BIOLOGY OF REPRODUCTION (2014) 91(1):8, 1–9 Published online before print 29 May 2014. DOI 10.1095/biolreprod.114.119396

p204-Initiated Innate Antiviral Response in Mouse Leydig Cells1 Weiwei Zhu,3 Peng Liu,3 Lili Yu,3 Qiaoyuan Chen,3 Zhenghui Liu,3 Keqin Yan,3 Will M. Lee,4 C. Yan Cheng,5 and Daishu Han2,3 3

Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, School of Basic Medicine, Peking Union Medical College, Beijing, China 4 School of Biological Sciences, University of Hong Kong, Hong Kong, China 5 Center for Biomedical Research, Population Council, New York, New York

The mammalian testis is an immunoprivileged organ where local tissue-specific cells acquire an effective innate immune function against invading microbial pathogens. The present study demonstrated that mouse Leydig cells had innate antiviral activities in response to viral DNA challenge through p204 activation. The DNA sensor p204 and its signaling adaptor stimulator of interferon (IFN) genes (STING) were constitutively expressed in Leydig cells. Synthetic herpes simplex virus DNA analog (HSV60), a p204 agonist, induced the expression of type I IFNs and various antiviral proteins, including IFN-stimulating gene 15, 2 0 5 0 -oligoadenylate synthetase, and Mx glutamyl transpeptidase 1, in Leydig cells. The HSV60-induced innate antiviral response in Leydig cells was significantly reduced by inhibiting p204 signaling using specific small interfering RNAs targeting p204 and Sting. The antiviral response did not affect steroidogenesis in Leydig cells. These results indicated a novel mechanism underlying the testicular innate antiviral response. antiviral response, herpes simplex virus, Leydig cell, p204

INTRODUCTION As an immunoprivileged organ, the testis has a special immune microenvironment. The systemic immune responses to both alloantigens and autoantigens are remarkably reduced in the testis [1]. To overcome this privilege and elicit appropriate local responses against invading microbial pathogens, the testicular cells have acquired effective innate immunity in response to the microbial challenges. However, microbial infection is one of the etiological factors causing male infertility [2]. The testis can be infected by different virus types that may perturb male fertility and facilitate testicular cancer [3]. Therefore, understanding the mechanisms underlying the testicular innate antiviral response would aid in developing strategies to protect the testis from viral infection. Pattern recognition receptors (PRRs) can recognize conserved pathogen-associated molecular patterns (PAMPs) of pathogens and initiate innate immune response against invading microbes [4]. Several subfamilies of PRRs have been 1 Supported by grants 31171445, 31261160491, and 31371518 from the National Natural Science Foundation of China. 2 Correspondence: Daishu Han, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, School of Basic Medicine, Peking Union Medical College, Beijing 100005, People’s Republic of China. E-mail: [email protected]

Received: 13 March 2014. First decision: 8 April 2014. Accepted: 16 May 2014. Ó 2014 by the Society for the Study of Reproduction, Inc. eISSN: 1529-7268 http://www.biolreprod.org ISSN: 0006-3363

1

Article 8

Downloaded from www.biolreprod.org.

identified, including Toll-like receptors (TLRs), retinoic acidinducible gene I (RIG-I)-like receptors (RLRs), nucleotide oligomerization domain-like receptors, and cytosolic DNA sensors [5]. These PRRs can be recognized by PAMPs from diverse pathogens, including bacteria, viruses, fungi, and parasites [4]. Various PRRs, including TLRs, RLRs, and DNA sensors, can be recognized by viral nucleic acids and initiate antiviral responses [6]. The role of TLRs in initiating innate immune responses in murine testicular cells has been revealed [7]. TLR2, TLR3, TLR4, and TLR5 initiate the innate immune response in Sertoli cells [8–11]. TLR3 and TLR4 are functional in Leydig cells [12]. The expression and function of TLR3 and TLR11 in male germ cells have been recently reported [13, 14]. We demonstrated that two RLR members, RIG-I and melanoma differentiation-associated protein 5 (MDA5), initiate innate antiviral responses in mouse Leydig cells and germ cells after challenge with RNA virus product [15]. A rapidly growing list of cytosolic DNA sensors, including DNA-dependent activator of interferon (IFN)regulatory factors (DAI), RNA polymerase III (Pol III), cGMP-AMP synthase (cGAS), and IFN-inducible protein 16 (p204 in mouse), recognize viral DNA and initiate innate immune response against DNA viruses [16–19]. Although various DNA viruses may infect the testis, DNA sensorinitiated antiviral responses in the testis remain unclear. Recognition of DNA viruses by cytosolic DNA sensors leads to IFN-regulatory factor 3 (IRF3) activation, thereby inducing type I IFN (IFNA and IFNB) production [20]. The signaling adaptor stimulator of IFN genes (STING) is necessary to mediate DNA sensor-initiated antiviral signaling [21]. The primary response is PRR-mediated type I IFN production, which subsequently induces the broad spectrum of antiviral proteins in the infected cells and sculpts systemic adaptive immunity against viruses [22]. Several IFN-induced antiviral proteins have been well defined. Among them, IFNstimulated gene 15 (ISG15), 2 0 5 0 -oligoadenylate synthetase (OAS1), and Mx glutamyl transpeptidase 1 (MX1) individually amplify antiviral signaling, degrade viral RNA, and block viral RNA transcription [23]. The mammalian testis comprises two compartments, the seminiferous tubules and the interstitial compartments. The seminiferous tubules are surrounded by peritubular myoid cells and composed of developing germ cells embraced by Sertoli cells. The interstitial compartments are composed of a large number of Leydig cells and various immune cells with predominant resident testicular macrophages, as well as minor fibroblasts, pericytes, and other leukocytes. Although the macrophages in the interstitium are believed to constitute a front line of the defense against invading pathogens [24], the testicular macrophages predominantly produce anti-inflammatory factors and exhibit immunosuppressive phenotypes for commitment to the immunoprivileged status [25]. By contrast,

ABSTRACT

ZHU ET AL.

the circulating monocytes and macrophages can be infiltrated into the interstitial spaces of the testis upon pathogen stimulation and have proinflammatory phenotypes. Moreover, the testis-specific cells, including somatic cells and germ cells, possess effective innate immune functions. Viral RNA sensors, including TLR3 and RLRs, initiate the innate antiviral response in the testicular cells [10, 12, 13, 15]. Although various DNA viruses such as herpes simplex virus (HSV) may infect the testis [26], the testicular response to DNA virus infection has not been investigated. The present study examines the expression and function of cytosolic DNA sensors in mouse Leydig cells.

Isolation of Macrophages The resident peritoneal macrophages were isolated based on a previously described procedure [30]. Briefly, the peritoneal cavities of 5-wk-old male mice were lavaged with 5 ml ice-cold 13 PBS. The peritoneal cavity cells were cultured in RPMI 1640 medium (Life Technologies) supplemented with 100 U/ ml penicillin, 100 mg/ml streptomycin, and 10% FCS in a humidified atmosphere containing 5% carbon dioxide at 378C. After 24 h, nonadherent cells were removed by washing twice with PBS. Macrophage purity was greater than 90% based on immunostaining for F4/80, a marker of macrophages [31].

Transfection Leydig cells were seeded in six-well plates at a density of 5 3 105 cells/well and cultured for 24 h. The cells were starved in serum-free F12/DMEM for 2 h and then transfected in 1 ml medium containing 2 lg/ml HSV60 and 2 ll lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. In the experiments for gene silencing with siRNA, the cells were seeded in six-well plates at a density of 2 3 105 cells/well. After 24 h, the cells were transfected with 50 nM siRNA. Twenty-four hours later, the cells were transfected with HSV60.

MATERIALS AND METHODS Animals C57BL/6 mice were purchased from the Laboratory Animal Center, Chinese Academy of Medical Sciences (Beijing, China). The mice were inbred under pathogen-free conditions with adequate nutrition (food and water ad libitum) and a consistent light cycle (12L:12D). The mice were treated in accordance with the Guidelines for the Care and Use of Laboratory Animals approved by the Chinese Council of Animal Care.

Real-time Quantitative RT-PCR

Antibodies and Major Reagents Rabbit anti-p204 (ab104409), anti-STING (ab179775), anti-DAI (ab81526), and anti-OAS1 (ab86343) polyclonal antibodies were purchased from Abcam (Cambridge, U.K.). Rabbit anti-phospho-IRF3 (No. 3661) and anti-ISG15 (No. 2743) polyclonal antibodies were purchased from Cell Signaling Technology (Beverly, MA). Rabbit anti-IRF3 (sc-9082) and antiMX1 (sc-50509) polyclonal antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Synthetic herpes simplex virus DNA analog (HSV60) (tlrl-hsv60n) and BX795 (tlr-bx7) were purchased from InvivoGen (San Diego, CA). Small interfering RNAs (siRNAs) targeting mouse p204 (sc40700) and Sting (sc-154411) and control siRNA (sc-37007) were purchased from Santa Cruz Biotechnology.

Isolation and Culture of Testicular Cells

Western Blot Analysis

The testicular cells, including Leydig cells, Sertoli cells, and germ cells, were isolated from 5-wk-old mice based on previously described procedures [12, 27]. Briefly, mice were killed by cervical dislocation after anesthetization with carbon dioxide. For each isolation, the testes of three mice were decapsulated and incubated with 0.5 mg/ml collagenase type I (Sigma, St. Louis, MO) at room temperature for 15 min with gentle oscillation. The suspensions were filtered through 80-lm copper meshes to separate the interstitial cells and the seminiferous tubules. The interstitial cells were collected in F12/Dulbecco modified Eagle medium (DMEM) (Life Technologies, Grand Island, NY) supplemented with 1.2 mg/ml sodium bicarbonate, 100 U/ml penicillin, 100 mg/ml streptomycin, and 10% fetal calf serum (FCS) (Life Technologies). The cells were incubated in a humidified atmosphere with 5% carbon dioxide at 328C for 30 min to allow the testicular macrophages to adhere on the culture dishes. Nonadherent and loosely adherent cells (mostly Leydig cells) were collected by gently rinsing the culture dishes twice with medium. The cells were cultured for 48 h for Leydig cell proliferation and then treated with 0.125 g/ml trypsin for 5 min. Most Leydig cells can be detached, whereas minor contaminated macrophages remain adherent during this treatment. Leydig cells were replated for transfection. The Leydig cell purity was more than 92% based on staining for 3b-hydroxysteroid dehydrogenase, a marker of Leydig cells [28]. The seminiferous tubules were resuspended in collagenase type I at room temperature for an additional 15 min to remove the peritubular myoid cells. The tubules were cut into small pieces (approximately 1 mm) and then incubated with 0.5 mg/ml hyaluronidase (Sigma) at room temperature for 10 min with gentle pipetting to separate Sertoli cells and germ cells. The cell suspensions were cultured in F12/DMEM at 328C for 6 h. The germ cells were recovered by collecting nonadherent cells. The germ cell purity was more than 95% based on the nuclear morphology analysis after staining with 4 0 ,6-diamidino-2-phenylindole (DAPI) [13]. Sertoli cells were cultured for an additional 24 h and then treated with a hypotonic solution (20 mM Tris, pH 7.4) for 1 min to remove germ cells adhering to Sertoli cells. The purity of Sertoli cells was more than 95% based on immunostaining for Wilms tumor nuclear protein 1, a marker of Sertoli cells [29].

Cells or tissues were lysed using a lysis buffer (C1053; Applygen Technologies Inc., Beijing, China). The protein concentration of the lysates was determined using the bicinchonic acid protein assay kit (Pierce Biotechnology, Rockford, IL). Equal amounts of proteins (20 lg) were separated on a 10% SDS-PAGE gel and subsequently electrotransferred onto polyvinyl difluoride membranes (Millipore, Bedford, MA). After blocking in Tris-buffered saline (TBS, pH 7.4) containing 5% nonfat milk for 1 h at room temperature, the membranes were incubated with the primary antibodies overnight at 48C. The membranes were washed twice with TBS containing 0.1% Tween-20 and incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (Zhongshan Biotechnology Co., Beijing, China) at room temperature for 1 h. Antigen-antibody complexes were visualized using an enhanced chemiluminescence detection kit (Zhongshan Biotechnology Co.). ImageJ software (http://rsb.info.nih.gov/ij) was used to quantify the band intensities.

Immunofluorescence Staining and Immunohistochemistry For indirect immunofluorescence staining, cells cultured on Lab-Tek chamber slides (Nunc, Naperville, IL) were fixed with precold methanol at 208C for 3 min and subsequently permeabilized with 0.2% Triton X-100 in 13 PBS for 15 min. After blocking with 10% normal goat serum in PBS for 30 min at room temperature, the cells were incubated with the primary antibodies for 1 h at 378C in a humid chamber. The cells were then washed three times with PBS and incubated with fluorescein isothiocyanate-conjugated secondary antibodies (Zhongshan Biotechnology Co.) for 30 min at 378C. Negative controls were incubated with preimmune rabbit serum instead of the primary antibodies. After costaining with DAPI, the cells were mounted with a mounting solution (Vector Laboratories, Inc., Burlingame, CA) for observation under a fluorescence microscope (IX-71; Olympus, Tokyo, Japan). For histological immunofluorescence staining, the testis was fixed in 4% paraformaldehyde for 24 h. After cryoprotection in 30% sucrose, frozen sections were cut to a thickness of 7 lm using the Leica CM1950 (Leica

2

Article 8

Downloaded from www.biolreprod.org.

Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. The RNA was treated with RNase-free DNase I (Invitrogen) to remove genomic DNA contamination. The absence of genomic DNA was confirmed by PCR amplification of b-actin before RT. The RNA (1 lg) was reverse transcribed into cDNA in a 20-ll reaction mixture containing 2.5 lM random hexamers, 2 lM deoxynucleotide triphosphates, and 200 U Moloney murine leukemia virus RT (Promega, Madison, WI). The PCR was performed in a 20-ll reaction system containing 0.2 ll cDNA, 0.5 lM forward and reverse primers each, and 10 ll 23 Power SYBR Green PCR Master Mix (Life Technologies) using an ABI PRISM 7300 real-time cycler (Applied Biosystems, Foster City, CA). Relative mRNA levels of target genes normalizing to b-actin were given by 2DDCt using the comparative threshold cycle method described in Applied Biosystems User Bulletin No. 2 (P/N 4303859) based on a previous study [32]. The primer pairs and template amounts were used for obtaining reaction efficiencies between 90% and 100%. The primer pairs for PCRs are listed in Table 1.

TESTICULAR ANTIVIRAL RESPONSE TABLE 1. Primer pairs (5 0 !3 0 ) used for real-time quantitative PCR. Gene cGas Dai Ifna Ifnb Isg15 Mx1 Oas1 Pol III p204 P450scc P45017oha Sting Hsd3b b-Actin

Forward

Reverse

ACGAGAGCCGTTTTATCTCGTACCC GACGACAGCCAAAGAAGTGA GACCTCCACCAGCAGCTCAA GACGTGGGAGATGTCCTCAAC CCAGTCTCTGACTGTGAGAGC GACCATAGGGGTCTTGACCAA ATTACCTCCTTCCCGACACC TTTCCAGCAGATGCCTCTTT TGGTCCCAAACAAGTGATGGTGC AGGTCCTTCAATGAGATCCCTT GCCCAAGTCAAAGACACCTAAT TGGCCTGGTCATACTATATTGG TATTCTCGGTTGTACGGGCAA GAAATCGTGCGTGACATCAAAG

TGTCCGGAAGATTCACAGCATGTTT GAGCTATGTCTTGGCCTTCC ACCCCCACCTGCTGCAT GGTACCTTTGCACCCTCCAGTA GCATCACTGTGCTGCTGGGAC AGACTTGCTCTTTCTGAAAAGCC CAAACTCCACCTCCTGATGC ACGAGCTGCATCCTAGTGCT TCAGTTTCAGTAGCCACGGTAGCA TCCCTGTAAATGGGGCCATAC GTACCCAGGCGAAGAGAATAGA GGAACCGGTTGTAAGTCTGG GTGCTACCTGTCAGTGTGACC TGTAGTTTCATGGATGCCACAG

macrophages constitutively express p204 and Sting at comparable levels (Fig. 1A). By contrast, Dai, cGas, and Pol III mRNA levels were relatively low in the testis compared with the macrophages. The testicular cell-specific expression analysis showed that the p204 mRNA level in Leydig cells is relatively high compared with Sertoli cells, germ cells, and even peritoneal macrophages (Fig. 1B). By contrast, Sting was expressed at a comparable level in the different testicular cells. The expression of p204 and STING in the testicular cells and macrophages was detected at protein levels using Western blot (Fig. 1C). Histological immunofluorescence staining confirmed that p204 is predominantly expressed in the interstitial cells (asterisks in Fig. 1). By contrast, STING was ubiquitously distributed in all testicular cells (data not shown). Indirect immunofluorescence staining on the primary interstitial cells (Fig. 1E) showed that p204 is located in both the cytoplasm and nuclei of macrophages (F4/80 þ, arrow) and Leydig cells (F4/80, arrowhead).

ELISA Assay The primary Leydig cells were cultured in six-well plates at a density of 5 3 105 cells and transfected with HSV60 in a serum-free F12/DMEM medium. At 24 h after HSV60 transfection, the cytokine levels in the culture medium were measured using the following ELISA kits according to the manufacturer’s instructions: mouse IFNA Platinum ELISA (BMS6027; eBioscience, San Diego, CA), IFNB mouse ELISA kit (KMC4041; Life Technologies), and testosterone rat/mouse ELISA kit (DEV9911; Demeditec, Kiel-Wellsee, Germany). For all ELISA kits, the limit of detection was 7 pg/ml, and intraassay variation and interassay variation were less than 5% and 10%, respectively.

HSV60 Induces Innate Antiviral Response in Leydig Cells The DNA sensor p204 can recognize HSV60, thereby initiating an innate antiviral response [33]. To determine whether p204 is functional in Leydig cells, we examined the innate antiviral response in Leydig cells after transfection with HSV60. Real-time quantitative RT-PCR results showed that HSV60 transfection significantly upregulates p204 and Dai expression in a time-dependent manner (Fig. 2A). The peaks of p204 and Dai mRNA levels were observed at 18 h after HSV60 transfection. By contrast, cGas, Pol III, and Sting expression levels were not affected by HSV60 transfection (Fig. 2A, right). The upregulation of p204 and DAI was confirmed at protein levels using Western blot (Fig. 2B). Notably, HSV60 dramatically induced Ifna and Ifnb expression (Fig. 2C). Plateau mRNA levels appeared at 6 and 8 h after HSV60 transfection. ELISA results showed that HSV60 significantly induces IFN secretion in culture medium at 24 h after transfection (Fig. 2D). Major antiviral proteins, including Isg15, Oas1, and Mx1, were also dramatically upregulated after HSV60 transfection (Fig. 2E). The highest mRNA levels were detected at 16 and 24 h after transfection. Western blot results confirmed the upregulation of ISG15, OAS1, and MX1 at protein levels in Leydig cells at 24 h after transfection (Fig. 2F). The treatment of cells with lipofectamine RNAiMAX alone did not affect gene expression (data not shown).

Injection of HSV60 into the Testis Mice were anesthetized with pentobarbital sodium (50 mg/kg), and the testes were surgically exposed. One testis was injected with 10 ll 13 PBS containing 0.3 lg HSV60 and 1 ll lipofectamine RNAiMAX, and the other one was injected with an equal volume of PBS containing 1 ll lipofectamine RNAiMAX as a control. The testes were recovered at appropriate time points for different assays.

Statistical Analysis Data are presented as mean 6 SEM. At least three independent experiments were performed, and each experiment was repeated twice. Student t-test was used to determine the significance between treatments. One-way ANOVA with Bonferroni correction was used for multiple comparisons. The data were analyzed using SPSS version 11.0 statistical software (SPSS Inc., Chicago, IL), and P , 0.05 was considered statistically significant.

RESULTS Expression of Cytosolic DNA Sensors in Leydig Cells The expression of major cytosolic viral DNA sensors, including p204, DAI, cGAS, Pol III, and their common adaptor STING, was examined in the testis in comparison with the peritoneal macrophages from the same mice. Real-time quantitative RT-PCR results showed that the testis and 3

Article 8

Downloaded from www.biolreprod.org.

Biosystems, Nussloch, Germany). The sections were incubated with 13 PBS containing 3% hydrogen peroxide for 15 min to inhibit the endogenous peroxidase activity. After blocking with 5% preimmune rabbit serum in PBS for 1 h at room temperature, the sections were incubated with primary antibodies overnight at 48C. After rinsing with PBS, the sections were incubated with tetramethylrhodamine isothiocyanate-conjugated anti-rabbit IgG antibodies (Zhongshan Biotechnology Co.) at room temperature for 30 min. The sections were costained with DAPI. For immunohistochemistry, after incubation with primary antibodies, the frozen sections were incubated with HRP-conjugated secondary antibodies (Zhongshan Biotechnology Co.) at room temperature for 30 min. The HRP activity was visualized using the diaminobenzidine method. Negative controls were incubated with the preimmune rabbit serum instead of the primary antibodies.

ZHU ET AL.

Sting were knocked down by specific siRNA. Each siRNA reduced more than 70% of the target gene mRNA levels at 24 h after transfection (Fig. 4A). Accordingly, the protein levels of the target genes were significantly reduced by siRNAs (Fig. 4B). An siRNA targeting a scrambled sequence was used as a control. At 24 h after siRNA transfection, the cells were transfected with HSV60. The pretreatment of cells with siRNA targeting p204 or Sting significantly reduced the p-IRF3 level at 2 h after HSV60 transfection (Fig. 4C). Accordingly, sip204 or siSting significantly inhibited HSV60-induced IFN production (Fig. 4D). Antiviral protein levels were also dramatically decreased by specific siRNAs (Fig. 4E). Notably, knockdown of Sting resulted in more severe inhibition on the HSV60induced innate antiviral response compared with knockdown of p204.

IRF3 Activation Given that p204 signaling induces type I IFN expression via IRF3 activation [6], we examined IRF3 activation in Leydig cells. The HSV60 efficiently induced IRF3 phosphorylation in a time-dependent manner (Fig. 3A). Phospho-IRF3 (p-IRF3) was detected at 1 h after HSV60 transfection. The p-IRF3 level peaked at 2 h and declined at 3 h. The p-IRF3 must translocate into nuclei to induce IFN expression. Indirect immunofluorescence staining showed that IRF3 translocates into the cell nuclei in a time-dependent manner (Fig. 3B). More than 90% of nuclei were IRF3 positive at 2 h after HSV60 transfection. To clarify the involvement of IRF3 activation in the antiviral response, we examined the effect of IRF3 activation inhibitor (BX795) on HSV60-induced IFN and antiviral protein expression. A 2-h pretreatment of the cells with BX795 significantly inhibited the HSV60-induced p-IRF3 level (Fig. 3C). Accordingly, BX795 significantly suppressed HSV60induced IFN production (Fig. 3D). Antiviral protein levels were also significantly reduced by BX795 (Fig. 3E). The results imply that IRF3 activation is required for the HSV60induced antiviral response in Leydig cells.

HSV60 Does Not Affect Testosterone Synthesis To determine whether HSV60 affects steroidogenesis, we examined the expression of the critical steroidogenic enzymes, including cytochrome P450 side-chain cleavage (P450scc), cytochrome P450 17a-hydroxylase (P45017aOH), and 3bhydroxysteroid dehydrogenase (HSD3B). The mRNA levels of the enzymes were not apparently affected by HSV60 in Leydig cells at 12 and 24 h after transfection (Fig. 5A). Accordingly, HSV60 did not affect testosterone synthesis at basal conditions (Fig. 5B, left). Also, HSV60 did not affect 8-bromoadenosine-

Role of the p204 Signaling Pathway in the HSV60-Induced Antiviral Response To demonstrate the involvement of the p204 signaling pathway in the HSV60-induced antiviral response, p204 and 4

Article 8

Downloaded from www.biolreprod.org.

FIG. 1. Expression of cytosolic DNA sensors. A) Total RNA was extracted from the testis and peritoneal macrophage (Mu) of 5-wk-old C57BL/6 mice. The relative mRNA levels of p204, Dai, cGas, Pol III, and their common adaptor Sting were determined by normalizing to b-actin using real-time quantitative RT-PCR. B and C) Cell-specific expression of p204 and STING. Sertoli cells (Sc), Leydig cells (Lc), germ cells (Gc), and Mu were isolated from 5-wk-old mice. The relative mRNA levels of p204 and Sting in these cells were examined using real-time quantitative RT-PCR (B), and their protein levels were determined using Western blot (C). b-Actin was used as a loading control for Western blot. D) Distribution of p204 in the testis. Immunofluorescence staining was performed in frozen testicular sections of 5-wk-old mice using specific antibodies and tetramethylrhodamine isothiocyanate-conjugated secondary antibodies. The sections were costained with DAPI. The seminiferous tubules (ST) were delineated by dotted lines. The square areas were magnified for high (Hi) resolution (right). Asterisks indicate the interstitial spaces. E) Localization of p204 in the primary interstitial cells. The primary interstitial cells were cultured and double-stained with antibodies against p204 and F4/80. The arrow and arrowhead indicate the testicular macrophages (F4/80þ) and Leydig cells (F4/80), respectively. Images represent at least three experiments. Data are presented as mean 6 SEM. Bar ¼ 20 lm.

TESTICULAR ANTIVIRAL RESPONSE

cAMP-induced testosterone production in Leydig cells (Fig. 5B, right).

significantly upregulated by HSV60 injection (Fig. 6C). Immunohistochemistry showed that OAS1 and IFN-b were predominantly located in the interstitial cells (asterisks) after HSV60 injection (Fig. 6D). Similarly, IFNA, OAS1, and MX1 were upregulated in the interstitial cells after HSV60 injection (data not shown). Consistent with the observations in vitro, the steroidogenic enzyme expression and the testosterone level in the testis were not apparently affected by HSV60 injection (data not shown).

HSV60 Induces the Testicular Innate Antiviral Response In Vivo To investigate the DNA sensor-initiated testicular antiviral response in vivo, a mixture of HSV60 and lipofectamine RNAiMAX was locally injected into the testis. The HSV60 injection efficiently induced IRF3 phosphorylation (Fig. 6A). As a control, injection of the testis with lipofectamine RNAiMAX alone did not induce IRF3 phosphorylation. Accordingly, IFNA and IFNB levels were significantly increased in the testis at 24 h after HSV60 injection (Fig. 6B). The expression of the antiviral proteins was also

DISCUSSION Although the mammalian testis is an immunoprivileged site, this organ can be infected by microbial pathogens from circulating blood and the ascending genitourinary tract. The 5

Article 8

Downloaded from www.biolreprod.org.

FIG. 2. The HSV60-induced innate antiviral responses. A) Expression of DNA sensors. Leydig cells were transfected with 2 lg/ml HSV60 for the specified durations. Relative mRNA levels of p204, Dai, cGas, Pol III, and Sting were analyzed using real-time quantitative RT-PCR. B) Leydig cells were lysed at 24 h after HSV60 transfection. The protein levels of p204 and DAI in the cell lysates were determined by Western blot. C) The IFN expression. Leydig cells were transfected with HSV60 for the indicated durations. The mRNA levels of Ifna and Ifnb were analyzed using real-time quantitative RT-PCR. D) Cytokine secretion in culture medium. At 24 h after HSV60 transfection, the IFN levels in culture medium were measured using ELISA. ND, not detectable. E) Expression of antiviral proteins. At the indicated time points after HSV60 transfection, the relative mRNA levels of Isg15, Oas1, and Mx1 were determined using quantitative RT-PCR. F) Protein levels of the antiviral proteins. At 24 h after HSV60 transfection, the protein levels of the antiviral proteins in the cell lysates were determined using Western blot. The cells transfected with lipofectamine RNAiMAX alone were used as a control (Ctrl). bActin was used as a standard control for both mRNA and protein analyses. Western blot images represent at least three independent experiments. Data are presented as mean 6 SEM. **P , 0.01.

ZHU ET AL.

FIG. 3. Activation of IRF3. A) Phosphorylation of IRF3. Leydig cells were transfected with 2 lg/ml HSV60 for the specified durations. The cell lysates were analyzed by Western blot using specific antibodies against pIRF3 and IRF3. B) Nuclear translocation of IRF3. Leydig cells were treated as in A. Indirect immunofluorescence staining was performed using antibodies against IRF3 (left). Bar ¼ 20 lm. The time-dependent efficacy of nuclear translocation was quantitatively analyzed by counting 200 cells (right). C) Inhibition of IRF3 activation by BX795. Leydig cells were transfected with HSV60 or with HSV60 after a 2-h preincubation with 1 lg/ml BX795. At 2 h after transfection, the cell lysates were subjected to Western blot to probe the p-IRF3 and total IRF3 using specific antibodies. D) Cytokine secretion. Leydig cells were treated as in C. At 24 h after HSV60 transfection, the media were measured for IFN concentration using ELISA. ND, not detectable. E) Expression of antiviral proteins. At 24 h after treatment as in C, the antiviral proteins in Leydig cells were determined using Western blot. Images represent at least three independent experiments, and data are presented as mean 6 SEM. *P , 0.05, **P , 0.01.

6

Article 8

Downloaded from www.biolreprod.org.

local cell-initiated innate immune response has important functions in the defense against microbial invasion. Microbial infections in the testis may cause orchitis and orchitisepididymitis, which are relevant factors in male infertility and subfertility [2, 34, 35]. The human testis can be infected by a wide range of RNA and DNA viruses such as mumps virus [36], HSV [37], papilloma virus [38], and adeno-associated virus [39], which are associated with male subfertility and may lead to the sexual dissemination of some pathogens. However, orchitis caused by natural microbial infections has not been found in murines, suggesting that the murine testis has a more effective defense system against the invading pathogens. Therefore, understanding the mechanisms underlying the innate immune response in the murine and human testes may provide strategies to develop preventive and therapeutic approaches to orchitis. The present study investigated the cytosolic DNA sensor-initiated antiviral response in the mouse testis. The list of known DNA sensors is rapidly growing, and several of their members, including p204, DAI, cGAS, and Pol III, initiate type I IFN-dependent antiviral response to DNA viral challenge [40, 41]. We demonstrated that mouse Leydig cells constitutively express p204, which is located in both the cytoplasm and nuclei of Leydig cells. This distribution of p204 can be modulated by protein acetylation [42]. As a synthetic analog of HSV genomic DNA, HSV60 triggers an innate antiviral response mimicking HSV through recognition of p204 [33]. Although we also detected p204 in the testicular interstitial macrophages, we focused our present study on the p204initiated antiviral response in Leydig cells based on the following two reasons: (1) Leydig cells represent most (.80%) of the interstitial cells in mice, and the DNA sensor-initiated innate antiviral response in the Leydig cells has not been investigated to date. (2) The p204 function in the macrophages from other sources has been extensively investigated, and p204 should be obviously functional in testicular macrophages. The p204 expression in Leydig cells was further upregulated by HSV60. Also, DAI is dramatically upregulated by HSV60 transfection, although it is faintly expressed in Leydig cells at basal conditions. The upregulation of the DNA sensors would amplify antiviral responses in Leydig cells. We did not demonstrate a role for DAI in the innate antiviral response in Leydig cells. The observation that the treatment of cells with siSting exhibited more inhibition on the antiviral response than siP204 suggests that other DNA sensors are involved in the HSV60-induced response in Leydig cells. This study expanded our understanding of the antiviral response in Leydig cells to DNA viral challenge, in addition to our recent finding that viral double-stranded RNA sensors, including TLR3, MDA5, and RIG-I, initiate an innate antiviral response in mouse Leydig cells [12, 15]. Type I IFN production is the primary response to viral infection [43]. Interferons IFNA and IFNB have important functions in the host defense against viral infection through the induction of antiviral proteins in the infected cells and the facilitation of systemic adaptive immune responses [44]. The present study demonstrated that the antiviral proteins, including ISG15, OAS1, and MX1, are dramatically upregulated by HSV60 in Leydig cells through p204 signaling, which would favor the elimination of viruses within the cells. The upregulation of the antiviral proteins could be attributable to type I IFN production because these antiviral proteins can be induced by IFNA and IFNB in the testicular cells [23]. The induction of the antiviral proteins appeared later than the IFN expression in Leydig cells after HSV60 transfection, suggesting that IFNA and IFNB may induce the antiviral protein

TESTICULAR ANTIVIRAL RESPONSE

expression in an autocrine manner. Although there was certain macrophage contamination in Leydig cells, the innate antiviral responses could not be from macrophages based on the following reasons: (1) Compared with peritoneal macrophages, p204 and STING are expressed at relatively high levels in Leydig cells. (2) Testicular resident macrophages exhibit diminished inflammatory responses to pathogen stimulation.

(3) The IRF3 activation occurred in Leydig cells (Fig. 3B). (4) The IFNB and OAS1 were induced in Leydig cells (Fig. 6D). Although various PRRs initiate innate antiviral responses, they trigger different signaling pathways [45]. Recognition of TLRs by viruses triggers myeloid differentiation protein 88 (MyD88)-dependent and/or Toll/IL-1 receptor domain-containing adaptor inducing IFNB-dependent pathways. The RLRs

FIG. 5. Testosterone synthesis. A) Expression of steroidogenic enzymes. Leydig cells were transfected with HSV60. At 12 and 24 h after transfection, the mRNA levels of P450scc, P45017oha, and Hsd3b were determined by real-time quantitative RT-PCR. b-Actin was used as an internal control for the PCR. B) Testosterone synthesis. Leydig cells were transfected with HSV60 (left) or transfected with HSV60 after a 2-h pretreatment with 10 mM 8bromoadenosine-cAMP (8-Br-cAMP) (right). At 24 h after transfection, the testosterone concentration in medium was measured using ELISA. The cells that were transfected with lipofectamine RNAiMAX alone served as a control (Ctrl). Data are presented as mean 6 SEM.

7

Article 8

Downloaded from www.biolreprod.org.

FIG. 4. Effect of silencing p204 and Sting on HSV60-induced antiviral responses. A and B) Knockdown of p204 and Sting using specific siRNA. Leydig cells were transfected with individual siRNA targeting a scrambled sequence (siCtrl), p204 (sip204), and Sting (siSting). At 24 h after transfection, p204 and Sting mRNA levels were assessed by real-time quantitative RT-PCR (A), and their protein levels were determined using Western blot (B). C) The IRF3 activation. Leydig cells were transfected with the indicated siRNAs. Twenty-four hours later, the cells were transfected with HSV60. The p-IRF3 and total IRF3 were determined by Western blot at 2 h after HSV60 transfection. D) The IFN secretion. Leydig cells were treated as described in C. At 24 h after HSV60 transfection, IFNA and IFNB levels in medium were measured using ELISA. E) Antiviral protein expression. Leydig cells were treated as described in C. At 24 h after transfection, the antiviral protein levels in cell lysates were determined using Western blot. Images represent at least three experiments. Data are presented as mean 6 SEM. *P , 0.05, **P , 0.01.

ZHU ET AL.

affect the testosterone synthesis in Leydig cells. The data suggest that the initiation of DNA sensor signaling would be an ideal strategy to counteract viral infection and protect the testicular functions. The results also raise an interesting question of whether the different antiviral pathways are associated with the fact that RNA viruses (e.g., mumps virus) predominantly perturb male fertility compared with DNA viruses [50, 51]. Further studies should assess the effect of different antiviral pathways to relevant viral infection on the testicular functions. In conclusion, the present study demonstrated that mouse Leydig cells exhibit the antiviral capacities through viral DNA sensor signaling in response to HSV60 stimulation, which would contribute to the testicular defense against DNA virus infection. Notably, p204-initiated innate antiviral responses did not affect the testicular endocrine function. The data describe a complementary mechanism underlying the testicular innate antiviral response. REFERENCES

FIG. 6. The HSV60-induced testicular innate antiviral responses in vivo. A) The IRF3 activation. A mixture of HSV60 and lipofectamine RNAiMAX was locally injected into one testis of 5-wk-old mice, and the other testis was injected with lipofectamine RNAiMAX alone as a control (Ctrl). At 3 h after injection, the p-IRF3 and total IRF3 in the testis were analyzed using Western blot. B) The IFN levels. At 24 h after injection, the levels of IFNA and IFNB in the testicular lysates were measured by ELISA. C) Expression of antiviral proteins. At 24 h after injection, the testicular lysates were subjected to Western blot to probe the antiviral proteins using specific antibodies. D) Distribution of IFNB and OAS1. Immunohistochemistry was performed on frozen sections of the testes at 24 h after injection. Bar ¼ 20 lm. Images represent at least three experiments. Data are presented as mean 6 SEM. **P , 0.01.

initiate antiviral response through IFNB promoter stimulator 1dependent signaling. The DNA sensors signal through the adaptor STING. These signaling pathways may induce the expression of different cytokines in different cell types [46]. We recently demonstrated that TLR and RLR signaling induces proinflammatory cytokines such as tumor necrosis factor a (TNF-a) and IFNA and IFNB in mouse Leydig cells [12, 15]. While IFNA and IFNB are critical in the defense against viruses, the augmentation of TNF-a may be harmful to the tissue functions. In fact, proinflammatory cytokines, particularly TNF-a, inhibit androgen synthesis in Leydig cells [47, 48]. We recently demonstrated that TLR signaling inhibits testosterone synthesis in Leydig cells, possibly caused by increased TNF-a [12]. Increased TNF-a level in orchitis also induces germ cell apoptosis [49]. In the present study, although IFNA and IFNB were dramatically upregulated in Leydig cells by HSV60, we did not observe TNF-a upregulation (data not shown). Notably, p204-initiated antiviral response did not 8

Article 8

Downloaded from www.biolreprod.org.

1. Hedger MP. Immune privilege of the testis: meaning, mechanisms, and manifestations. In: Stein-Streilein J (ed.), Infection, Immune Homeostasis and Immune Privilege. Basel: Springer; 2012:31. Birkha¨user Advances in Infectious Diseases series. 2. Schuppe HC, Meinhardt A, Allam JP, Bergmann M, Weidner W, Haidl G. Chronic orchitis: a neglected cause of male infertility? Andrologia 2008; 40:84–91. 3. Dejucq N, Jegou B. Viruses in the mammalian male genital tract and their effects on the reproductive system. Microbiol Mol Biol Rev 2001; 65: 208–231. 4. Kumar H, Kawai T, Akira S. Pathogen recognition by the innate immune system. Int Rev Immunol 2011; 30:16–34. 5. Thompson MR, Kaminski JJ, Kurt-Jones EA, Fitzgerald KA. Pattern recognition receptors and the innate immune response to viral infection. Viruses 2011; 3:920–940. 6. Barbalat R, Ewald SE, Mouchess ML, Barton GM. Nucleic acid recognition by the innate immune system. Annu Rev Immunol 2011; 29:185–214. 7. Hedger MP. Toll-like receptors and signalling in spermatogenesis and testicular responses to inflammation: a perspective. J Reprod Immunol 2011; 88:130–141. 8. Riccioli A, Starace D, Galli R, Fuso A, Scarpa S, Palombi F, De Cesaris P, Ziparo E, Filippini A. Sertoli cells initiate testicular innate immune responses through TLR activation. J Immunol 2006; 177:7122–7130. 9. Wu H, Wang H, Xiong W, Chen S, Tang H, Han D. Expression patterns and functions of Toll-like receptors in mouse Sertoli cells. Endocrinology 2008; 149:4402–4412. 10. Starace D, Galli R, Paone A, De Cesaris P, Filippini A, Ziparo E, Riccioli A. Toll-like receptor 3 activation induces antiviral immune responses in mouse Sertoli cells. Biol Reprod 2008; 79:766–775. 11. Winnall WR, Muir JA, Hedger MP. Differential responses of epithelial Sertoli cells of the rat testis to Toll-like receptor 2 and 4 ligands: implications for studies of testicular inflammation using bacterial lipopolysaccharides. Innate Immun 2011; 17:123–136. 12. Shang T, Zhang X, Wang T, Sun B, Deng T, Han D. Toll-like receptorinitiated testicular innate immune responses in mouse Leydig cells. Endocrinology 2011; 152:2827–2836. 13. Wang T, Zhang X, Chen Q, Deng T, Zhang Y, Li N, Shang T, Chen Y, Han D. Toll-like receptor 3-initiated antiviral responses in mouse male germ cells in vitro. Biol Reprod 2012; 86:e106. 14. Chen Q, Zhu W, Liu Z, Yan K, Zhao S, Han D. Toll-like receptor 11initiated innate immune response in male mouse germ cells. Biol Reprod 2014; 90:e38. 15. Zhu W, Chen Q, Yan K, Liu Z, Li N, Zhang X, Yu L, Chen Y, Han D. RIG-I-like receptors mediate innate antiviral response in mouse testis. Mol Endocrinol 2013; 27:1455–1467. 16. Takaoka A, Wang Z, Choi MK, Yanai H, Negishi H, Ban T, Lu Y, Miyagishi M, Kodama T, Honda K, Ohba Y, Taniguchi T. DAI (DLM-1/ ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature 2007; 448:501–505. 17. Chiu YH, Macmillan JB, Chen ZJ. RNA polymerase III detects cytosolic DNA and induces type I interferons through the RIG-I pathway. Cell 2009; 138:576–591.

TESTICULAR ANTIVIRAL RESPONSE 34. Haidl G, Allam JP, Schuppe HC. Chronic epididymitis: impact on semen parameters and therapeutic options. Andrologia 2008; 40:92–96. 35. Ludwig M. Diagnosis and therapy of acute prostatitis, epididymitis and orchitis. Andrologia 2008; 40:76–80. 36. Jalal H, Bahadur G, Knowles W, Jin L, Brink N. Mumps epididymoorchitis with prolonged detection of virus in semen and the development of anti-sperm antibodies. J Med Virol 2004; 73:147–150. 37. Kapranos N, Petrakou E, Anastasiadou C, Kotronias D. Detection of herpes simplex virus, cytomegalovirus, and Epstein-Barr virus in the semen of men attending an infertility clinic. Fertil Steril 2003; 79(suppl 3): 1566–1570. 38. Lai YM, Lee JF, Huang HY, Soong YK, Yang FP, Pao CC. The effect of human papillomavirus infection on sperm cell motility. Fertil Steril 1997; 67:1152–1155. 39. Erles K, Rohde V, Thaele M, Roth S, Edler L, Schlehofer JR. DNA of adeno-associated virus (AAV) in testicular tissue and in abnormal semen samples. Hum Reprod 2001; 16:2333–2337. 40. Keating SE, Baran M, Bowie AG. Cytosolic DNA sensors regulating type I interferon induction. Trends Immunol 2011; 32:574–581. 41. Barber GN. STING-dependent cytosolic DNA sensing pathways. Trends Immunol 2014; 35:88–93. 42. Li T, Diner BA, Chen J, Cristea IM. Acetylation modulates cellular distribution and DNA sensing ability of interferon-inducible protein IFI16. Proc Natl Acad Sci U S A 2012; 109:10558–10563. 43. Randall RE, Goodbourn S. Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J Gen Virol 2008; 89:1–47. 44. Katze MG, He Y, Gale M Jr. Viruses and interferon: a fight for supremacy. Nat Rev Immunol 2002; 2:675–687. 45. Kawai T, Akira S. The roles of TLRs, RLRs and NLRs in pathogen recognition. Int Immunol 2009; 21:317–337. 46. Mogensen TH. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin Microbiol Rev 2009; 22:240–273. 47. Bornstein SR, Rutkowski H, Vrezas I. Cytokines and steroidogenesis. Mol Cell Endocrinol 2004; 215:135–141. 48. Hong CY, Park JH, Ahn RS, Im SY, Choi HS, Soh J, Mellon SH, Lee K. Molecular mechanism of suppression of testicular steroidogenesis by proinflammatory cytokine tumor necrosis factor alpha. Mol Cell Biol 2004; 24:2593–2604. 49. Theas MS, Rival C, Jarazo-Dietrich S, Jacobo P, Guazzone VA, Lustig L. Tumour necrosis factor-alpha released by testicular macrophages induces apoptosis of germ cells in autoimmune orchitis. Hum Reprod 2008; 23: 1865–1872. 50. Ochsendorf FR. Sexually transmitted infections: impact on male fertility. Andrologia 2008; 40:72–75. 51. Davis NF, McGuire BB, Mahon JA, Smyth AE, O’Malley KJ, Fitzpatrick JM. The increasing incidence of mumps orchitis: a comprehensive review. BJU Int 2010; 105:1060–1065.

9

Article 8

Downloaded from www.biolreprod.org.

18. Sun L, Wu J, Du F, Chen X, Chen ZJ. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 2013; 339:786–791. 19. Veeranki S, Choubey D. Interferon-inducible p200-family protein IFI16, an innate immune sensor for cytosolic and nuclear double-stranded DNA: regulation of subcellular localization. Mol Immunol 2012; 49:567–571. 20. Wang Z, Choi MK, Ban T, Yanai H, Negishi H, Lu Y, Tamura T, Takaoka A, Nishikura K, Taniguchi T. Regulation of innate immune responses by DAI (DLM-1/ZBP1) and other DNA-sensing molecules. Proc Natl Acad Sci U S A 2008; 105:5477–5482. 21. Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev 2001; 14: 778–809. 22. Schoggins JW, Rice CM. Interferon-stimulated genes and their antiviral effector functions. Curr Opin Virol 2011; 1:519–525. 23. Sadler AJ, Williams BR. Interferon-inducible antiviral effectors. Nat Rev Immunol 2008; 8:559–568. 24. Bryniarski K, Szczepanik M, Maresz K, Ptak M, Ptak W. Subpopulations of mouse testicular macrophages and their immunoregulatory function. Am J Reprod Immunol 2004; 52:27–35. 25. Winnall WR, Muir JA, Hedger MP. Rat resident testicular macrophages have an alternatively activated phenotype and constitutively produce interleukin-10 in vitro. J Leukoc Biol 2011; 90:133–143. 26. Gribencha SV, Bragina EE, Abdumalikov RA, Bocharova EN, Kurilo LF. Detection of type 2 herpes simplex virus in cells of spermatogenic epithelium in infected testes of guinea pigs. Bull Exp Biol Med 2007; 144: 73–76. 27. Wang H, Xiong W, Chen Y, Ma Q, Ma J, Ge Y, Han D. Evaluation on the phagocytosis of apoptotic spermatogenic cells by Sertoli cells in vitro through detecting lipid droplet formation by Oil Red O staining. Reproduction 2006; 132:485–492. 28. Klinefelter GR, Hall PF, Ewing LL. Effect of luteinizing hormone deprivation in situ on steroidogenesis of rat Leydig cells purified by a multistep procedure. Biol Reprod 1987; 36:769–783. 29. Sharpe RM, McKinnell C, Kivlin C, Fisher JS. Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction 2003; 125:769–784. 30. Chong MM, Metcalf D, Jamieson E, Alexander WS, Kay TW. Suppressor of cytokine signaling-1 in T cells and macrophages is critical for preventing lethal inflammation. Blood 2005; 106:1668–1675. 31. Hume DA, Perry VH, Gordon S. The mononuclear phagocyte system of the mouse defined by immunohistochemical localisation of antigen F4/80: macrophages associated with epithelia. Anat Rec 1984; 210:503–512. 32. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001; 25:402–408. 33. Unterholzner L, Keating SE, Baran M, Horan KA, Jensen SB, Sharma S, Sirois CM, Jin T, Latz E, Xiao TS, Fitzgerald KA, Paludan SR, et al. IFI16 is an innate immune sensor for intracellular DNA. Nat Immunol 2010; 11: 997–1004.