MOLECULAR AND CELLULAR BIOLOGY, JUlY 1991, p. 3642-3651 0270-7306/91/073642-10$02.00/0 Copyright ©D 1991, American Society for Microbiology

Vol. 11, No. 7

RAP1 Is Required for BAS1/BAS2- and GCN4-Dependent Transcription of the Yeast HIS4 Gene CECILIA DEVLIN,' KIMBERLY TICE-BALDWIN,lt DAVID SHORE,2 AND KIM T. ARNDT'* Cold Spring Harbor Laboratory, P.O. Box 100, Cold Spring Harbor, New York 11724,1 and Department of Microbiology, Columbia College of Physicians and Surgeons, New York, New York 100322 Received 18 January 1991/Accepted 25 April 1991

The major in vitro binding activity to the Saccharomyces cerevisiae HIS4 promoter is due to the RAP1 protein. In the absence of GCN4, BAS1, and BAS2, the RAP1 protein binds to the HIS4 promoter in vivo but cannot efficiently stimulate HIS4 transcription. RAP1, which binds adjacently to BAS2 on the HIS4 promoter, is required for BAS1/BAS2-dependent activation of HIS4 basal-level transcription. In addition, the RAPlbinding site overlaps with the single high-affinity HIS4 GCN4-binding site. Even though RAP1 and GCN4 bind competitively in vitro, RAP1 is required in vivo for (i) the normal steady-state levels of GCN4-dependent HIS4 transcription under nonstarvation conditions and (ii) the rapid increase in GCN4-dependent steady-state HIS4 mRNA levels following amino acid starvation. The presence of the RAPl-binding site in the HIS4 promoter causes a dramatic increase in the micrococcal nuclease sensitivity of two adjacent regions within HIS4 chromatin: one region contains the high-affinity GCN4-binding site, and the other region contains the BAS1and BAS2-binding sites. These results suggest that RAP1 functions at HIS4 by increasing the accessibility of GCN4, BAS1, and BAS2 to their respective binding sites when these sites are present within chromatin.

Transcription of the Saccharomyces cerevisiae HIS4 gene is regulated by two separate systems. One system, general amino acid control, increases HIS4 transcription upon starvation for any amino acid(s) (17). In this system, amino acid starvation causes an increase in the levels of the GCN4 protein (for a review, see reference 13). GCN4 stimulates transcription by binding directly to the promoters of genes that are under general control (1, 15). In vitro, GCN4 binds to five 5'-TGACTC-3' sites located within the HIS4 promoter but has a much higher affinity for one of these sites, site C, than for the other four sites (1). The GCN4 protein is also expressed at low levels under nonstarvation conditions and is responsible for some of the H1S4 transcription under these conditions. The second system that regulates HIS4 transcription is basal control. Basal control activates HIS4 transcription in the absence of amino acid starvation but further stimulates HIS4 transcription under conditions of phosphate or adenine limitation (2, 28). Basal-control regulation of HIS4 requires two trans-acting proteins, BAS1 and BAS2 (PH02). BAS1 has a DNA-binding region that is similar to Myb proteins of higher organisms (28), and BAS2 contains a region that is similar to the homeo box (7). Neither BAS1 nor BAS2 alone can activate HIS4 transcription. BAS1 and BAS2 bind adjacently on the HIS4 promoter at a site upstream of the high-affinity GCN4 site C (28). BAS1 and BAS2 can activate HlS4 transcription independently of GCN4. Likewise, GCN4 can activate HIS4 transcription independently of both BAS1 and BAS2. A yeast strain that does not contain GCN4, BAS1, and BAS2 (gcn4-2 basl-2 bas2-2) is His- as a result of lack of transcription of the HIS4 gene (3). Therefore, normal activation of HIS4 transcription is dependent on either GCN4 (general control) or BAS1/BAS2 (basal control). There is no

evidence for any system activating HIS4 transcription other than basal and general control. Even though strains that lack GCN4, BAS1, and BAS2 (gcn4-2 basl-2 bas2-2) are His- and almost completely lack HIS4 transcription, extracts prepared from these strains contain a factor that binds very strongly to the HIS4 promoter. In fact, experiments using extracts prepared from wild-type yeast cells show that this factor represents greater than 90% of all the in vitro binding activity to the HIS4 promoter (1, 2; also see Fig. 1A). In this report, we show that this major HlS4 promoter-binding factor is the previously identified RAP1 protein (24). RAP1 is most probably the same factor as GRF1 (5) and TUF (16). RAP1 binds to the E box of silencers (24), to the simple repeat sequence of telomeres (5), and to the promoters of many different genes, particularly those encoding glycolytic enzymes (such as ADHI [6] and PGK [8]) and those encoding proteins involved in translation (such as TEF2 [6]). However, very little is known about how RAP1 functions at these diverse binding sites. In this report, we show the HIS4 RAPl-binding site is required for both the GCN4-dependent and BAS1/BAS2dependent activation of HIS4 transcription. The finding that RAP1 is required for GCN4-dependent transcription at HIS4 was unexpected, since in vitro binding studies showed that RAP1 binds competitively with GCN4 (to its high-affinity site C). However, this apparent contradiction may be explained by the finding that RAP1 increases the micrococcal nuclease sensivitity of both the HIS4 high-affinity GCN4binding site and the BAS1/BAS2-binding sites when present within chromatin. We present a model in which RAP1 functions to maintain the accessibility of GCN4, BAS1, and BAS2 for their respective DNA-binding sites when these sites are present within chromatin. MATERIALS AND METHODS

Corresponding author. t Present address: Department of Biological Sciences, CarnegieMellon University, Pittsburgh, PA 15213. *

Strains and media. Table 1 shows the genotypes of yeast strains used in this study. Media YPD, YNB, SC (synthetic 3642

YEAST HIS4 GENE TRANSCRIPTION REQUIRES RAP1

VOL. 11, 1991

3643

TABLE 1. Yeast strains Strain

Background'

Genotype

AY883 CY544 CY550 CY546 CY542 CY555

MATa gcn4-2 basl-2 bas2-2 ura3-52 leu2-3,112 URA3 at position -123 of HIS4 Same as AY883 but with wild-type HIS4 Same as AY883 but with HIS4-51 Same as AY883 but with HIS4-52 Same as AY883 but with HIS4-53 Same as AY883 but with HIS4-54

a a a a a a

CY552 CY778 CY780 CY615 CY619 CY617

Same as AY883 but with HIS4-56 Same as AY883 but with HIS4-61 Same as AY883 but with HIS4-62 Same as CY544 transformed with pCB651 (wild-type GCN4 on YCp5O) Same as CY550 transformed with pCB651 (wild-type GCN4 on YCp5O) Same as CY546 transformed with pCB651 (wild-type GCN4 on YCp5O)

a a a a a a

CY621 CY613 CY609 CY782 CY776 CY931

Same as CY542 transformed with pCB651 Same as CY555 transformed with pCB651 Same as CY552 transformed with pCB651 Same as CY778 transformed with pCB651 Same as CY780 transformed with pCB651 Same as CY544 but with BAS2

GCN4 on YCp5O) GCN4 on YCp5O) GCN4 on YCp5O) GCN4 on YCp5O) GCN4 on YCp5O)

a a a a a a

CY932 CY933 CY945 CY946 CY947 CY948

Same as Same as Same as Same as Same as Same as

CY550 but with BAS2 CY542 but with BAS2 CY931 transformed with YCp5O CY931 transformed with pCB291 (wild-type BASI on YCp50) CY932 transformed with YCp5O CY932 transformed with pCB291 (wild-type BASI on YCp5O)

a a a a a a

CY949 CY950 CY1095

Same as CY933 transformed with YCp50 Same as CY933 transformed with pCB291 (wild-type BASI on YCp5O) Same as CY946 transformed with pCB1099 (wild-type GCN4 on LEU2/centromere plasmid) Same as CY948 transformed with pCB1099 (wild-type GCN4 on LEU2/centromere plasmid) Same as CY950 transformed with pCB1099 (wild-type GCN4 on LEU2/centromere plasmid) MATa ura3-1 leu2-3,112 his3-11,15 trpl-l ade2-1 canl-100

a a a

Same as CY304 but with RAPJ-A21 hmr::TRPI

b

Same as CY304 but with RAPI-A22 hmr::TRPI

b

MATa sit)-9 gcn4-2 basl-2 bas2-2 ura3-52 inol-13 URA3 at position -650 of HJS4 MATa sit2-1 gcn4-2 basl-2 bas2-2 ura3-52 inol-13 URA3 at position -650 of HIS4 MATa sit3-76 gcn4-2 basl-2 bas2-2 ura3-52 inol-13 URA3 at position -650 of HJS4 MATa sit4-32 gcn4-2 basl-2 bas2-2 ura3-52 inol-13 URA3 at position -650 of HIS4

c c c c

CY1097 CY1099 CY304 (W303a)

CY303 (also called YLS92) CY302 (also called YLS91) SAx9-1B SAx1-3B SAx76-2D SAx32-2A

(wild-type (wild-type (wild-type (wild-type (wild-type

a These strains represent three isogenic sets (a, b, and c) except for the indicated changes. The reference 27. The c set of strains is from Arndt et al. (3).

complete), SC-His (synthetic complete medium without histidine), SD-His, and SD+His (SD medium plus histidine) are as described previously (2, 3). Glucose was used at 2% for all media. Preparation of HIS4 promoter mutations. A 764-base HIS4 promoter fragment (sequences -733 to +31 relative to the A of the HIS4 ATG) was placed into the BamHI site of pUC118, yielding plasmid pCB576. This plasmid was transformed into a dut ung mutant F' host (CJ236 [19]), and single-stranded DNA was prepared by infection with M13K07 helper phage (29). The resulting single-stranded DNA was individually hybridized with oligonucleotides containing the base changes shown in Fig. 2 (except for HIS462). HIS4-62 was prepared by using HIS4-53 as the template DNA to introduce the SpeI site. The single-stranded DNAoligonucleotide hybrids were made into double-stranded plasmids by polymerization with Klenow enzyme (Boehr-

a

and b sets

are

a

a

b

from this study. For W303a (CY304),

see

inger Mannheim), ligation with T4 DNA ligase (New England BioLabs), and transformation into Escherichia coli HB101. The resulting plasmids are pCB590 (HIS4-56), pCB594 (HIS4-54), pCB596 (HIS4-52), pCB599 (HIS4-53), pCB600 (HIS4-51), pCB844 (HIS4-61), and pCB846 (HIS462). The entire length of the HIS4 insert was sequenced for each of these plasmids, including the starting plasmid containing wild-type HIS4 (pCB576). Every HIS4 insert contained the expected HIS4 promoter mutation and no changes anywhere else. The HIS4 promoter mutations were placed into the HIS4 chromosomal locus of strain AY883 by cotransformation. Strain AY883 is MATTa gcn4-2 basl-2 bas2-2 ura3-52 leu23,112 and contains the URA3 gene (on a 1.2-kb HindIIIHindIII fragment) inserted at position -123 (relative to A of the HIS4 ATG) of the chromosomal HIS4 gene. Each of the above plasmids containing either the wild-type HIS4 pro-

3644

DEVLIN ET AL.

moter or the indicated HIS4 promoter mutation (150 ,ug digested with EcoRl and HindIll to generate the HIS4 insert with small lengths of pUC118 polylinker sequences at each end) was mixed with 50 jig of YEp13 (contains the LEU2 gene). These DNA mixes were transformed into spheroplasts (14) of strain AY883, selecting for Leu+ colonies. These Leu+ transformants were plated onto 5-fluoro-orotic acid medium which allows only Ura- cells to grow (4). For each of the HIS4 mutations (or for wild-type HIS4), about one half of the Ura- cells contained the desired chromosomal HIS4 mutation (or wild-type HIS4) as determined by Southern analysis. Since each of the HIS4 promoter mutations introduced a restriction site, we were able to confirm the presence of the desired mutation in the final strains. Strain CY780, containing HIS4-62, had both the Spel site and the HindIll site. The above procedure yielded an isogenic set of yeast strains that differs only at the chromosomal HIS4 locus. All of the resulting strains were grown nonselectively to allow loss of the YEp13 plasmid (used for selection in the transformation). The genetic background of the original set of strains was gcn4-2 basl-2 bas2-2 ura3-52 leu2-3,11. To obtain the GCN4 basl-2 bas2-2 set of strains containing wild-type HIS4 or the HIS4 mutations, the original set of strains was transformed to Ura+ with the wild-type GCN4 gene (2.8-kb SalI-EcoRI fragment) in YCp5O (pCB651 is p164 of reference 12). To obtain the gcn4-2 BASJ BAS2 strains containing the HIS4 mutations, the gcn4-2 basl-2 bas2-2 strains that contained wild-type HIS4, HIS4-51, or HIS4-53 were first transformed to Pho+ (BAS2 = PH02) on YPD-PO4 medium (2) with a 3.6-bp HindIlI-HindlIl yeast DNA fragment that contains the BAS2 gene. This procedure generates a wild-type chromosomal BAS2 locus. These gcn4-2 basl-2 BAS2 strains were then transformed with YCp5O containing the wild-type BASI gene (pCB291; 28). The GCN4 BASI BAS2 set of strains was obtained by transforming the gcn4-2 BASI BAS2 set of strains with a LEU2/centromere plasmid containing the wild-type GCN4 gene (pCB1099). Northern (RNA) analysis. Northern analysis of steadystate RNA levels was performed as previously described (3). Micrococcal nuclease digestion. The procedure for micrococcal nuclease digestion was adapted from the method of Nelson and Fangman (21) by Mitchell Smith (Department of Microbiology, University of Virginia School of Medicine). One liter of cells (at 107 cells per ml in YPD medium) was centrifuged, and the resulting pellet was washed once with water and resuspended in 150 ml of SPC buffer [1.1 M sorbitol, 0.02 M piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES) (pH 6.3), 0.5 mM CaCl2]. Then, 0.75 ml of 2-mercaptoethanol was added and the cells were incubated for 10 min at 30°C. Two milligrams of a 1:1 mixture of Zymolyase 20T and Zymolyase 100T (Miles Scientific) was added per gram of cells. The cells were incubated with gentle shaking at 30°C for 35 min. The cells were centrifuged, and the resulting pellet was washed with 40 ml of cold SPCP buffer (SPC buffer plus 1 mM phenylmethylsulfonyl fluoride [PMSF] plus 1 ,ug [each] of leupeptin, chymostatin, antipain, and pepstatin [all from Sigma] per ml). After the cells were resuspended in 0.75 ml of SPCP buffer, 30 ml of FPCP buffer (18% Ficol [Pharmacia], 0.02 M PIPES [pH 6.3], 0.5 mM CaCl2, 1 mM PMSF, and 1 ,g [each] of leupeptin, chymostatin, antipain, and pepstatin per ml) was added. Lysis of the cells was aided by five strokes in a Dounce homogenizer with a tight-fitting pestle. Cell debris and unlysed cells formed a pellet after centrifugation at 3,000 x g for 7 min.

MOL. CELL. BIOL.

The nuclei formed a pellet after centrifugation at 25,000 x g for 30 min. The resulting pellet was resuspended in 7.5 ml of SPCP buffer, and the nuclei again formed a pellet after centrifugation at 25,000 x g for 15 min. The nuclear pellet was resuspended in 2 ml of SPC buffer, and then 0.5-ml aliquots were placed into four microcentrifuge tubes. The samples were prewarmed at 37°C for 2 min. Micrococcal nuclease (Worthington) was added to give final concentrations of 1, 3, 10, and 30 Worthington units per ml and the samples were incubated for 5 min at 37°C. For naked DNA controls, total yeast DNA was extracted with phenol, precipitated with ethanol, and then treated with micrococcal nuclease under conditions identical to those used for the nuclei. The micrococcal nuclease digestions were terminated by the addition of 20 ,ul of 0.5 M EDTA and 50 ,ul of 10% sodium dodecyl sulfate and placed on ice. The samples were then extracted four times with phenol-chloroform (1:1) and precipitated with ethanol. The DNA was dissolved in 100 ,u of TE buffer, and then 10 ,ul of 3 M sodium acetate (pH 7.0) and 2 ,ul of RNase I (10 mg/ml) were added. The samples were incubated at 37°C for 30 min and ethanol precipitated. The DNA was dissolved in 90 RI1 of TE buffer, and then 10 pu1 of 1Ox Sall digestion buffer was added. The samples were then digested to completion by the addition of 7 ,ul of Sall restriction enzyme (New England BioLabs). The samples were phenol extracted, ethanol precipitated, resuspended in 50 ,ul of TE buffer, and loaded onto a 25-cm 1.2% agarose gel. The DNA was then transferred to a nylon membrane and probed as described in the legend to Fig. 9. RESULTS RAP1 binds to the HIS4 promoter. When whole-cell or nuclear extracts of yeast are used for gel shift (Fig. 1A) or DNase I footprint analysis (1), greater than 90% of the binding activity to the HIS4 promoter is due to a single binding factor. This major HIS4 promoter-binding factor is not GCN4, BAS1, or BAS2, since it is present in extracts prepared from strains in which GCN4, BASI, and BAS2 have been deleted (2). Since the region of the HIS4 promoter that this DNA-binding factor protects from DNase I (1) is similar to the known DNA-binding sites of the RAP1 protein (see Fig. 2), we wished to determine whether this binding factor could be the RAP1 protein. For this analysis, extracts were prepared from a set of three isogenic yeast strains that differed only in the molecular weight of RAP1. One strain contained wild-type RAP1, while the other two strains contained RAP1 protein with parts of their amino-terminal regions deleted. Strains containing these smaller RAP1 derivatives as the only source of RAP1 are viable and grow with normal growth rates (RAP] is an essential gene). Gel shift analysis using extracts prepared from these three strains shows that the protein-DNA complex due to the major HIS4 promoter-binding factor increases in mobility as the molecular weight of RAP1 decreases (Fig. 1A). HIS4 promoter mutations located within the DNase I footprint of the major HIS4 promoter-binding factor eliminate binding of RAP1 (for example, HIS4-56 in Fig. 1B). In addition, RAP1 binds to the HIS4 promoter at least as tightly as it binds to the HMR RAPl-binding site (E box [Fig. 1B]). Therefore, RAP1 binds tightly to the HIS4 promoter and is the major HIS4 promoter-binding factor present in extracts prepared from yeast cells. At HIS4, RAP1 cannot efficiently activate transcription by itself. Strains in which GCN4, BASI, and BAS2 have been deleted have normal levels of RAPl-binding activity to the

VOL.

YEAST HIS4 GENE TRANSCRIPTION REQUIRES RAP1

11, 1991 WA T

{0-i 'HfJrS4

W' HZS4

RAP

NT A2

A

-56

R

AP

W HIS4 E Bcx

A22 B

__

FREE,_ FRrF

FIG. 1. The major in vitro HIS4 promoter-binding factor is

RAP1. (A) Gel shift analysis using labelled wild-type (WT) HIS4 promoter was performed as previously described (3). The strains used to prepare the extracts were CY304 (has wild-type RAPI which encodes wild-type RAP1 with 827 amino acids), CY303 (has RAPIA21 which encodes an altered RAP1 that lacks amino acids 274 to 303, giving a total of 801 amino acids), and CY302 (has RAPI-A22

which encodes an altered RAP1 that lacks amino acids 44 to 274, giving a total of 601 amino acids). All extracts were diluted to 1.0 pg of total protein per ml (using the BioRad protein assay with bovine serum albumin [BSA] as the standard). For each assay, 1 ,ul of the extract was used in a total volume of 25 ,ul. Even though GCN4, BAS1, and BAS2 are present in these extracts, their binding activities are not detectable relative to that of RAP1 at this exposure. (B) Gel shift analysis using an extract prepared from a strain (CY544) that contains wild-type RAP1. All three assays used identical amounts (2.5 ILI, at 1.2 pg of total protein per ml, using the BioRad protein assay with BSA as the standard) of the same extract in a total volume of 25 p1I. These assays used labelled DNA fragments consisting of either the HIS4-56 promoter fragment (169 bp), the wild-type HJS4 promoter fragment (169 bp), or the HMR E silencer region (which contains the RAPl-binding site called the E

box).

HIS4 promoter (see Fig. 6 of reference 2). However, even though RAP1 strongly binds to the HIS4 promoter, strains in which GCN4, BASI, and BAS2 have been deleted are Hisand have no HIS4 transcript initiating at the wild-type initiation site (3). As assayed by the levels of P-galactosidase resulting from a HIS4-lacZ fusion, a wild-type strain gives over 300 U, while a gcn4-2 basl-2 bas2-2 strain gives less than 0.5 U (both strains grown in SD+Ade+Arg+His medium). Therefore, RAP1 by itself cannot efficiently stimulate HIS4 transcription. The sit mutations were identified by isolating His+ revertants from a gcn4-2 basl-2 bas2-2 strain (which is His-; 3). These sit mutations were isolated in order to identify mutations in genes encoding general transcription factors. sit] and sit2 alleles are mutations in the genes encoding the largest and second largest subunits, respectively, of RNA polymerase II. sit4 alleles are mutations in a gene encoding a serine/threonine protein phosphatase (3). In addition, sit3 alleles are mutations (26a) in the previously identified GCRI gene (10), which is required for high-level expression of many glycolytic enzymes. The siti through sit4 mutations restore HIS4 transcription at the wild-type initiation site in gcn4-2 basl-2 bas2-2 strains and also alter the transcription of many other unrelated yeast genes. Since the gcn4-2 basl-2

3645

bas2-2 starting strain used to obtain the sit revertants contains RAP1, we wished to analyze whether the His' phenotype of the sit revertants requires RAP1. For this analysis, we prepared an isogenic set of gcn4-2 basl-2 bas2-2 strains which differs only at the RAP1-binding site of the chromosomal HIS4 promoter (see Materials and Methods). Each HIS4 mutation changes 3 to 5 bases within the RAPl-binding site, but in a region completely outside the DNase I footprint of BAS2 and GCN4 (Fig. 2). These mutations eliminate RAP1 binding in vitro (for instance, HIS4-56 in Fig. 1B) but, as expected, do not reduce the in vitro binding of BAS2 and GCN4 (data not shown). A few different chromosomal HIS4 promoter mutations were prepared so that the results would not be dependent on the particular base changes made for any one HIS4 promoter mutation. Three of the HIS4 RAPlbinding site mutations were combined with the siti through sit4 mutations in a gcn4-2 basl-2 bas2-2 background. In each case, mutation of the HIS4 RAPl-binding site eliminates suppression to His' by the sit mutations (Fig. 3). Therefore, RAP1 binds to the HIS4 promoter in vivo in the absence of GCN4, BAS1, or BAS2. RAP1 is required for normal transcription of HIS4. A GCN4 BASI BAS2 strain containing the wild-type HIS4 gene is His'. However, GCN4 BASI BAS2 strains containing point mutations in the HIS4 RAP1-binding site have a His+/ phenotype (Fig. 4A). As determined by Northern analysis of steady-state HIS4 RNA levels, a GCN4 BASI BAS2 strain containing the wild-type HIS4 promoter (previously shown to initiate at -63 relative to the A of the HIS4 ATG [20]) has high levels of HIS4 RNA (Fig. 4B). In contrast, isogenic GCN4 BAS1 BAS2 strains that contain point mutations in the HIS4 RAPl-binding site have much reduced levels of HIS4 RNA and most of this RNA is shorter than the normal HIS4 RNA (Fig. 4B). Therefore, when HIS4 transcription is activated by both the BAS1/BAS2 and GCN4 systems, the HIS4 RAPl-binding site is required for normal levels of transcription. BAS1/BAS2-dependent transcription of HIS4 requires RAP1. A gcn4-2 BASI BAS2 strain containing the wild-type HIS4 promoter is His' (2). As measured by the levels of galactosidase resulting from a HIS4-lacZ fusion, a gcn4-2 BAS1 BAS2 strain has 115 U of P-galactosidase (28) when grown on SD+Arg medium (compared with 300 U for a GCN4 BASI BAS2 strain) and 15 U when grown on SD+Arg+Ade medium (compared with 50 U for a GCN4 BAS1 BAS2 strain [2]). BAS1 and BAS2 are both required for HIS4 basal-level transcription. BAS1 by itself or BAS2 by itself cannot stimulate transcription from the wild-type HIS4 promoter. Since the RAPl-binding site is adjacent to the BAS2binding site on the HIS4 promoter (Fig. 2), we investigated the role of RAP1 in BAS1/BAS2-dependent HIS4 transcription. Although gcn4-2 BASI BAS2 strains containing the wild-type HIS4 promoter are His+, gcn4-2 BASI BAS2 strains with mutations in the RAPl-binding site of the HIS4 promoter are His- (Fig. SA). As determined by Northern analysis of steady-state RNA levels, a gcn4-2 basl-2 bas2-2 strain containing the wild-type HIS4 promoter has very low amounts of HIS4 RNA, which is primarily of two lengths (Fig. SB, lane 1). Primer extension analysis has previously shown that the shorter RNAs initiate within HIS4 coding sequences and that the longer RNAs initiate 5 to 10 bases upstream of the normal BAS1/BAS2- or GCN4-dependent initiation site (which is at -63 relative to HIS4 ATG; 3, 22). The longer HIS4 RNAs are not detectable in gcn4-2 basl-2 bas2-2 strains with mutations within the I-

3646

MOL. CELL. BIOL.

DEVLIN ET AL.

A A

C

B

-_-

II

I -258

RAP1

-187

B 1IS4

SITE CREBATE

allele

HIS4-51 HIS4-52 HIS4-53 HIS4-54 B1S4-56 IS4-61 HIS4-62

GCTAAqtaCL

SacI ScaI

l2*Z GCTAAACttTGCAC GrCTCAC* * GCTAAtCaotTGCACAGTG&CTCC* GCTAtctaIATGCACAGTGACTCACGT

HindIII ClaI XbaI

GCTAAACCCATGCACAGTI'-5QTl(ILTT

SpeI SpeI +

q G

GCTAAgCttTGCACAGTG&C3gtGT

EL.DTE BINDDr OF

RAP1 RAP1 RAP1 RAP1 RAP1

GCN4 GCN4+RAP1

HindIII wild type HIS4

GCTAAACCCATGCACAGTGACTCACGTT

none

none

AAACCCAgaCACg PGK promoter AAACCCATaCAtc ADH1 promoter FIG. 2. Binding sites at the HIS4 promoter and HIS4 promoter mutations. (A) This diagram accurately shows the regions of the HIS4 promoter protected from DNase I by BAS1 and BAS2 (data from reference 28) and by GCN4 and RAP1 (data from reference 1). Arrows A, B, and C are 5'-TGACTC-3' sequences to which GCN4 and BAS1 bind. GCN4 binds much more tightly to repeat sequence C than to the A and B repeats (1). BAS1 binds much more tightly to repeat sequence B than to the A anc C repeats (28). The numbers are relative to the A of the HIS4 ATG methionine start codon. (B) HIS4 promoter mutations used in this study. The lowercase letters indicate changes from the wild-type HIS4 promoter sequence. The underlined regions show the newly created restriction sites. For each new site, 3- to 5-base changes were made.

HIS4 RAPl-binding site (Fig. SB, lanes 3 and 5). The shorter RNAs that initiate within HIS4 coding sequences are not affected by the presence or absence of the RAPl-binding site. Therefore, RAP1 by itself (in the absence of GCN4, BAS1, and BAS2) is able to very weakly stimulate transcription from the HIS4 promoter at a site 5 to 10 bases upstream from the normal HIS4 initiation site. This amount of HIS4 RNA is not able to give rise to a His' phenotype. BAS1 and BAS2 together (strain CY946; gcn4-2 BAS1 BAS2) are able to stimulate transcription from the wild-type HIS4 promoter to give increased amounts of the longer HIS4 RNA (Fig. 5B, lane 2). Primer extension analysis has previously shown that the longer HIS4 RNA of a gcn4-2 BASI BAS2 strain initiates primarily at -63 relative to the HIS4 ATG (the same as for GCN4-dependent transcription; 22). However, when the RAPl-binding site within the HIS4 promoter is mutated, BAS1 and BAS2 are not able to efficiently stimulate transcription from the normal initiation site (absence of longer HIS4 RNAs in lanes 4 and 6 of Fig. SB). Therefore, BAS1/BAS2-dependent transcription from HIS4 requires RAP1.

Normal GCN4-dependent transcription of HIS4 requires RAP1. GCN4 is able to activate transcription of HIS4 (and other promoters) independently of BAS1 and BAS2 (2). A GCN4 basl-2 bas2-2 strain containing the wild-type HIS4 promoter is His' (Fig. 6A). In contrast, GCN4 basl-2 bas2-2 strains with mutations within the HIS4 RAPl-binding site are His+' (Fig. 6A). On SC-His medium, the sizes of the visible colonies for the strains containing HIS4 RAPl-binding site mutations are very variable. In addition, the strains containing RAPl-binding site mutations give rise to fewer visible colonies than the strain containing wild-type HIS4. Microscopic analysis of the plates shows that greater than 98% of the cells for the GCN4 basl-2 bas2-2 strain containing wild-type HIS4 give rise to large colonies on SC-His medium (data not shown). In contrast, for the GCN4 basl-2 bas2-2 strains containing mutations within the HIS4 RAPlbinding site, about 30% of the cells do not divide at all (the cells remain unbudded) and about 20% of the cells give rise to microcolonies on SC-His medium (Fig. 6B). The extent or nature of prior histidine starvation is not very important. For the results shown in Figure 6, the cells

cZ

-_ S 4 5 t _9

S

-

-AT -,5i ~

A

,

mz-ll' UAT -5/ -52 -56

-52 -56z

~

-1

~

/,2-.i

7i54 - 5; c

x,

YEAST HIS4 GENE TRANSCRIPTION REQUIRES RAP1

VOL . 1 l, 1991

¢4- T2

FIG. 3. The sit mutations require RAP1 for His' suppression. An isogenic set of MATa gcn4-2 basl-2 bas2-2 ura3-52 strains containing wild-type HIS4 or HIS4 promoter mutations within the RAPl-binding site were crossed with a different isogenic set of MATa gcn4-2 basl-2 bas2-2 ura3-52 strains containing a URA3marked HIS4 gene and sit] through sit4. For each cross, at least 4 Ura- (contains desired HIS4 allele from MATat strain) sit progeny were examined and shown to have equivalent His phenotypes. Only one of the progeny for each cross is shown in the figure. The panels show the growth on SD-His or SD+ His medium after 4 days at 30°C.

B

A rV

-

HI/S 4

-53

/'154-5/

B 5 I4:

wV

m

-5/

-53

_

_

AC.-

FIG. 4. Normal transcription of HIS4 requires RAP1. (A) The growth phenotypes of isogenic GCN4 BASI BAS2 strains containing either wild-type HJS4 or the indicated HIS4 promoter mutations on SC-His medium is shown after 2 days at 30°C. The strains used were CY1095 (wild-type [WT] HIS4), CY1097 (HIS4-51), and CY1099 (HIS4-53). (B) Northern analysis of steady-state HIS4 RNA levels for GCN4 BASI BAS2 strains containing either wild-type (WT) HIS4 (CY1095), HIS4-51 (CY1097), or HIS4-53 (CY1099). Total RNA was prepared from exponentially growing cells in SC-Ura-Leu medium, and 5 jig of total RNA was loaded per lane of a 1% agarose gel. The blot was probed first (2-day exposure at -70°C) with an internal 2.2-kb XhoI-XbaI fragment of the HIS4 gene that was labelled using [a-32P]ATP (random hexamer primed). The blot was subsequently probed with a similarly labelled ACT] probe to control for the amount of RNA loaded in each lane.

:AT H 54

H15 4- 5

A /1154 H154-5/ HIS4-53 Y Y B Y 3 B

1

that were placed onto the SC-His plates were from colonies on an SC-Ura plate that contained 0.1 g of histidine per liter (some of the cells within each colony on these plates are somewhat limited for histidine because of slow diffusion of histidine through the agar and the growing colony itself).

3647

/1~~~~154

w

*

2

4*.*

v 4

3

4

AC?T/

&

5

6

FIG. 5. BAS1/BAS2-dependent transcription of HIS4 requires RAP1. (A) The growth phenotypes of isogenic gcn4-2 BASI BAS2 strains containing either wild-type (WT) HIS4 or the indicated HIS4 promoter mutations on SC-His medium is shown after 3 days at 30°C. The strains used were CY946 (wild-type HIS4), CY948 (HIS4-51) and CY950 (HIS4-53). (B) Northern analysis of steadystate HIS4 RNA levels for gcn4-2 BASI BAS2 strains (B lanes) and for gcn4-2 basl-2 bas2-2 strains (Y lanes) containing either wild-type HIS4 or the indicated HIS4 promoter mutation. Total RNA was prepared from exponentially growing cells in SC-Ura medium, and 7 pLg of total RNA was loaded per lane of a 1% agarose gel. For the HIS4 probe, the blot was exposed for 3 days at -70°C with one screen.

Very similar results are obtained when the strains are grown to a low density (2 x 107 cells per ml to avoid amino acid limitation) in liquid medium containing 0.1 g of histidine per ml (data not shown). Since the levels of the GCN4 protein increase during conditions of limitation for histidine or any other amino acid (13), we also restreaked colonies from one SC-His plate onto a second SC-His plate. Even though the GCN4 basl-2 bas2-2 strains containing mutations within the HIS4 RAPl-binding site are partially starved for histidine on the first SC-His plate (and GCN4 levels should be induced), these cells give rise on a second SC-His plate to only slightly more visible colonies and only slightly more microcolonies than those shown in Fig. 6 (data not shown). As determined by Northern analysis of steady-state HIS4 RNA levels, unstarved GCN4 basl-2 bas2-2 strains that contain mutations within the RAPl-binding site have very little full-length HIS4 RNA compared with that of an isogenic strain that contains the wild-type HIS4 promoter (Fig. 7A). Since unstarved cells contain low levels of GCN4, we analyzed the steady-state levels of HIS4 RNA as a function of time after inducing amino acid starvation, which rapidly increases the levels of the GCN4 protein (13). For these experiments, amino acid starvation was induced by the addition of 5-methyltryptophan (to a final concentration of 1 mM) to medium containing histidine. The presence of histidine permits strains with various His phenotypes to grow at the same rate. For a GCN4 basl-2 bas2-2 strain that contains the wild-type HIS4 promoter, the maximal levels of steadystate HIS4 RNA are achieved within 0.5 h after inducing starvation (Fig. 7B). In contrast, isogenic GCN4 basl-2

DEVLIN ET AL.

3648

A

MOL. CELL. BIOL.

A

h/IS 4-5/

B J HIS4

S ei v

51

(

-53 A *

'/2

2

4;~r

4 _0

.0

H/54

i. I

H154-52

_

WT H!54

AC7T

*

r -

2

N rs5/

jt /

;T

51

4

WT

-5;

_N

'

/H154-53

*

WT

-5

_

%--

A -r WT

HIS 4

/H154-54 A677/

B I

AVT

5 -53

w-32 WT

*

FIG. 6. RAP1 is required for a normal GCN4-dependent His' phenotype. (A) The growth phenotypes of isogenic GCN4 basl-2 bas2-2 strains containing either wild-type (WT) HIS4 or the indicated HIS4 promoter mutations on SC-His medium are shown after 2 days at 30°C. Before being plated on the SC-His plates, the strains were pregrown on SC-Ura plates. The strains used were CY615 (wild-type HIS4), CY619 (HIS4-51), CY617 (HIS4-52), CY621 (HIS4-53), and CY613 (HIS4-54). Each of the original strains was also transformed with YCp5O instead of CB651 (wild-type GCN4 on YCp5O). All of these YCp5O-containing gcn4-2 basl-2 bas2-2 strains had a tight His- phenotype. (B) Microscopic view of strain CY621 (HIS4-53 GCN4 basl-2 bas2-2) on SC-His plates. Before being plated on SC-His plates, the strains were pregrown on SC-Ura plates. Many cells do not divide at all; these are the smallest barely visible white dots in the figure. The three largest colonies in the right panel are the size of the visible colonies in the plate view shown in Fig. 6A.

bas2-2 strains that contain mutations within the HIS4 RAPlbinding site take 6 h to achieve the maximal levels of steady-state HIS4 RNA (Fig. 7C). Even at 6 h, the levels of steady-state HIS4 RNA in strains that contain mutations in the HIS4 RAPl-binding site are much lower than in the strain that contains wild-type HIS4. GCN4 can bind in vitro to five different sites within the HIS4 promoter (1). However, GCN4 binds much more tightly to site C than to the other sites (1). Binding site C is the GCN4 site shown in Fig. 2. Interestingly, in vitro, the binding of GCN4 to site C is competitive with RAP1 (1). At high concentrations of RAP1, GCN4 is displaced from site C, whereas GCN4 can still bind to the weaker binding sites A, B, D, and E. Conversely, at high GCN4 concentrations, GCN4 can displace RAP1 from its binding site. To demon-

-53

o .*Xv

A,

-53

WNT

-537

**

A

.CT

FIG. 7. Normal GCN4-dependent transcription of HIS4 requires RAP1. (A) Northern analysis of steady-state HIS4 RNA levels of GCN4 basl-2 bas2-2 strains CY615 (wild-type [WT] HIS4), CY619 (HIS4-51), and CY621 (HIS4-53) grown on SC-Ura medium. Since the strains were not starved for amino acids, this panel shows the levels of HIS4 RNA resulting from the low uninduced levels of GCN4 protein. The majority of the HIS4 RNAs from the HIS4-51 and HIS4-53 strains (which are not detected for the 0 h time point in the exposures shown in panel C, see below) are shorter than those from the wild-type HIS4 strain. For each lane, 5 ,ug of total RNA was loaded. For the HIS4 probe, the blot was exposed for 6 days at -70°C with one screen. (B) Northern analysis of steady-state HIS4 RNA levels of a GCN4 basl-2 bas2-2 strain containing wild-type (WT) HIS4 (CY615) grown on SC-Ura-Trp medium after addition of 5-methyltryptophan to 1 mM. Addition of 5-methyltryptophan increases the levels of GCN4 protein because of starvation for tryptophan. The number of hours after addition of the 5-methyltryptophan is indicated. For each lane, 5 ,ug of total RNA was loaded. For the HIS4 probe, the blot was exposed for 24 h at -70°C with one screen. (C) Northern analysis of steady-state HIS4 RNA levels of GCN4 basl-2 bas2-2 strains containing wild-type (WT) or mutated HIS4 promoters grown on SC-Ura-Trp medium after addition of 5-methyltryptophan to 1 mM. The number of hours after addition of the 5-methyltryptophan is indicated. The strains used were CY615 (wild-type HIS4), CY619 (HIS4-51), and CY621 (HIS4-53). For each lane, 5 jig of total RNA was loaded. For the HIS4 probe, the blot was exposed for 34 h at -70°C with one screen. For all panels, the blots were subsequently probed with the ACT] gene to control for the amount of RNA loaded onto each lane.

strate that the GCN4-dependent transcription of HIS4 in vivo is primarily dependent on the high-affinity site C, we made a 3-base change in GCN4 site C that lies outside the RAP1 DNase I footprint. As expected, this mutation (HIS4-61 [Fig. 2]) eliminates GCN4 binding to site C in vitro but does not reduce the in vitro affinity of RAP1 for its site (data not shown). A GCN4 basl-2 bas2-2 strain containing a

A

WT HIS4-53

WT HIS4

U H154-61

HfIS4-62

B SITE MUTATED:

RAP!

NONE

H154 -53 5-MT:

~ ' ~BASI/BAS2

YEAST HIS4 GENE TRANSCRIPTION REQUIRES RAP1

VOL . 1 l, 1991

+

1,

bd6

-

4

GCN4+RAPI

GCN4

WTHIS4 H154-61 +

~~ ~~

-

3649

-5/ -53 :HIS4

S

U

- TATA

a

I

, GNC4

_

RAPI

stteC

HIS4-62

+

+

-

-

-

1-5HIS4

_

ACT!

FIG. 8. The single high-affinity GCN4-binding site C is essential for GCN4-dependent HIS4 transcription. (A) The growth phenotypes of isogenic GCN4 basl-2 bas2-2 strains containing either wild-type (WT) HIS4 or the indicated HIS4 promoter mutations on SC-His medium is shown after 3 days at 30°C. The strains used were CY615 (wild-type HIS4), CY621 (HIS4-53), CY782 (HIS4-61), and CY776 (HIS4-62). Isogenic gcn4-2 basl-2 bas2-2 strains are His-. (B) Northern analysis of steady-state HIS4 RNA levels of GCN4 basl-2 bas2-2 strains CY615 (wild-type [WT] HIS4), CY621 (HIS453), CY782 (HIS4-61), and CY776 (HIS4-62) grown on SC-Ura-Trp medium. The - or + indicates 0 or 2 h, respectively, after addition of 5-methyltryptophan (5-MT) to 1 mM to induce amino acid starvation. The HIS4-53 and HIS4-62 strains have no detectable longer H154 transcript. For each lane, 5 SLg of total RNA was loaded. For the H1S4 probe, the blot was exposed for 5 days at -70°C with one screen.

chromosomal HIS4 mutation in GCN4 site C (HIS4-61) is essentially His- (Fig. 8A). Northern analysis of steady-state HIS4 RNA levels of this strain shows that it has much reduced levels of HIS4 RNA (HIS4-61 in Fig. 8B). Even 2 h after induction of amino acid starvation (and hence increasing the levels of GCN4) by the addition of 5-methyltryptophan, the GCN4 basl-2 bas2-2 strain containing a mutation within HIS4 GCN4 site C has very little HIS4 RNA (HIS4-61 [Fig. 8B]). Therefore, the high-affinity GCN4-binding site C is almost completely essential for GCN4-dependent transcription from HIS4. The GCN4 basl-2 bas2-2 strain containing a mutation in GCN4 site C (HIS4-61) does have some detectable growth on SC-His medium compared with the HIS4-62 strain (Fig. 8A). Either GCN4 sites A, B, D, and E are able to give some amount of functional GCN4-dependent HIS4 transcription or the mutated GCN4 site C in the HIS4-61 allele is able to bind GCN4 very weakly in vivo. RAP1 increases accessibility to the GCN4 and BAS2/BAS1 sites in HIS4 chromatin. Although RAP1 is required for normal GCN4-dependent transcription at HIS4, RAP1 competes with GCN4 in vitro for binding to the high-affinity GCN4-binding site C. As shown above, GCN4-binding site C is essential for normal GCN4-dependent transcription of HIS4. To gain insight into this apparent contradiction, we

FIG. 9. Micrococcal nuclease sensitivity of HIS4 chromatin. After treatment of the nuclear fraction with micrococcal nuclease (all at 30 U/ml for the lanes shown, which were all from the same gel), the DNA was extracted with phenol-chloroform and digested with Sanl enzyme. Sall cuts at positions -1103 and +469 (relative to the A of the HIS4 ATG). The DNA was fractionated on a 1.2% agarose gel and Southern transferred to a nylon membrane (Biotrans; ICN). The blot was probed with a 32P-labelled 286-bp SaiI-SacI fragment (sequences - 1103 to -818 relative to A of HIS4 ATG) that is upstream of the HIS4 promoter. Therefore, downstream sequences are at the top of the figure. The large band at the top of the figure is the 1,572-bp Salf-Sail fragment that was not digested by micrococcal nuclease. The RAPl-, GCN4-, and BAS1/ BAS2-binding sites and the HIS4 TATA sequence (at position - 123) are indicated and were positioned by using internal markers consisting of restriction fragments from the HIS4 gene. These markers

were the Sail (-1103)-Sail (+469) fragment, the Sail (-1103)-AvaI (+96) fragment, the Sail (-1103)-AccI (-132) fragment, and the

Sail (-1103)-BanI (-687) fragment. The approximate positions are as follows. The micrococcal nuclease-sensitive upper band that overlaps GCN4 site C is from positions -163 to -195; the micrococcal nuclease-resistant region between the two closely spaced bands, corresponding to the RAPl-binding site, is from positions -195 to -222; the micrococcal nuclease-sensitive lower band that overlaps the BAS1/BAS2 sites is from positions -222 to -262 (see Fig. 2 for binding site positions). The strains used were CY544

(wild-type [WT] H154), CY550 (HIS4-SI), and CY542 (HIS4-S3). These patterns of micrococcal nuclease sensitivity for HIS4 chromatin are very reproducible from experiment to experiment.

treated crude yeast nuclei with micrococcal nuclease. These experiments show that for chromatin from a strain containing the wild-type HIS4 promoter, both the region of the H154 promoter containing GCN4-binding site C and the region containing the BAS1/BAS2-binding sites are very sensitive to micrococcal nuclease digestion (Fig. 9). In contrast, chromatin from two different isogenic strains containing mutations within the RAP1-binding site shows a much reduced sensitivity to micrococcal nuclease digestion in these two regions (Fig. 9). Micrococcal nuclease digestion of deproteinized naked yeast DNA isolated from the strains used in Fig. 9 shows that the HIS4-51 and HIS4-53 mutations themselves do not cause alterations (compared with wildtype HIS4 DNA) in micrococcal nuclease sensitivity (data not shown). Since the sensitivity of chromatin to digestion by micrococcal nuclease is primarily dependent on the

3650

DEVLIN ET AL.

accessibility of the enzyme to the DNA, the above results suggest that RAP1 functions at the HIS4 promoter by increasing the accessibility of GCN4, BAS1, and BAS2 to their respective binding sites. DISCUSSION The major in vitro binding activity to the HIS4 promoter is due to the RAP1 protein. For a strain in which GCN4, BASI, and BAS2 have been deleted, the sit] through sit4 transcriptional suppressors give rise to a His' phenotype (due to increased HIS4 transcription from the wild-type initiation site [3]) only if the HIS4 RAPl-binding site is intact. Therefore, RAP1 binds to the HIS4 promoter in vivo in the absence of GCN4, BAS1, and BAS2. However, RAP1 by itself is not able to efficiently stimulate HIS4 transcription. The inability of RAP1 to efficiently stimulate HIS4 transcription agrees with the results of Stanway et al. (25), who showed that a DNA fragment of the PGK promoter that contains the RAPl-binding site is not able to efficiently activate transcription in their test promoter. The high-affinity GCN4-binding site C is essential for normal GCN4-dependent HIS4 transcription and overlaps with the RAPl-binding site. Since GCN4 and RAP1 bind competitively in vitro (1) and since RAP1 by itself does not efficiently stimulate HIS4 transcription, we initially expected RAP1 to be a repressor of GCN4-dependent HIS4 transcription. However, experiments using chromosomal point mutations within the HIS4 RAPl-binding site show that RAP1 is required not only for normal GCN4-dependent transcription of HIS4 but also for BAS1/BAS2-dependent transcription of HIS4 Even if the levels of GCN4 are increased by amino acid starvation, RAP1 is still required for GCN4-dependent transcription of HIS4. These results suggest that RAP1 functions at HIS4 by increasing the ability of both GCN4 and BAS1/BAS2 to function as activators of HIS4 transcription. The question is, then, does RAP1 function directly as part of the transcriptional activation complex as a coactivator with GCN4 and as a coactivator with BAS1 and BAS2? Or does RAP1 function indirectly, not as a part of the activation complex, but by potentiating the activities of GCN4 and BAS1/BAS2, which are themselves the direct activators of transcription? Digestion of yeast chromatin with micrococcal nuclease shows that the presence of the RAPl-binding site in the HIS4 promoter causes the regions containing the GCN4- and BAS1/BAS2-binding sites to be more accessible to the nuclease, suggesting that bound RAP1 protein keeps nucleosomes from forming near it. The mechanism by which RAP1 might exclude nearby nucleosome binding is unknown but may involve DNA bending (30). Therefore, RAP1 may function at HIS4 in vivo simply by increasing the accessibility of GCN4, BAS1, and BAS2 to their respective binding sites when present within chromatin. For GCN4, this model is supported by the finding that GCN4 and RAP1 bind competitively in vitro to the HIS4 promoter (1). However, it is possible that GCN4 and RAP1 can bind simultaneously to the HIS4 promoter in vivo. For GCN4, we propose the following model of proteinDNA interactions: when GCN4 dissociates from its highaffinity binding site C, RAP1 rapidly binds to its site at HIS4. The rapid binding of RAP1 would be possible, since RAP1 is a relatively abundant nuclear protein (greater than 4,000 molecules per cell [6]). For GCN4, about one half of its binding site is not included within the RAP1 DNase I footprint, which probably slightly overestimates the actual

MOL. CELL. BIOL.

RAPl-binding site (Fig. 2). For GCN4 to bind to its highaffinity site C, either RAP1 must first dissociate from its binding site or RAP1 remains bound and GCN4 initially binds weakly only to its exposed half site. In this model, RAP1 binds to the HIS4 promoter whenever GCN4 is not bound to site C. In the alternative to this model, RAP1 and GCN4 can bind simultaneously in vivo and RAP1 is part of the activation complex with GCN4. GCN4 can activate transcription independently of RAP1 at other promoters. Both HIS3 (26) and ILV2 (11) have their high-affinity GCN4 site positioned between long poly(A) and/or poly(T) tracts. Because of the observation that poly(A) or poly(T) tracts can prevent nucleosome formation in vitro (18, 23), Struhl (26) suggested that poly(A) and poly(T) tracts could alter chromatin so that general transcription factors can access the template. Likewise, it is possible that poly(A) and poly(T) tracts, by remaining nucleosome free, also increase the accessibility of an adjacent DNA-binding site for its cognate binding factor, such as for GCN4. The HIS4 promoter does not have the long stretches of poly(A) or poly(T) present at some other general control promoters. Therefore, RAP1 may provide a function at HIS4 similar to one of the possible functions provided by the long poly(A) or poly(T) tracts at promoters such as HIS3 and ILV2. In addition to poly(A) and poly(T) tracts, the yeast GRFII protein creates a nucleosome-free region and has been shown to be able to combine with a nearby weak activator to give a 170-fold enhancement of transcription (9). A given DNA-binding protein dissociates frequently from its DNA-binding site. The half-life of most protein-DNA complexes is on the order of about 1 to 30 min. Also, for GCN4, the number of yeast promoters that GCN4 regulates (which is greater than 30; 13) may exceed the number of GCN4 molecules. Continued accessibility to DNA-binding sites is especially crucial if the promoter being regulated needs to be rapidly induced. It would seem very important that when a yeast cell senses amino acid starvation it could rapidly induce the biosynthesis of amino acids. Indeed, the levels of GCN4 are rapidly increased by amino acid starvation primarily via increased translation of pre-existing GCN4 mRNA (13). The HIS4 gene encodes an enzyme that performs three different steps in the biosynthesis of histidine (17). Rapid induction of the HIS4 protein by amino acid starvation could only be achieved if GCN4 would have continued access to its binding site within the HIS4 promoter, irrespective of the cell cycle stage of the cell. For a strain containing the wild-type HIS4 promoter, the maximal steady-state levels of HIS4 mRNA are achieved in less than 30 min after amino acid starvation. In contrast, for. strains containing a HIS4 promoter with a mutation in the RAPlbinding site, the steady-state levels of HIS4 mRNA take about 6 h to achieve their low maximal levels. In addition, when GCN4 basl-2 bas2-2 strains (unstarved or prestarved for histidine) containing HIS4 promoter mutations in the RAPl-binding site are plated onto medium without histidine, there is a large heterogeneity in the sizes of the colonies (Fig. 6B). Some of the cells are not able to divide at all, while other cells give rise only to very small colonies. It is possible that without RAP1 bound to the HIS4 promoter to provide continued accessibility to GCN4 site C, the GCN4 protein can bind to site C only immediately after DNA replication, that is, before nucleosomes are assembled on the newly synthesized DNA. It remains to be determined whether RAP1 can function at other promoters to provide accessibility for other DNA-binding factors.

YEAST HIS4 GENE TRANSCRIPTION REQUIRES RAP1

VOL . 1 l, 1991

ACKNOWLEDGMENTS We thank Alan Hinnebusch for the YCpS0 plasmid containing the wild-type GCN4 gene and especially thank Mitchell Smith for the micrococcal nuclease digestion protocol and advice on micrococcal nuclease digestion. We thank Lori Sussel for yeast strains and Ann Sutton and Bruce Futcher for comments on the manuscript. The research was supported by National Institutes of Health grant GM39892 to K.T.A. and National Institutes of Health grant GM40094 and support from the Searle Scholars Program-Chicago Community Trust to D.S. REFERENCES 1. Arndt, K., and G. R. Fink. 1986. GCN4 protein, a positive transcription factor in yeast, binds general control promoters at all 5' TGACTC 3' sequences. Proc. Natl. Acad. Sci. USA 83:8516-8520. 2. Arndt, K. T., C. Styles, and G. R. Fink. 1987. Multiple global regulators control HIS4 transcription in yeast. Science 237:874880. 3. Arndt, K. T., C. A. Styles, and G. R. Fink. 1989. A suppressor of a HIS4 transcriptional defect encodes a protein with homology to the catalytic subunit of protein phosphatases. Cell 56:527-537. 4. Boeke, J. D., F. Lacroute, and G. R. Fink. 1984. A positive selection for mutants lacking orotidine-5' phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:534-546. 5. Buchman, A. R., W. J. Kimmerly, J. Rine, and R. D. Kornberg. 1988. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae. Mol. Cell. Biol. 8:210-225. 6. Buchman, A. R., N. F. Lue, and R. D. Kornberg. 1988. Connections between transcriptional activators, silencers, and telomeres as revealed by functional analysis of a yeast DNA-binding protein. Mol. Cell. Biol. 8:5086-5099. 7. Burglin, T. R. 1988. The yeast regulatory gene PH02 encodes a homeo box. Cell 53:339-340. 8. Chambers, A., J. S. H. Tsang, C. Stanway, A. J. Kingsman, and S. M. Kingsman. 1989. Transcriptional control of the Saccharomyces cerevisiae PGK gene by RAP1. Mol. Cell. Biol. 9:5516-5524. 9. Chasman, D. I., N. F. Lue, A. R. Buchman, J. W. LaPointe, Y. Lorch, and R. D. Kornberg. 1990. A yeast protein that influences the chromatin structure of UASG and functions as a powerful auxiliary gene activator. Genes Dev. 4:503-514. 10. Clifton, D., and D. G. Fraenkel. 1971. The gcr (glycolysis regulation) mutation of Saccharomyces cerevisiae. J. Biol. Chem. 256:13074-13078. 11. Falco, S. C., K. S. Dumas, and K. J. Livak. 1985. Nucleotide sequence of the yeast ILV2 gene which encodes acetolactate synthase. Nucleic Acids Res. 13:4011-4027. 12. Hinnebusch, A. G. 1985. A hierarchy of trans-acting factors modulates translation of an activator of amino acid biosynthetic genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 5:23492360.

3651

13. Hinnebusch, A. G. 1988. Mechanisms of gene regulation in the general control of amino acid biosynthesis in Saccharomyces cerevisiae. Microbiol. Rev. 52:248-273. 14. Hinnen, A., J. B. Hicks, and G. R. Fink. 1978. Transformation of yeast. Proc. Natl. Acad. Sci. USA 75:1929-1933. 15. Hope, I. A., and K. Struhl. 1985. GCN4 protein, synthesized in vitro, binds HIS3 regulatory sequences: implications for general control of amino acid biosynthetic genes in yeast. Cell 43:177188. 16. Huet, J., P. Cottrelle, M. Cool, M.-L. Vignais, D. Thiele, C. Merck, J.-M. Buhler, A. Sentenac, and P. Fromageot. 1985. A general upstream binding factor for genes of the yeast translation apparatus. EMBO J. 4:3539-3547. 17. Jones, E. W., and G. R. Fink. 1982. Regulation of amino acid and nucleotide biosynthesis in yeast, p. 181-299. In J. N. Strathern, E. W. Jones, and J. R. Broach (ed.), The molecular biology of the yeast Saccharomyces. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 18. Kunkel, G. R., and H. C. Martinson. 1981. Nucleosomes will not form on double-stranded RNA or over poly(dA) poly(dT) tracts in recombinant DNA. Nucleic Acids Res. 9:6869-6888. 19. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492. 20. Nagawa, F., and G. R. Fink. 1985. The relationship between "TATA" sequence and transcription initiation sites at the HIS4 gene of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 82:8557-8561. 21. Nelson, R. C., and W. L. Fangman. 1979. Nucleosome organization of the yeast 2-p.m DNA plasmid: a eukaryotic minichromosome. Proc. Natl. Acad. Sci. USA 76:6515-6519. 22. Peliman, D., M. E. McLaughlin, and G. R. Fink. 1990. TATAdependent and TATA-independent transcription at the HIS4 gene of yeast. Nature (London) 348:82-85. 23. Pruneli, A. 1982. Nucleosome reconstitution on plasmid-inserted poly(dA) poly(dT). EMBO J. 1:173-179. 24. Shore, D., and K. Nasmyth. 1987. Purification and cloning of a DNA-binding protein that binds to both silencer and activator elements. Cell 51:721-732. 25. Stanway, C. A., A. Chambers, A. J. Kingsman, and S. M. Kingsman. 1989. Characterization of the transcriptional potency of sub-elements of the UAS of the yeast PGK gene in a PGK mini-promoter. Nucleic Acids Res. 17:9205-9218. 26. Struhl, K. 1985. Naturally occurring poly(dA-dT) sequences are upstream promoter elements for constitutive transcription in yeast. Proc. Natl. Acad. Sci. USA 82:8419-8423. 26a.Sutton, A., and K. T. Arndt. Unpublished data. 27. Thomas, B. J., and R. Rothstein. 1989. Elevated recombination rates in transcriptionally active DNA. Cell 56:619-630. 28. Tice-Baldwin, K., G. R. Fink, and K. T. Arndt. 1989. BAS1 has a Myb motif and activates HIS4 transcription only in combination with BAS2. Science 246:931-935. 29. Vieira, J., and J. Messing. 1987. Production of single-stranded plasmid DNA. Methods Enzymol. 153:3-11. 30. Vignais, M.-L., and A. Sentenac. 1989. Asymmetric DNA bending induced by the yeast multifunctional factor TUF. J. Biol. Chem. 264:8463-8466.