TRIM26 was required for its interaction with NEMO and found that only wild-type TRIM26 but not TRIM26(C31S) interacted with NEMO (Figure 7C, short exposure). Interestingly, on a film with long exposure, it was observed that ubiquitinated TRIM26 coimmunoprecipitated with NEMO (Figure 7C, long exposure), suggesting that NEMO interacts with the polyubiquin chains of ubiquitinated TRIM26. To further test this, we examined the interaction of TRIM26

abolished (Wu et al., 2006). As shown in Figure 7D, NEMO(D311N) failed to interact with TRIM26, indicating that NEMO interacts with TRIM26 through binding of polyubiquitin chains. Taken together, these data suggest that the polyubiquin chains of autoubiquinated TRIM26 serve as a platform to recruit NEMO after viral infection.

TRIM26 bridges TBK1−NEMO interaction Previously, NEMO has been established as a critical adaptor to recruit TBK1 to the VISA signalsome, which is essential for activation of TBK1 and IRF3/7 (Zhao et al., 2007; Zhou et al., 2014b). Since TRIM26 interacted with both TBK1 and NEMO, we then tested whether TRIM26 could facilitate the TBK1−NEMO interaction. The results of coimmunoprecipitation experiments showed that overexpression of TRIM26 markedly enhanced TBK1−NEMO interaction (Figure 7E, lanes 1 and 2). Consistently, knockdown of endogenous TRIM26 impaired virus-induced interaction of TBK1 and NEMO but had no effects on the interaction between IKK and NEMO (Figure 7F). Interestingly, TBK1(K38A) interacted with NEMO much stronger than


with NEMO(D311N), a mutant in which the polyubiquitin-binding activity is

15

the wild type TBK1 (Figure 7E, lane 1 and 4), probably due to the dissociation of activated TBK1. Notably, the interaction between TBK1(K38A) and NEMO was also enhanced by TRIM26 (Figure 7E, lane 4 and 5). Since NEMO binds to the polyubiquitin chains of ubiquitinated TRIM26, we speculated that both the E3 ligase activity of TRIM26 and the polyubiquitin-binding activity of NEMO were required for the facilitation of TBK1−NEMO interaction. Consistent with our speculation, we

with NEMO (Figure 7E). In addition, the interaction between TBK1 and NEMO(D311N) could not be augmented by TRIM26 (Figure 7G, lane 3 and 4). Collectively, we propose the following model of TRIM26-meidated positive regulation of virus-triggered IRF3 activation. TRIM26 associates with TBK1 under physiological conditions. After viral infection, TRIM26 undergoes autoubiquitination. The polyubiquitin chains of autoubiquitinated TRIM26 serve as a platform to recruit NEMO, bringing TBK1 proximal to NEMO and facilitating the interaction of TBK1 with NEMO, which is essential for recruitment of TBK1 to the VISA signalsome and its activation. Once activated, TBK1 dissociates from TRIM26, phosphorylates IRF3, and induces the production of type I IFNs.

Discussion It has been well demonstrated that the TBK1 plays critical roles in the signaling of virus-induced production of type I IFNs. However, how TBK1 is recruited to the VISA signalsome and activated remains to be elucidated. In this study, we identified


found that TRIM26(C31S) failed to enhance the interaction of TBK1 or TBK1(K38A)

16

TRIM26 as a positive regulator of RNA virus-triggered innate immune response. Overexpression of TRIM26 at low dosages potentiated SeV- and cytoplasmic poly(I:C)-triggered IFN- production. In contrast, knockdown of endogenous TRIM26 impaired SeV- and cytoplasmic poly(I:C)-triggered IFN- production as well as the cellular antiviral response. However, overexpression or knockdown of TRIM26 had no marked effects on extracellular poly(I:C)-, LPS- or HSV-1-induced IFN-

addition, TRIM26 also had no effects on the signaling induced by IFN-. These data demonstrate that TRIM26 specifically facilitates RLR-mediated signaling. There are several lines of evidence suggesting that TRIM26 functions at the TBK1 level. First, overexpression of TRIM26 potentiated ISRE activation mediated by TBK1 and its upstream components, but not its downstream factor IRF3 or IRF7, whereas knockdown of TRIM26 had opposite effects. Second, knockdown of TRIM26 impaired SeV-triggered phosphorylation of TBK1, suggesting TRIM26 functions upstream of IRF3. Third, both overexpression and endogenous coimmunoprecipitaion experiments demonstrated the interaction of TRIM26 with TBK1 and NEMO, an important molecule required for TBK1 activation. Intriguingly, viral infection displayed different effects on TRIM26-TBK1 and TRIM26-NEMO interaction. TRIM26 associated with TBK1 in the absence of viral infection, and their association was impaired after viral infection. In contrast, the interaction between TRIM26 and NEMO was viral infection-induced. The simplest explanation is that, after viral infection, TRIM26 recruits NEMO and facilitates


production, which were mediated by TLR3, TLR4, and DNA sensors respectively. In

17

TBK1−NEMO interaction, which is important for the activation of TBK1. Once activated, TBK1 then dissociates from TRIM26. This hypothesis is further supported by the observation that TBK1(K38A), a mutant which is unable to conduct autophosphorylation therefore cannot be activated, interacted with TRIM26 much stronger than the wild type TBK1 and their interaction could be further enhanced by viral infection. However, we cannot exclude other potential mechanism(s) which also

could be phosphorylated by TBK1 and whether such phosphorylation has any effect on their interaction. In our study, we found that point mutation of a conserved Cys in the RING domain of TRIM26 abolished its ability to augment virus induced production of IFN-. We also found that the E3 ligase activity as well as the autoubiquitination of TRIM26 were important for the interaction of TRIM26 with NEMO but not TBK1. Since NEMO has been demonstrated to bind polyubiquitin chains (Husnjak and Dikic, 2012; Wang et al., 2012), we speculate that the polyubiquitin chains conjugated to TRIM26 during its autoubiquitination mediated its interaction with NEMO. Therefore, ubiquitinated TRIM26, accompanied by its binding partner TBK1, recruits NEMO and bridges TBK1−NEMO interaction. Once TBK1 is recruited to the VISA signalsome and get activated, it then dissociates from TRIM26. Previously, it has been reported that TRIM26 negatively regulates IFN-β production and antiviral response by degradation of nuclear IRF3 (Wang et al., 2015). In this study, we found that TRIM26 positively regulates cytoplasmic dsRNA-induced


regulate the interaction between TBK1 and TRIM26. For example, whether TRIM26

18

expression of type I IFNs by facilitating TBK1−NEMO interaction. This discrepancy may due to the following reasons. First, the discrepancy may due to different dosages of TRIM26 used in gain of function experiments. In our experiments, we found that overexpression of TRIM26 at low dosages potentiated SeV-induced activation of the IFN- promoter, whereas inhibited the activation of IFN- promoter at high dosages (Figure 1B and Supplementary Figure S1). Since TRIM26 is an E3 ligase, one

substrate specificity, therefore causes off-target effects. Similar observations have been reported for some other molecules. For example, NEMO is a regulatory subunit required for IKK kinase activation. However, overexpression of NEMO at high dosages inhibits IKK-mediated NF-κB activation (Krappmann et al., 2000). Second, the discrepancy might be caused by different experimental systems used in these two studies. In our study, 293T, HeLa, THP-1 and MEFs were used in RNAi experiments and similar results were obtained in all these cells. However, all the loss of function experiments in the other study were performed with mouse peritoneal macrophages. It is possible that TRIM26 plays different functions in different cell types. Therefore additional studies, especially the investigations of TRIM26-deficient mice may resolve this discrepancy. Nevertheless, our findings provide insights on the mechanisms of TRIM26-mediated regulation of cellular antiviral response.


possible explanation of these observations is that high levels of TRIM26 affects its

19

Materials and methods Reagents and antibodies Poly(I:C) (InvivoGen), recombinant TNF IFN- (R&D Systems), IFN- (ProSpec), and LPS (Sigma); lipofectamine 2000, and dual-specific luciferase assay

kit (Promega); mouse monoclonal antibodies against Flag, -actin (Sigma), HA (Origene), and TRIM26 (Santa Cruz Biotechnology); rabbit monoclonal antibodies

phospho-TBK1(Ser-172) (EPITOMICS) were purchased from the indicated manufacturers. Mouse multiclonal antibodies against TRIM26 was raised against recombinant human C-terminal TRIM26 (aa 301-539). SeV, VSV, NDV-GFP, and HSV-1 were previously described (Lei et al., 2010; Zhou et al., 2014a).

Constructs ISRE, NF-B, IRF1, and IFN-promoter luciferase reporter plasmids, mammalian expression plasmids for HA-, Flag-tagged MDA5, RIG-I, RIG-IN, VISA, TBK1 and TBK1(K38A), IRF3, IRF3-5D, IRF7, NEMO, TANK were previously described (Xu et al., 2005; Zhong et al., 2008). Mammalian expression plasmids for Flag-, HA-, cherry-, GFP-tagged TRIM26, TBK1, and their truncations and point mutants were constructed by standard molecular biology techniques.

Expression cloning The cDNA expression clones encoding independent 352 ubiquitin-related


against IRF3, phospho-IRF3 (Ser-396) (Santa Cruz Biotechnology), TBK1 and

20

enzymes were purchased from Origene. These clones were individually transfected into 293T cells together with the IFN- promoter reporter plasmid. Twenty hours later, the cells were stimulated by transfection of poly(I:C) for 12 h, luciferase reporter assays were performed to identify clones that regulate cytoplasmic poly(I:C)stimulated activation of the IFN- promoter.

The 293 cells (1×105) were seeded on 24-well plates and transfected the next day by standard calcium phosphate precipitation method. HeLa cells were transfected by lipofectamine 2000. Empty control plasmid was added to ensure that each transfection receives the same amount of total DNA. To normalize for transfection efficiency, 0.01 g of pRL-TK (Renilla luciferase) reporter plasmid was added to each transfection. Luciferase assays were performed using a dual-specific luciferase assay kit.

Establishment of RNAi-transduced stable cell lines The 293T cells were transfected with two packaging plasmids pGag-Pol and pVSVG, and the plasmid for control or TRIM26-RNAi by calcium phosphate precipitation. Twelve hours after transfection cells were washed and fresh medium without antibiotics was added. Forty-eight hours later the cell culture medium containing recombinant virus was filtered and used to infect 293T or THP-1 cells in the presence of polybrene (8 g/ml). The infected 293T or THP-1 cells were selected with puromycin (1.0 g/ml) for 4 days before additional experiments were performed. In


Transfection and reporter assays

21

the case of MEFs, plasmids for control or TRIM26-RNAi were transfected into the Plat-E package cell line to general recombinant virus.

RNA interference Double-strand oligonucleotides corresponding to the target sequences were cloned into the pSuper.Retro-RNAi plasmid (Oligoengine). The following sequences

GAAGTTCTGGGTTGGGAAA; #3: CAGCCGGGAGAGGTGACCC. For murine TRIM26 mRNA: GAGAATTCTCAGATAAACT.

Coimmunoprecipitation and immunoblot analysis 293T cells or THP-1 (5×106 for overexpression and 2×107 for endogenous experiments) were lysed in l ml NP-40 lysis buffer (20 mM Tris·HCl [pH 7.4], 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 10 μg/ml aprotinin, 10 μg/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride). Coimmunoprecipitation and immunoblot analysis were performed as previously described (Xu et al., 2005; Wei et al., 2015).

In vitro ubiquitination assays TRIM26 and HA-Ubiquitin were expressed with a TNT Quick-coupled Transcription/Translation Systems kit (Promega) following instructions of the manufacturer. Ubiquitination was analyzed with an ubiquitination kit (Enzo Life Science) following protocols recommended by the manufacturer.


were targeted for human TRIM26 mRNA. #1: GAGACTTCCTAAACAGGTA; #2:

22

Real-time PCR Total RNA was isolated for real-time PCR analysis to measure mRNA levels of the indicated genes. Data shown are the relative abundance of the indicated mRNA normalized to that of GAPDH/Gapdh. Gene-specific primer sequences were as follows. IFNB1: TTGTTGAGAACCTCCTGGCT (forward),

GCCTTGCTGAAGTGTGGAGGAA (forward), ATCCAGGCGATAGGCAGAGATC (reverse); TNF: GCCGCATCGCCGTCTCCTAC (forward), CCTCAGCCCCCTCTGGGGTC (reverse); IFNA1: AGAAGGCTCCAGCCATCTCTGT (forward), TGCTGGTAGAGTTCGGTGCAGA (reverse); GAPDH: GAGTCAACGGATTTGGTCGT (forward), GACAAGCTTCCCGTTCTCAG (reverse); Ifnb1: TCCTGCTGTGCTTCTCCACCACA (forward), AAGTCCGCCCTGTAGGTGAGGTT (reverse); Ifna1: GGATGTGACCTTCCTCAGACTC (forward), ACCTTCTCCTGCGGGAATCCAA (reverse); Gapdh: ACGGCCGCATCTTCTTGTGCA (forward), ACGGCCAAATCCGTTCACACC (reverse).

Virus manipulation Viral infection was performed when cells were 70% confluent. The culture medium was replaced by serum-free DMEM, and then VSV and NDV-GFP was added into the


TGACTATGGTCCAGGCACAG (reverse); ISG56:

23

medium at various multiplicities of infection (MOI) according to the specific experiments. After 1 h, the medium was removed, and the cells were fed with DMEM containing 10% FBS. The titers of VSV in supernatants were calculated by standard plaque assays, and the NDV-GFP replication in 293 cells was visualized by fluorescent microscopy (Ran et al., 2011; Zhang et al., 2012).

HeLa cells were transfected with the indicated plasmids by lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection, the cells were fixed with 4% paraformaldehyde for 10 min at room temperature. The cells were observed with an Olympus confocal microscope under a ×100 oil objective.

Acknowledgements We thank Drs Hong-Bing Shu (Wuhan University) and Gary Johnson (Department of Pharmacology and Lineberger Comprehensive Cancer Center, University of North Carolina School of Medicine) for reagents. We thank the Core Facility and Technical Support of Wuhan Institute of Virology for their help with confocal microscopy.

Funding This work was supported by the Ministry of Science and Technology of China (2014CB542603, 2015CB554302), the National Natural Science Foundation of China (31425010, 31270932, 31400742), and the 10000 Talents Plan.


Fluorescent confocal microscopy

24

Figure legends Figure 1 TRIM26 potentiates RNA virus-triggered signaling. (A) Screening of ubiquitin-related enzymes involved in cytoplasmic poly(I:C)-triggered activation of the IFN- promoter. 293T cells (1×105) were transfected with the IFN- promoter reporter (25 ng) and the indicated expression plasmids (25 ng). Twenty hours after

before luciferase assays were performed. (B) Dose-dependent effects of TRIM26/TRIM26(C31S) on SeV- and poly(I:C)-triggered activation of IFN- promoter. The experiments were similarly performed as in A. (C) TRIM26 potentiates SeV- but not HSV-1-induced activation of the IFN- promoter in HeLa cells. The experiments were similarly performed as in A. (D) TRIM26 has no effects on TLR3mediated IFN- promoter activation. 293T-TLR3 cells (1×105) were transfected with the IFN- promoter reporter (25 ng) and the indicated expression plasmids (25 ng). Twenty hours after transfection, cells were stimulated by addition of poly(I:C) (30 g/ml) into the media. Twelve hours after treatment, luciferase assays were performed. (E) TRIM26 is an ISG. 293T, HeLa, and THP-1 cells were stimulated with SeV, HSV1, or IFN- as indicated. The mRNA levels of TRIM26 were measured by RT-qPCR experiments. Graphs show mean + SD. n=3. *P < 0.05, **P < 0.01 (Student’s t-test). Figure 2 Knockdown of TRIM26 impairs virus-triggered induction of type I IFNs. (A) Knockdown efficiency of TRIM26-RNAi plasmids on the expression of transfected and endogenous TRIM26. In the upper panels, 293T cells (4×105) were transfected


transfection, cells were stimulated by transfection of poly(I:C) (0.5 g) for 12 h

25

with expression plasmids for Flag-TRIM26 and Flag--actin (0.2 g each), and the indicated RNAi plasmids (1 g each). Twenty-four hours after transfection, cell lysates were analyzed by immunoblots with anti-Flag antibody. In the lower panels, 293T cells (4×105) were transfected with the indicated RNAi plasmids (1 g each). Forty-eight hours later, cell lysates were analyzed by immunoblots with the indicated antibodies. The amounts of TRIM26 were quantitated using Bio-Rad Quantity One

SeV-and poly(I:C)-triggered activation of the IFN- promoter reporter. 293T cells (1×105) were transfected with the indicated reporter (0.05 g) and RNAi plasmids (0.5 g). Thirty-six hours after transfection, cells were infected with SeV or stimulated by transfection of poly(I:C) for 12 h before reporter assays were performed. (C) Effects of TRIM26-RNAi on SeV-triggered activation of ISRE and NF-B reporter. The experiments were similarly performed as in B. (D) Effects of TRIM26RNAi on TNF-stimulated activation of the NF-B reporter. The experiments were similarly performed as in B. (E) Effects of TRIM26-RNAi on SeV- and cytoplasmic poly(I:C)-triggered transcription of IFNB1, ISG56, and TNFa genes. 293T cells stably expressing control or TRIM26-RNAi were infected with SeV or stimulated by transfection of poly(I:C) for 12 h before RT-qPCR was performed. (F) Effects of TRIM26-RNAi on SeV- and HSV-1-triggered transcription of IFNB1, IFNa1, ISG56, and TNFa genes. THP1 cells stably expressing control or TRIM26-RNAi were infected with SeV or HSV-1 for 10 h before RT-qPCR was performed. (G) Knockdown of TRIM26 impairs SeV-triggered TBK1 and IRF3 phosphorylation.


Program and were normalized to that of -actin. (B) Effects of TRIM26-RNAi on

26

293T cells stably expressing control or TRIM26-RNAi were infected with SeV for the indicated times. The whole cell lysate were analyzed by immunoblots with the indicated antibodies. (H) Knockdown of TRIM26 inhibits SeV-induced nuclear translocation of IRF3. 293T cells stably expressing control or TRIM26-RNAi were infected with SeV for the indicated times. The cytoplasmic and nuclear fraction were extracted and analyzed by immunoblots with the indicated antibodies. Graphs show

Figure 3 Knockdown of TRIM26 hampers cellular antiviral response. (A) Knockdown of TRIM26 potentiates VSV replication. 293T cells stably expressing control or TRIM26-RNAi were infected with VSV (MOI=0.1), and the supernatants were harvested 24 h post infection followed by analysis of VSV production with standard plaque assay. Graphs show mean + SD. n=3. (B) Knockdown of TRIM26 potentiates NDV replication. 293T cells stably expressing control or TRIM26-RNAi were infected with NDV-GFP (MOI=0.1) for 48 h before virus replication was examined by fluorescence microscopy. Scale bar, 40 m. (C) Knockdown of TRIM26 impairs cellular antiviral response. 293T cells stably expressing control or TRIM26RNAi were transfected with poly(I:C). Twelve hours after transfection, the cell culture supernatants were transferred to the VERO cells. Twelve hours later, the supernatants were removed. Then the VERO cells were infected with VSV-GFP and NDV-GFP (MOI=0.1) for 36 h before virus replication was examined by fluorescence microscopy. Scale bar, 40 m.


mean + SD. n=3. *P < 0.05, **P < 0.01.

27

Figure 4 TRIM26 functions at the TBK1 level. (A and B) Effects of TRIM26 on activation of the IFN- promoter and ISRE. 293T cells (1×105) were transfected with the IFN- promoter reporter (A) or ISRE reporter (B) (0.05 g), plus control or TRIM26 expression plasmids (20 ng) and the indicated plasmids. Luciferase assays were performed 24 h after transfection. (C and D) Effects of TRIM26 knockdown on activation of the IFN- promoter and ISRE. 293T cells stably expressing control or

reporter (D) (0.05 g) and the indicated expression plasmids (0.1 g each). Luciferase assays were performed 24 h after transfection. Graphs show mean + SD. n=3. *P < 0.05, **P < 0.01. Figure 5 TRIM26 interacts with TBK1 independently of its E3 ligase activity. (A) TRIM26 associates with TBK1 in untransfected cells. 293T or THP-1 cells (2×107) were infected with SeV for the indicated times. Coimmunoprecipitation and immunoblot analysis were performed with the indicated antibodies. (B) TRIM26 interacts with TBK1. Flag-tagged TRIM26 were co-transfected with HA-tagged TBK1 or TBK1(K38A) (3g each) into 293T cells (2×106). Coimmunoprecipitation experiments were performed with anti-Flag or IgG. Immunoblot analysis was performed with the indicated antibodies. (C) Viral infection enhances the interaction between TRIM26 and TBK1(K38A). 293T cells (2×106) were transfected with the indicated plasmids (3 g each) and infected with SeV for the indicated times. Coimmunoprecipitation and immunoblot analysis were performed with the indicated antibodies. (D and E) Domain mapping of TRIM26-TBK1 association. The upper


TRIM26-RNAi were transfected with the IFN- promoter reporter (C) or ISRE

28

panels showed schematic representations of TRIM26 and TBK1 truncations, respectively. The experiments were similarly performed as in B. (F) TRIM26 interacts with TBK1 independently of its E3 ligase activity. These experiments were similarly performed as in B. Figure 6 TRIM26 promotes autoubiquitination. (A) 293T cells (2×106) were transfected with the indicated plasmids. The cells were collected and aliquoted into

experiments with anti-Flag antibody (upper two panels); the other sample was denatured with 1% SDS-containing lysis buffer at 95°C for 10 min, and then diluted by 10-fold before immunoprecipitation with anti-Flag antibody (panel 3 and panel 4). Immunoblot analysis was performed with the indicated antibodies. (B) TRIM26 undergoes ubiquitination after viral infection. 293T cells (2×106) were transfected with HA-Ub (0.5 g). Twenty hours later, cells were infected with SeV for the indicated times. Coimmunoprecipitation and immunoblot analysis were performed with the indicated antibodies. (C) TRIM26 mainly mediates K27-linked polyubiquitination. 293T cells (2×106) were transfected with the indicated plasmids. Coimmunoprecipitation and immunoblot analysis were performed with the indicated antibodies. (D) K27-, K29-, and K33-linked ubiquitination of endogenous TRIM26. These experiments were performed similarly as in B. Figure 7 Autoubiquitinated TRIM26 recruits NEMO and bridges TBK1−NEMO interaction. (A) TRIM26 interacts with NEMO. 293T cells (2×106) were transfected with the indicated plasmids (3 g each) and either left untreated or infected with SeV.


two samples: one sample was lysed directly and applied to immunoprecipitation

29

Coimmunoprecipitation and immunoblot analysis were performed with the indicated antibodies. (B) TRIM26 associates with NEMO in untransfected cells. 293T cells (2×107) were infected with SeV for the indicated times. Coimmunoprecipitation and immunoblot analysis were performed with the indicated antibodies. (C) The E3 ligase activity of TRIM26 is required for its interaction with NEMO. 293T cells (2×106) were transfected with the indicated plasmids. Coimmunoprecipitation and

ubiquitin binding activity of NEMO is required for its interaction with TRIM26. These experiments were performed similarly as in C. (E) TRIM26 facilitates TBK1−NEMO interaction. 293T cells (1×106) were transfected with the indicated plasmids. Coimmunoprecipitation and immunoblot analysis were performed with the indicated antibodies. (F) Knockdown of TRIM26 impairs TBK1−NEMO interaction. 293T cells stably expressing control or TRIM26-RNAi (2×107) were left untreated or infected with SeV for 6 h. Coimmunoprecipitation and immunoblot analysis were performed with the indicated antibodies. (G) The poly-ubiquitin binding activity of NEMO is required for TRIM26 to facilitate the interaction between TBK1 and NEMO. These experiments were performed similarly as in E.


immunoblot analysis were performed with the indicated antibodies. (D) The poly-

30

References Akira, S., Uematsu, S., and Takeuchi, O. (2006). Pathogen recognition and innate immunity. Cell 124, 783-801. Arimoto, K., Funami, K., Saeki, Y., et al. (2010). Polyubiquitin conjugation to NEMO by triparite motif protein 23 (TRIM23) is critical in antiviral defense. Proc. Natl Acad. Sci. USA 107, 15856-15861. Belgnaoui, S.M., Paz, S., Samuel, S., et al. (2012). Linear ubiquitination of NEMO negatively regulates

12, 211-222. Bibeau-Poirier, A., and Servant, M.J. (2008). Roles of ubiquitination in pattern-recognition receptors and type I interferon receptor signaling. Cytokine 43, 359-367. Ea, C.K., Deng, L., Xia, Z.P., et al. (2006). Activation of IKK by TNFα requires site-specific ubiquitination of RIP1 and polyubiquitin binding by NEMO. Mol. Cell 22, 245-257. Hu, M.M., Yang, Q., Zhang, J., et al. (2014). TRIM38 inhibits TNFα- and IL-1β-triggered NF-κB activation by mediating lysosome-dependent degradation of TAB2/3. Proc. Natl Acad. Sci. USA 111, 1509-1514. Husnjak, K., and Dikic, I. (2012). Ubiquitin-binding proteins: decoders of ubiquitin-mediated cellular functions. Annu. Rev. Biochem. 81, 291-322. Janeway, C.A., Jr., and Medzhitov, R. (2002). Innate immune recognition. Annu. Rev. Immunol. 20, 197216. Kawai, T., Takahashi, K., Sato, S., et al. (2005). IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat. Immunol. 6, 981-988. Krappmann, D., Hatada E.N., Tegethoff, S., et al. (2000) The IκB kinase (IKK) complex is tripartite and contains IKKγ but not IKAP as a regular component. J. Biol. Chem. 275, 29779–29787.


the interferon antiviral response through disruption of the MAVS-TRAF3 complex. Cell Host Microbe

31

Lei, C.Q., Zhong, B., Zhang, Y., et al. (2010). Glycogen synthase kinase 3β regulates IRF3 transcription factor-mediated antiviral response via activation of the kinase TBK1. Immunity 33, 878-889. Malynn, B.A., and Ma, A. (2010). Ubiquitin makes its mark on immune regulation. Immunity 33, 843852. Maniatis, T., Falvo, J.V., Kim, T.H., et al. (1998). Structure and function of the interferon-β enhanceosome. Cold Spring Harb. Symp. Quant. Biol. 63, 609-620.

regulation. Curr. Opin. Immunol. 23, 46-56. Ozato, K., Shin, D.M., Chang, T.H., et al. (2008). TRIM family proteins and their emerging roles in innate immunity. Nat. Rev. Immunol. 8, 849-860. Pichlmair, A., and Reis e Sousa, C. (2007). Innate recognition of viruses. Immunity 27, 370-383. Pickart, C.M. (2001). Mechanisms underlying ubiquitination. Annu. Rev. Biochem. 70, 503-533. Qin, Y., Zhou, M.T., Hu, M.M., et al. (2014). RNF26 temporally regulates virus-triggered type I interferon induction by two distinct mechanisms. PLoS Pathog. 10, e1004358. Rajsbaum, R., Stoye, J.P., and O'Garra, A. (2008). Type I interferon-dependent and -independent expression of tripartite motif proteins in immune cells. Eur. J. Immunol. 38, 619-630. Ran, Y., Liu, T.T., Zhou, Q., et al. (2011). SENP2 negatively regulates cellular antiviral response by deSUMOylating IRF3 and conditioning it for ubiquitination and degradation. J. Mol. Cell Biol. 3, 283292. Seth, R.B., Sun, L., Ea, C.K., et al. (2005). Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-κB and IRF 3. Cell 122, 669-682. Shi, M., Deng, W., Bi, E., et al. (2008). TRIM30α negatively regulates TLR-mediated NF-κB activation by


McNab, F.W., Rajsbaum, R., Stoye, J.P., et al. (2011). Tripartite-motif proteins and innate immune

32

targeting TAB2 and TAB3 for degradation. Nat. Immunol. 9, 369-377. Skaug, B., Jiang, X., and Chen, Z.J. (2009). The role of ubiquitin in NF-κB regulatory pathways. Annu. Rev. Biochem. 78, 769-796. Stetson, D.B., and Medzhitov, R. (2006). Type I interferons in host defense. Immunity 25, 373-381. Tsuchida, T., Zou, J., Saitoh, T., et al. (2010). The ubiquitin ligase TRIM56 regulates innate immune responses to intracellular double-stranded DNA. Immunity 33, 765-776.

regulation of immune signaling by tripartite motif proteins. Cytokine Growth Factor Rev. 25, 563-576. Versteeg, G.A., Rajsbaum, R., Sanchez-Aparicio, M.T., et al. (2013). The E3-ligase TRIM family of proteins regulates signaling pathways triggered by innate immune pattern-recognition receptors. Immunity 38, 384-398. Wang, L., Li, S., and Dorf, M.E. (2012). NEMO binds ubiquitinated TANK-binding kinase 1 (TBK1) to regulate innate immune responses to RNA viruses. PLoS One 7, e43756. Wang, P., Zhao, W., Zhao, K., et al. (2015). TRIM26 negatively regulates interferon-β production and antiviral response through polyubiquitination and degradation of nuclear IRF3. PLoS Pathog. 11, e1004726. Wang, Q., Liu, X., Cui, Y., et al. (2014). The E3 ubiquitin ligase AMFR and INSIG1 bridge the activation of TBK1 kinase by modifying the adaptor STING. Immunity 41, 919-933. Wei, J., Lian, H., Zhong, B., et al. (2015). Parafibromin is a component of IFN-γ-triggered signaling pathways that facilitates JAK1/2-mediated tyrosine phosphorylation of STAT1. J. Immunol. doi:10.4049/jimmunol.1501111. Wu, C.J., Conze, D.B., Li, T., et al. (2006). Sensing of Lys 63-linked polyubiquitination by NEMO is a key


Versteeg, G.A., Benke, S., Garcia-Sastre, A., et al. (2014). InTRIMsic immunity: Positive and negative

33

event in NF-κB activation. Nat Cell Biol. 8, 398-406. Xu, L.G., Wang, Y.Y., Han, K.J., et al. (2005). VISA is an adapter protein required for virus-triggered IFN-β signaling. Mol. Cell 19, 727-740. Yan, J., Li, Q., Mao, A.P., et al. (2014). TRIM4 modulates type I interferon induction and cellular antiviral response by targeting RIG-I for K63-linked ubiquitination. J. Mol. Cell Biol. 6, 154-163. Zhang, J., Hu, M.M., Wang, Y.Y., et al. (2012). TRIM32 protein modulates type I interferon induction

Chem. 287, 28646-28655. Zhao, T., Yang, L., Sun, Q., et al. (2007). The NEMO adaptor bridges the nuclear factor-κB and interferon regulatory factor signaling pathways. Nat. Immunol. 8, 592-600. Zhong, B., Yang, Y., Li, S., et al. (2008). The adaptor protein MITA links virus-sensing receptors to IRF3 transcription factor activation. Immunity 29, 538-550. Zhou, Q., Lin, H., Wang, S., et al. (2014a). The ER-associated protein ZDHHC1 is a positive regulator of DNA virus-triggered, MITA/STING-dependent innate immune signaling. Cell Host Microbe 16, 450-461. Zhou, Z., Jia, X., Xue, Q., et al. (2014b). TRIM14 is a mitochondrial adaptor that facilitates retinoic acidinducible gene-I-like receptor-mediated innate immune response. Proc. Natl Acad. Sci. USA 111, E245E254.


and cellular antiviral response by targeting MITA/STING protein for K63-linked ubiquitination. J. Biol.

34


35


36


37


38


39


40


Siglec1 suppresses antiviral innate immune response by inducing TBK1 degradation via the ubiquitin ligase TRIM27.

Antiviral innate immune response of RNA interference.

IKKε from mitochondrial antiviral platform.

The role of alternative polyadenylation in the antiviral innate immune response.

Skin innate immune response to flaviviral infection.

Innate immune sensing and response to influenza.

Reduced dynamic range of antiviral innate immune responses in aging.

Intracellular osteopontin stabilizes TRAF3 to positively regulate innate antiviral response.

An autoinhibitory mechanism modulates MAVS activity in antiviral innate immune response.

Accessory Factors of Cytoplasmic Viral RNA Sensors Required for Antiviral Innate Immune Response.

TRIM26 negatively regulates interferon-β production and antiviral response through polyubiquitination and degradation of nuclear IRF3.

trans-sialidase of Trypanosoma cruzi links neurotrophic signaling to cardiac innate immune response.

Chronic innate immune activation of TBK1 suppresses mTORC1 activity and dysregulates cellular metabolism.

Hepatotoxicants induce cytokine imbalance in response to innate immune system.

Ubiquitination in the antiviral immune response.

The innate immune response in human tuberculosis.

Muscovy duck reovirus infection rapidly activates host innate immune signaling and induces an effective antiviral immune response involving critical interferons.

p204-initiated innate antiviral response in mouse Leydig cells.

HepG2 cells mount an effective antiviral interferon-lambda based innate immune response to hepatitis C virus infection.

HERP Binds TBK1 To Activate Innate Immunity and Repress Virus Replication in Response to Endoplasmic Reticulum Stress.

The amazing innate immune response to influenza A virus infection.

Cigarette smoke represses the innate immune response to asbestos.

Transcriptomic Analysis of the Innate Antiviral Immune Response in Porcine Intestinal Epithelial Cells: Influence of Immunobiotic Lactobacilli.

The stress granule protein G3BP1 recruits protein kinase R to promote multiple innate immune antiviral responses.