Characterisation of patients with Glanzmann thrombasthenia and identification of 17 novel mutations.

1

Platelets and Blood Cells

Characterisation of patients with Glanzmann thrombasthenia and identification of 17 novel mutations Kirstin Sandrock-Lang1; Johannes Oldenburg2; Verena Wiegering3; Susan Halimeh4; Sentot Santoso5; Karin Kurnik6; Lars Fischer7; Dimitrios A. Tsakiris8; Michael Sigl-Kraetzig9; Brigitte Brand10; Martina Bührlen11; Katharina Kraetzer1; Niklas Deeg1; Martin Hund1; Eileen Busse1; Anja Kahle1; Barbara Zieger1 1Department

of Pediatrics and Adolescent Medicine, University Medical Center Freiburg, Freiburg, Germany; 2Institute of Experimental Haematology and Transfusion Medicine, University Clinic Bonn, Bonn, Germany; 3Department of Pediatric Hematology, Oncology and Neurooncology, University Children’s Hospital Würzburg, Germany; 4Coagulation Centre Rhine Ruhr, Duisburg, Germany; 5Institute for Clinical Immunology and Transfusion Medicine, Justus Liebig University of Giessen, Germany; 6Dr. von Hauner’s Children’s Hospital, Paediatric Haemophilia Centre, Munich, Germany; 7Division of Pediatric Oncology, University Hospital of Leipzig, Leipzig, Germany; 8Department of Haematology, University Hospital Basel, Basel, Switzerland; 9Practice for pediatrics with haemophilia treatment center, Blaubeuren and IPFW Blaubeuren – München, Munich, Germany; 10Division of Hematology, University Hospital, Zurich, Switzerland, 11Center for Thrombosis and Hemostasis, Professor-Hess-Kinderklinik, Klinikum Bremen-Mitte, Bremen, Germany

Summary Glanzmann thrombasthenia (GT) is an autosomal recessive bleeding disorder characterised by quantitative and/or qualitative defects of the platelet glycoprotein (GP) IIb/IIIa complex, also called integrin αIIbβ3. αIIbβ3 is well known as a platelet fibrinogen receptor and mediates platelet aggregation, firm adhesion, and spreading. This study describes the molecular genetic analyses of 19 patients with GT who were diagnosed on the basis of clinical parameters and platelet analyses. The patients’ bleeding signs include epistaxis, mucocutaneous bleeding, haematomas, petechiae, gastrointestinal bleeding, and menorrhagia. Homozygous or compound heterozygous mutations in ITGA2B or ITGB3 were identified as causing GT through sequencing of genomic DNA. All exons including exon/intron boundaries of both genes were analysed. In a patient with an intronic mutation, splicing of mRNA was analysed using reverse transcriptase (RT)-PCR of platelet-derived RNA. In short, 16 of 19 patients revealed 27 different Correspondence to: Prof. Dr. Barbara Zieger University Medical Center Freiburg Department of Pediatrics and Adolescent Medicine Mathildenstr. 1 79106 Freiburg, Germany Tel.: +49 761 27043000, Fax: +49 761 27045820 E-mail: [email protected]

mutations (ITGA2B: n=17, ITGB3: n=10). Seventeen of these mutations have not been published to date. Mutations in ITGA2B or ITGB3 were identified as causing GT in 16 patients. We detected a total of 27 mutations in ITGA2B and ITGB3 including 17 novel missense, nonsense, frameshift and splice site mutations. In addition, three patients revealed no molecular genetic anomalies in ITGA2B or ITGB3 that could explain the suspected diagnosis of GT. We assume that these patients may harbour defects in a regulatory element affecting the transcription of these genes, or other proteins may exist that are important for activating the αIIbβ3 complex that may be affected.

Keywords Glanzmann thrombasthenia, platelet function defect, glycoprotein αIIbβ3

Received: June 3, 2014 Accepted after major revision: October 8, 2014 Epub ahead of print: November 6, 2014 http://dx.doi.org/10.1160/TH14-05-0479 Thromb Haemost 2015; 113: ■■■

Introduction Glanzmann thrombasthenia (GT) is a rare inherited platelet disorder. The hallmark of this disease is severely impaired or absent platelet aggregation in response to multiple physiological agonists and the lack of platelet integrin αIIbβ3 surface expression (1). Patients suffer from a lifelong moderate to severe haemorrhagic syndrome which can manifest rapidly after birth. Bleeding symptoms comprise haematomas, petechiae, gastrointestinal and mucocutaneous bleeding (i.e. epistaxis) (2). GT cannot be clinically distinguished from other platelet disorders because defects of primary haemostasis such as Bernard-Soulier syndrome, ADP receptor defect, and von Willebrand’s disease can present with the same bleeding symptoms. Therefore, comprehensive diagnostic investigation

is important to elucidate the underlying cause of the haemorrhagic diathesis. The integrin αIIbβ3, also called glycoprotein (GP) IIb/IIIa complex, is the most abundant platelet receptor for fibrinogen that also binds von Willebrand factor as well as vitronectin and fibronectin. In GT type I, no αIIbβ3 expression is detected on the platelet surface (C mutation, PCR was done using the primers, E26fw: TCTTCCTGCCAGAGGCCGAGCA together with E30rev: GTAGCCCAGCTCTGTTGGGA (P1) or E30rev2: GCGGTGCAGGTAGCACGCCCAA (P2), spanning αIIb exons 26–30.

Results We analysed 19 patients presenting the clinical symptoms of GT and identified disease-causing mutations in the genes ITGA2B or ITGB3 in 16 of them (▶ Table 1, ▶ Figure 1). We detected no causative mutation in three study patients. Of the 19 GT patients, eight were male and 11 female, ranging from 18 months to 55 years of age. We identified the GT type in 13 patients: 11 patients were GT type I, and two GT type II (5.3% and 9.2% αIIbβ3 expression, respectively). Regarding the other patients we only received the information that αIIbβ3 expression levels were severely

Thrombosis and Haemostasis 113.3/2015

© Schattauer 2015

Downloaded from www.thrombosis-online.com on 2015-02-17 | ID: 1000480351 | IP: 130.179.16.201 Note: Uncorrected proof, epub ahead of print online For personal or educational use only. No other uses without permission. All rights reserved.

Sandrock-Lang et al. Novel mutations in Glanzmann thrombasthenia

Table 1: Clinical phenotype of GT patients. hom: homozygous; het: heterozygous, path: pathological; expr: expression, nl: normal, n/a: not available.

Patient

Ethnic backgr ound

Consan- Genotype patient guinity

Genotype parents

GT1 ♀

Turkish

yes

ITGA2B c.2374delG hom

mother: c.2374delG het father: c.2374delG het

GT2 ♂

German

no

ITGB3 c.31T>C het c.1458T>C het

mother: c.31T>C het father: c.1458T>C het

GT3 ♀

Turkish

yes (cousins)

ITGA2B c.310+3_310+6 delGAGT hom

n/a

Bleeding sympPlatelet Platelet αIIbβ3 expression toms (BS) aggre- Flow cytometry (FC), Bleeding time (BT) gation Western Blot (WB)

• BS: severe • BT: path (in vitro)

path

• FC: αIIbβ3 expr path • WB: αIIb -, β3 ↓


path

• FC: αIIbβ3 expr path

• BS: severe • BT: path (in vivo)

path


(GT type I)

(GT type I), function path WB: αIIb -, β3 ↓

GT4 ♀

German

no

ITGB3 c.725G>A het c.1813G>A het

n/a


path

• • FC: αIIbβ3 expr path,

GT5 ♀

Caucasian no

ITGA2B c.408G>C het c.1787T>C het

n/a

• ·BS: severe • ·BT: path (in vitro)

path


GT6 ♂

Croats

no*

ITGB3 c.166–2A>G hom

n/a

path


GT7 ♀

German (mother) Jugoslav (father)

no

ITGB3 c.1030dupT het c.1126–72C>T het

mother: c.1126–72C>T het father: c.1126–72C>T het

path


GT8 ♀

Caucasian no

ITGB3 c.118C>T het

father: c.118C>T het mother: none

GT9 ♂

Caucasian no

ITGA2B c.1186G>A het c.3060+2T>C het

father: c.3060+2T>C het mother: c.1186G>A het

GT10 ♀

Caucasian no

ITGA2B c.1210+105A>G het c.3091delC het

father: c.1210+105A>G het mother: c.3091delC het

GT11 ♂

Arabs

ITGA2B c.641T>C het c.3092delT het

father: deceased mother: c.3092delT het

GT12 ♀

Caucasian no

ITGA2B c.957T>A het c.2326_2331dup GAGGCC het

mother: c.2326_2331dup GAGGCC het father: deceased

GT13 ♂

Swiss

no

ITGA2B c.555T>G het c.1882C>T het

GT14 ♂

Turkish

yes (cousins)

GT15 ♂

German

GT16 ♀

Kosovo

• BS: severe • BT: path (in vitro) • BS: severe • BT: path (in vitro)

αIIbβ3 function path

(GT type I)

(GT type I) (GT type I)

• BS: moderate

path

• BS: severe

path


path

• FC: αIIbβ3 expr path (GT type I) • WB: αIIb -, β3 • FC: αIIbβ3 expr path, αIIbβ3 function path • WB: αIIb ↓, β3 ↓ • FC: αIIbβ3 expr path

• BS: severe

path



path


n/a

• BS: moderate

path


ITGA2B c.1752+2T>C hom

n/a

• BS: severe • BT: path (in vivo)

path

no

ITGB3 c.1594T>C het c.2014+1G>A het

mother: c.1594T>C het father: n/a

• BS: severe

path

no

ITGA2B n/a c.842C>T het c.2602–2A>G/c.2602–3 C>A het

• BS: moderate

path

no

(GT type I), αIIbβ3 function path

(GT type II), αIIbβ3 function path (GT type I)

(GT type II)

• FC: αIIbβ3 expr path (GT type I) • WB: αIIb ↓↓, β3 ↓ • FC: αIIbβ3 expr path, αIIbβ3 function path

• FC: αIIbβ3 expr path • WB: αIIb nl, β3 nl

*parents came from the same small village.

© Schattauer 2015

Thrombosis and Haemostasis 113.3/2015 Downloaded from www.thrombosis-online.com on 2015-02-17 | ID: 1000480351 | IP: 130.179.16.201 Note: Uncorrected proof, epub ahead of print online For personal or educational use only. No other uses without permission. All rights reserved.

3

4


A

B Figure 1: Schematic representation of mutations identified in GT patients. Exon/intron structure of ITGA2B (A) and ITGB3 (B) representing the location of all identified mutations. Novel mutations are indicated in red and bold.

A

Figure 2:Typical aggregation/agglutination curves of GT patient GT3. Platelet aggregation of patient GT3 was stimulated with collagen (2 and 10 µg/ml), adenosine diphosphate (4 and 10 µmol/l), and epinephrine (8 and 40 µmol/l). Platelet agglutination was induced with ristocetin (1.2 and 1.8 mg/ml). Analysis was performed with an APACT aggregometer.

B


© Schattauer 2015



Figure 3:Flow cytometry and Western analyses showing the typical platelet receptor pattern of a GT patient. A) Flow cytometric quantification of platelet surface αIIbβ3 (CD41). Fixed platelets were analysed by flow cytometry with FITC-conjugated unspecific mouse IgG (upper panel) or with FITC-conjugated antiCD41 (lower panel). B) Flow cytometric quantification of adenosine diphosphate- (upper panel) and thrombin-induced (lower panel) platelet fibrinogen binding detected by flow cytometry in patient GT3. C) Platelet lysates derived from healthy blood donor (lane 1), patient GT1 (lane 2), and patient GT3 (lane 3) were separated on 7.5% SDS-PAGE under non-reducing conditions. After blotting onto nitrocellulose, the separated proteins were incubated with mabs specific for αIIb, β3 and PECAM-1 as a control.

A

B

C

reduced. The clinical manifestations included haematomas, epistaxis, petechiae as well as mucocutaneous, gingival, and gastrointestinal haemorrhage. Four of the eight post-menarchal female patients reported having had menorrhagia. Red blood cell transfusions were required by 11 of the 19 GT patients due to prolonged bleeding after surgery or anaemia as cause of multiple bleeding symptoms. Both in vitro and in vivo bleeding times were severely prolonged in all measurements from 13 patients. All the tested patients´ platelets revealed severely reduced platelet aggregation after stimulation with agonists such as collagen, adenosine diphosphate, arachidonic acid, adrenaline, and epinephrine (▶ Table 1, patient GT3 shown in ▶ Figure 2). Platelet agglutination after stimulation with ristocetin revealed residual to almost normal initial response following striking desaggregation.

Platelet αIIbβ3 receptor analyses Platelet αIIbβ3 expression was determined via flow cytometry and Western analyses. Flow cytometric analyses of patients´ platelets revealed αIIbβ3 surface expression levels A), Jallu et al., 2010 (21) (ITGB3 c.1125+3_1125+6delAAGT)

2

c.408G>C p.V105 (last nucleotide in exon 3)

exon 3

GT5 ♀

heterozygous

unknown; alternative splicing?

new mutation, comparable with Sandrock et al. (22), Jallu et al. (21) (c.1878G>C), Jin et al. (26) (ITGB3 c.1260G>A)

3

c.555T>G

p.I154M

exon 4

GT13 ♂

heterozygous

missense

new mutation

4

c.641T>C

p.L183P

exon 6

GT11 ♂

heterozygous

missense

French and Coller, 1997 (17), Grimaldi et al., 1998 (16), Kannan et al., 2009 (14), Pillitteri et al., 2010 (27)

5

c.842C>T

p.T250I

exon 8

GT16 ♀

heterozygous

missense

new mutation

6

c.957T>A

p.Y288X

exon 11

GT12 ♀

heterozygous

nonsense

new mutation

7

c.1186G>A

p.D365N

exon 12

GT9 ♂

heterozygous

missense

Vijapurkar et al., 2009 (20)

8

c.1210+105A>G

intron 12

GT10 ♀

heterozygous


new mutation, comparable with Kannan et al., 2009 (14) (c.1210+4A>G), Vinciguerra et al., 2001 (23) (c.1211–78A>G)

9

c.1752+2T>C

intron 17

GT14 ♂

homozygous

alternative splicing?

Pillitteri et al., 2010 (27)

10

c.1787T>C

p.I565T

exon 18

GT5 ♀

heterozygous

missense

French and Coller, 1997 (17), Ruan et al., 1998 (28), Sandrock et al., 2012 (22)

11

c.1882C>T

p.R597X

exon 19

GT13 ♂

heterozygous

nonsense

Arias-Salgado et al., 2002 (29)

12

c.2326_2331dup GAGGCC

p.E745_A74 6dup

exon 23

GT12 ♀

heterozygous

amino acid duplication without frameshift

new mutation, comparable with Ambo et al., 1998 (18), Tadokoro et al., 1998 (19) (p.Q747P)

13

c.2374delG

p.V761delG

exon 24

GT1 ♀

homozygous

frameshift → premature termination (794X)

Rosenberg et al., 2005 (30)

14

c.2602–2A>G c.2602–3C>A

intron 25

GT16 ♀

heterozygous


new mutation, comparable with French and Coller, 1997 (17) and Kato et al., 1992 (24) (c.2602–3C>G)

15

c.3060+2T>C

intron 29

GT9 ♂

heterozygous

alternative splicing → French and Coller, 1997 (17) skipping of exon 29 (p.V951-K989del)

16

c.3091delC

p.L1000delC exon 30

GT10 ♀

heterozygous

frameshift → prolong- new mutation, ed altered protein comparable with French and Coller, 1997 (17) (c.3094insTG)

17

c.3092delT

p.L1000delT

GT11 ♂

heterozygous

frameshift → prolong- new mutation, ed altered protein comparable with French and Coller, 1997 (17) (c.3094insTG)

exon 30

Novel mutations in ITGA2B and ITGB3 Of the 27 different mutations, 17 mutations have not been reported until now. These 17 novel mutations comprise five missense, two nonsense, two deletions, two duplications, and six

splice site mutations (▶ Table 2 and ▶ Table 3, ▶ Figure 1). The two novel missense mutations in ITGA2B were located in exon 4 (p.I154M) and exon 8 (p.T250I). Both mutations are part of the extracellular β propeller region of αIIb. The three novel missense mutations in ITGB3 were located in exon 1 (p.W-15R) and exon


© Schattauer 2015



Table 3: ITGB3 mutations identified in GT patients.

No

ITGB3 mutation

Location

Patient

Genotype

Effect

Literature

1

c.31T>C

p.W-15R

exon 1

GT2 ♂

heterozygous

unknown missense

new mutation, comparable with Kannan et al., 2009 (14) (c.59T>C => p.L-6P)

2

c.118C>T

p.Q14X

exon 2

GT8 ♀

heterozygous

nonsense

new mutation

3

c.166–2A>G

intron 2

GT6 ♂

homozygous

alternative splicing

Jallu et al., 2010 (21)

4

c.725G>A

p.R216Q

exon 5

GT4 ♀

heterozygous

missense

French and Coller, 1997 (17), Kannan et al., 2009 (14)

5

c.1030dupT

p.Y318dupT

exon 7

GT7 ♀

heterozygous

frameshift → premature termination (322X)

new mutation, comparable with Kannan et al., 2009 (14) (c.1031A>G => p.Y318C)

6

c.1126–72C>T

intron 8

GT7 ♀

heterozygous


new mutation

7

c.1458T>C

p.C460W

exon 10

GT2 ♂

heterozygous

missense

new mutation

8

c.1594T>C

p.C506R

exon 10

GT15 ♂

heterozygous

missense

new mutation, comparable with Nair et al., 2002 (25) (p.C506Y)

9

c.1813G>A

p.G579S

exon 11

GT4 ♀

heterozygous

missense

Ambo et al., 1998 (31)

10

c.2014+1G>A

intron 12

GT15 ♂

heterozygous


new mutation

10 (p.C460W and p.C506R). The mutation in exon 1 is located in the signal peptide and is therefore absent in the mature protein. Both mutations in exon 10 of ITGB3 are located within the EGF domains 1-2. We identified two novel nonsense mutations: one in ITGA2B and one in ITGB3. The mutation in exon 11 of ITGA2B (p.Y288X) is located in the β propeller region of αIIb. The mutation in exon 2 of ITGB3 (p.Q14X) is part of the PSI (plexins, semaphorins, and integrins) domain. Both single nucleotide deletions in exon 30 of ITGA2B (c.3091delC and c.3092delT) were located in residue leucine 1000 which is part of the cytoplasmic tail of αIIb. In addition, we identified two novel duplications: a duplication of two amino acids (p.E745_A746dup) without frameshift localised in the Calf2 domain of ITGA2B was identified in one patient, and a single nucleotide duplication (c.1030dupT) resulting in a frameshift and a premature termination at position 322 of ITGB3 detected in the other patient. The novel splice site mutations were located in intron 2 (c.310+3_310+6delGAGT), intron 12 (c.1210+105A>G), and intron 25 (c.2602-2A>G together with c.2602-3C>A) of ITGA2B as well as in intron 8 (c.1126-72C>T) and intron 12 (c.2014+1G>A) of ITGB3. The point mutation of the last nucleotide in exon 3 of ITGA2B (c.408G>C) which did not cause amino acid substitution is predicted to induce a splicing defect.

Known mutations in ITGA2B and ITGB3 Of the 27 different mutations, 10 mutations have been already described comprising five missense, one nonsense, one deletion, and three splice site mutations (▶ Table 2 and ▶ Table 3, ▶ Figure 1). Three missense mutations were reported previously in ITGA2B

(p.L183P, p.D365N, p.I565T) and two in ITGB3 (p.R216Q, p.G579S). The nonsense mutation (p.R597X) as well as the deletion of ITGA2B (c.2374delG) had been documented. In addition, we detected two already described splice site mutations in ITGA2B (c.1752+2T>C, c.3060+2T>C) and one in ITGB3 (c.166-2A>G). For the heterozygous c.3060+2T>C mutation of patient GT9 we verified skipping of exon 29 (p.V951-K989del) using reverse transcriptase PCR of platelet-derived RNA (▶ Figure 5).

Discussion We investigated 19 patients demonstrating a typical Glanzmann thrombasthenia (GT) phenotype. The patients´ platelets described in this study showed decreased αIIbβ3 expression in flow cytometry and/or Western analyses. Platelet aggregometry after stimulation with collagen, adenosine diphosphate, or epinephrine revealed severely impaired platelet aggregation in the patients, while platelet agglutination after stimulation with ristocetin was almost normal. Using sequencing analyses we identified mutations in 16 out of 19 (84.2%) unrelated GT patients: 10 patients (62.5%) showed defects in ITGA2B (gene for αIIb) and six patients (37.5%) presented with defects in ITGB3 (gene for β3) (▶ Figure 4 A). One patient (GT8) presented only one mutation in ITGB3 in the heterozygous state. Furthermore, although three patients presented no causative mutations in ITGA2B or ITGB3, their platelet analyses (platelet aggregation and αIIbβ3 expression) confirmed their diagnosis of GT. Other studies (13-15) have reported that some GT patients seem to harbour no causative mutation in either ITGA2B or ITGB3. In the present study we report on a total of 17

© Schattauer 2015


7

8


A

B

Figure 4:Schematic representation showing the distribution of mutations in our GT patients. A) Circle diagram showing the ratio of patients with mutations in ITGA2B vs ITGB3, respectively. B) Circle diagram showing the ratio of all identified mutations in ITGA2B and ITGB3 including the percentage of novel vs alreadyknown mutations, respectively. C) Circle diagram showing the ratio of all identified mutations in ITGA2B and ITGB3 including the percentage of missense and nonsense mutations, deletions, insertions, and splice site mutations, respectively.

C

Figure 5:mRNA analysis of the heterozygous αIIb c.3060+2T>C mutation (patient GT9). Skipping of exon 29 is caused by the αIIb c.3060+2T>C mutation. Upper panel: agarose gel showing reverse transcriptase (RT)-PCR products of platelet-derived RNA. Lane MW: ΦX174 DNA-Hae III Digest molecular weight marker (New England Biolabs GmbH, Frankfurt, Germany). Note in patient GT9 a RT-PCR product of 473 bp (P1) or 382 bp (P2) resulting from exon 29 skipping, and a RT-PCR product of 590 bp (P1) or 499 bp (P2) consistent with normal splicing. These two different PCR products reflect heterozygosity of the splice site mutation. Lower panel: Schematic representation of the normally and aberrantly spliced mRNA species induced by the mutation in the donor splice site of intron 29. Splice sites are highlighted in bold letters.

A

B


© Schattauer 2015



(out of 27) different mutations in ITGA2B and ITGB3 for the first time.

Novel mutations in ITGA2B We identified 10 novel mutations in ITGA2B: two missense, one nonsense, two deletions, one duplication, and four splice site mutations (▶ Table 2, ▶ Figure 1). The two novel missense mutations in ITGA2B were located in exon 4 (p.I154M of patient GT13) and exon 8 (p.T250I of patient GT16). Both mutations are part of the extracellular β propeller region of αIIb. As the p.L183P mutation (patient GT11) of the αIIb β propeller region is known to disrupt structural conformation of αIIbβ3 receptor (16), we assume that these novel missense mutations in ITGA2B may have similar effects on αIIbβ3 complex formation. We identified one novel nonsense mutation in exon 11 of ITGA2B: p.Y288X located in the β propeller region of αIIb (patient GT12). This mutation causes a dramatically truncated αIIb protein which is most probably unable to form a functional complex with β3. Both single nucleotide deletions in exon 30 of ITGA2B (c.3091delC and c.3092delT) were located in residue leucine 1000 which is part of the cytoplasmic tail of αIIb. These deletions identified in patients GT10 and GT11 both lead to an altered protein longer than the wild-type αIIb protein. No further stop codon resides within the remaining coding region. A similar diseasecausing mutation leading to a frameshift with no αIIb termination (c.3094insTG) was described by French and Coller (17). In addition, we identified a novel duplication of two residues (p.E745_A746dup) localized in the Calf2 domain of ITGA2B (patient GT12). This duplication did not cause a reading frameshift; however, this position does seem important for αIIbβ3 complex formation. Four Japanese GT patients showing the missense mutation p.Q747P have been described (18, 19). Ambo et al reported that this mutation causes defective expression of the αIIbβ3 complex, thereby producing a quantitative thrombasthenic phenotype. The novel splice site mutations we observed were located in intron 2 (c.310+3_310+6delGAGT; patient GT3), exon 3 (c.408G>C; patient GT5), intron 12 (c.1210+105A>G; patient GT10), and intron 25 (c.2602-2A>G together with c.2602-3C>A; patient GT16) of ITGA2B. The novel homozygous c.310+3_310+6delGAGT deletion is located close to the c.310+1G>A mutation already described (20). Interestingly, there is evidence of an equivalent mutation within intron 8 of ITGB3 (c.1125+3_1125+6delAAGT) (21). Those authors reported that Genescan analysis predicts the use of a cryptic donor splice site, although the mutation does not directly affect a splice site. Therefore, the mutation in intron 2 of ITGA2B (c.310+3_310+6delGAGT) may trigger the use of a cryptic donor splice site. Patient GT5 revealed a novel substitution in the last nucleotide of exon 3 (c.408G>C). Interestingly, the already-described c.1878G>C (p.Q595H) mutation is localized at the last nucleotide of exon 18 (21, 22). This patient’s platelet mRNA revealed entirely normal β3 mRNA synthesis, but αIIb mRNA remained undetectable, indicating a splicing anomaly. Therefore, the novel ITGA2B c.408G>C mutation which is contiguous with the donor splice site

of intron 3 may also induce a splicing anomaly. We identified the novel ITGA2B c.1210+105A>G mutation in intron 12 of patient GT10 which is similar to the already described c.1211-78A>G mutation in intron 12 (23). Patient GT16 presented with two mutated nucleotides within the acceptor splice site of exon 26 (c.2602-2A>G and c.2602-3C>A). The cytosine at position 3 has been reported to be essential, as the c.2602-3C>G mutation causes in-frame exon skipping from exon 25 to 27 (17, 24).

Novel mutations in ITGB3 We identified seven novel mutations in ITGB3: three missense, one nonsense, one duplication, and two splice site mutations (▶ Table 3, ▶ Figure 1). Three novel missense mutations in ITGB3 were located in exon 1 (p.W-15R) and exon 10 (p.C460W and p.C506R). The novel missense mutation of patient GT2 is located within the signal peptide of β3 (c.31T>C, p.W-15R). The signal peptide is absent in mature β3 protein; however, there is evidence that a known missense mutation in the signal peptide (c.59T>C, p.L-6P) is a disease-causing mutation (14). We also identified two novel missense mutations within EGF domains 1-2: p.C460W (patient GT2) and p.C506R (patient GT15). Interestingly, the similar homozygous p.C506Y missense mutation of an Indian patient creates unpaired cysteine residue in the second cysteine-rich repeat region of β3 (25). Kato et al. suggest that eliminating C506 may result in the formation of intermolecular disulfide bonds. The p.C506R mutation described in this study should have the same effect. The other mutation identified in this region leading to C460 elimination may also create unpaired cysteine residue. The novel nonsense mutation (p.Q14X of patient GT8) is within the PSI (plexins, semaphorins, and integrins) domain. The very early stop codon leads to a severely truncated and certainly nonfunctional β3 protein. The heterozygous duplication (c.1030dupT) of patient GT7 leads to a reading frameshift beginning at amino acid 318 (p.Y318L) and premature termination at position 322. Interestingly, just the missense mutation p.Y318C has been described as a disease-causing mutation in a GT patient (14). The two novel splice site mutations we detected were located in intron 8 (c.1126-72C>T of patient GT7) and intron 12 (c.2014+1G>A of patient GT15) of ITGB3. The c.2014+1G>A intronic mutation is located within the donor splice site and probably leads to a splicing anomaly. In one GT female patient (GT8) we identified only one heterozygous mutation (p.Q14X) in ITGB3. Her father is a heterozygous carrier of the p.Q14X mutation. Since she is phenotypically thrombasthenic (GT type I shown by flow cytometry, absence of αIIb and β3 in Western analysis), she most probably carries another ITGB3 defect which has not yet been located. Interestingly, we detected no gene alterations of ITGA2B or ITGB3 in three out of 19 (15.8%) patients. In previous studies of GT patients, no mutations were detected in 20% to 27% of the patients (13-15). It therefore seems plausible from those and from our investigations that ITGA2B or ITGB3 mutations may be absent in some GT patients. These patients may carry defects in regulatory elements like

© Schattauer 2015


9

10


What is known about this topic?

• •

Several mutations in ITGA2B and ITGB3 causing Glanzmann thrombasthenia (GT) are known. Platelet function analyses of GT patients have been described.

What does this paper add?

• •

The paper describes 17 novel homozygous and heterozygous mutations in ITGA2B and ITGB3. Flow cytometry and Western analyses are very good tools to characterise GT patients, especially in cases where molecular genetic defect is difficult to identify (e.g. intronic mutations).

12. 13. 14. 15. 16. 17.

the promoter that adversely affect the transcription of these genes (7). In addition, dysfunction in mechanisms that are important for post-translational modifications and the trafficking of integrin subunits αIIb and/or β3 may account for some cases of GT. It is essential to conduct molecular genetic analyses from patients with GT both to verify the diagnosis via pathological platelet parameters and to encourage patient compliance. Patients who are aware of their genetic defect are more apt to accept their disease and to tolerate the treatment better. In summary, we investigated 19 patients with GT and identified 17 novel mutations within ITGA2B and ITGB3. The numerous different mutations detected in this study reveal GT’s great genetic heterogeneity.

18. 19. 20. 21. 22. 23. 24.

Conflicts of interest

None declared.

25.

References 1. George JN, Caen JP, Nurden AT. Glanzmann's thrombasthenia: the spectrum of clinical disease. Blood 1990; 75: 1383-1395. 2. Nurden AT. Glanzmann thrombasthenia. Orphanet J Rare Dis 2006; 1: 10. 3. Nurden AT, Fiore M, Nurden P, et al. Glanzmann thrombasthenia: a review of ITGA2B and ITGB3 defects with emphasis on variants, phenotypic variability, and mouse models. Blood 2011; 118: 5996-6005. 4. Bray PF, Barsh G, Rosa JP, et al. Physical linkage of the genes for platelet membrane glycoproteins IIb and IIIa. Proc Natl Acad Sci USA 1988; 85: 8683-8687. 5. Heidenreich R, Eisman R, Surrey S, et al. Organization of the gene for platelet glycoprotein IIb. Biochemistry 1990; 29: 1232-1244. 6. Wilhide CC, Jin Y, Guo Q, et al. The human integrin beta3 gene is 63 kb and contains a 5'-UTR sequence regulating expression. Blood 1997; 90: 3951-3961. 7. Bray PF, Rosa JP, Lingappa VR, et al. Biogenesis of the platelet receptor for fibrinogen: evidence for separate precursors for glycoproteins IIb and IIIa. Proc Natl Acad Sci USA 1986; 83: 1480-1484. 8. Rosenberg N, Yatuv R, Sobolev V, et al. Major mutations in calf-1 and calf-2 domains of glycoprotein IIb in patients with Glanzmann thrombasthenia enable GPIIb/IIIa complex formation, but impair its transport from the endoplasmic reticulum to the Golgi apparatus. Blood 2003; 101: 4808-4815. 9. O'Toole TE, Loftus JC, Plow EF, et al. Efficient surface expression of platelet GPIIb-IIIa requires both subunits. Blood 1989; 74: 14-18. 10. Lahav J, Jurk K, Hess O, et al. Sustained integrin ligation involves extracellular free sulfhydryls and enzymatically catalyzed disulfide exchange. Blood 2002; 100: 2472-2478. 11. Santoso S, Kiefel V, Richter IG, et al. A functional platelet fibrinogen receptor with a deletion in the cysteine-rich repeat region of the beta(3) integrin: the

26. 27. 28. 29.

30. 31.

Oe(a) alloantigen in neonatal alloimmune thrombocytopenia. Blood 2002; 99: 1205-1214. Vannier C, Behnisch W, Bartsch I, et al. Novel homozygous mutation (c.175delG) in platelet glycoprotein ITGA2B gene as cause of Glanzmann's thrombasthenia type I. Klin Padiatr 2010; 222: 150-153. D'Andrea G, Colaizzo D, Vecchione G, et al. Glanzmann's thrombasthenia: identification of 19 new mutations in 30 patients. Thromb Haemost 2002; 87: 1034-1042. Kannan M, Ahmad F, Yadav BK, et al. Molecular defects in ITGA2B and ITGB3 genes in patients with Glanzmann thrombasthenia. J Thromb Haemost 2009; 7: 1878-1885. Nelson EJ, Nair SC, Peretz H, et al. Diversity of Glanzmann thrombasthenia in southern India: 10 novel mutations identified among 15 unrelated patients. J Thromb Haemost 2006; 4: 1730-1737. Grimaldi CM, Chen F, Wu C, et al. Glycoprotein IIb Leu214Pro mutation produces glanzmann thrombasthenia with both quantitative and qualitative abnormalities in GPIIb/IIIa. Blood 1998; 91: 1562-1571. French DL, Coller BS. Hematologically important mutations: Glanzmann thrombasthenia. Blood Cells Mol Dis 1997; 23: 39-51. Ambo H, Kamata T, Handa M, et al. Novel point mutations in the alphaIIb subunit (Phe289-->Ser, Glu324-->Lys and Gln747-->Pro) causing thrombasthenic phenotypes in four Japanese patients. Br J Haematol 1998; 102: 829-840. Tadokoro S, Tomiyama Y, Honda S, et al. A Gln747-->Pro substitution in the IIb subunit is responsible for a moderate IIbbeta3 deficiency in Glanzmann thrombasthenia. Blood 1998; 92: 2750-2758. Vijapurkar M, Ghosh K, Shetty S. Novel mutations in GP IIb gene in Glanzmann's thrombasthenia from India. Platelets 2009; 20: 35-40. Jallu V, Dusseaux M, Panzer S, et al. AlphaIIbbeta3 integrin: new allelic variants in Glanzmann thrombasthenia, effects on ITGA2B and ITGB3 mRNA splicing, expression, and structure-function. Hum Mutat 2010; 31: 237-246. Sandrock K, Halimeh S, Wiegering V, et al. Homozygous point mutations in platelet glycoprotein ITGA2B gene as cause of Glanzmann thrombasthenia in 2 families. Klin Padiatr 2012; 224: 174-178. Vinciguerra C, Bordet JC, Beaune G, et al. Description of 10 new mutations in platelet glycoprotein IIb (alphaIIb) and glycoprotein IIIa (beta3) genes. Platelets 2001; 12: 486-495. Kato A, Yamamoto K, Miyazaki S, et al. Molecular basis for Glanzmann's thrombasthenia (GT) in a compound heterozygote with glycoprotein IIb gene: a proposal for the classification of GT based on the biosynthetic pathway of glycoprotein IIb-IIIa complex. Blood 1992; 79: 3212-3218. Nair S, Li J, Mitchell WB, et al. Two new beta3 integrin mutations in Indian patients with Glanzmann thrombasthenia: localization of mutations affecting cysteine residues in integrin beta3. Thromb Haemost 2002; 88: 503-509. Jin Y, Dietz HC, Montgomery RA, et al. Glanzmann thrombasthenia. Cooperation between sequence variants in cis during splice site selection. J Clin Invest 1996; 98: 1745-1754. Pillitteri D, Pilgrimm AK, Kirchmaier CM. Novel Mutations in the GPIIb and GPIIIa Genes in Glanzmann Thrombasthenia. Transfus Med Haemother 2010; 37: 268-277. Ruan J, Peyruchaud O, Alberio L, et al. Double heterozygosity of the GPIIb gene in a Swiss patient with Glanzmann's thrombasthenia. Br J Haematol 1998; 102: 918-925. Arias-Salgado EG, Tao J, Gonzalez-Manchon C, et al. Nonsense mutation in exon-19 of GPIIb associated with thrombasthenic phenotype. Failure of GPIIb(delta597-1008) to form stable complexes with GPIIIa. Thromb Haemost 2002; 87: 684-691. Rosenberg N, Hauschner H, Peretz H, et al. A 13-bp deletion in alpha(IIb) gene is a founder mutation that predominates in Palestinian-Arab patients with Glanzmann thrombasthenia. J Thromb Haemost 2005; 3: 2764-2772. Ambo H, Kamata T, Handa M, et al. Three novel integrin beta3 subunit missense mutations (H280P, C560F, and G579S) in thrombasthenia, including one (H280P) prevalent in Japanese patients. Biochem Biophys Res Commun 1998; 251: 763-768.


© Schattauer 2015


The international, prospective Glanzmann Thrombasthenia Registry: treatment modalities and outcomes of non-surgical bleeding episodes in patients with Glanzmann thrombasthenia.

[Glanzmann thrombasthenia, PLA1 antigen and anti-Glanzmann antibody].

Demonstration of novel gain-of-function mutations of αIIbβ3: association with macrothrombocytopenia and glanzmann thrombasthenia-like phenotype.

[Glanzmann thrombasthenia: about 11 cases].

Anaesthetic Management with Thromboelastography in a Patient with Glanzmann Thrombasthenia.

Identification and Characterization of Glanzmann Thrombasthenia in 2 Closely Related Mixed-breed Dogs.

Identification and characterisation of eight novel SERPINA1 Null mutations.

Inherited platelet disorders including Glanzmann thrombasthenia and Bernard-Soulier syndrome.

Unusual redo mitral valve replacement for bleeding in Glanzmann thrombasthenia.

Successful use of recombinant factor VIIa in a patient with acquired Glanzmann thrombasthenia.

Novel mutations of integrin αIIb and β3 genes in Turkish children with Glanzmann's thrombasthenia.

The molecular genetic basis of Glanzmann thrombasthenia in the Iraqi-Jewish and Arab populations in Israel.

The international, prospective Glanzmann Thrombasthenia Registry: treatment and outcomes in surgical intervention.

Two novel ITGA2B mutations in a Glanzmann thrombasthaenia family associated with different platelet phenotypic expression.

Spontaneous hemarthrosis in combined Glanzmann thrombasthenia and type 2N von Willebrand disease.

dacarbazine) chemotherapy.

Diagnosis of Glanzmann thrombasthenia by whole blood impedance analyzer (MEA) vs. light transmission aggregometry.

Use of allogeneic stem cell transplantation for moderate-severe Glanzmann thrombasthenia.

Molecular dynamics analysis of a novel β3 Pro189Ser mutation in a patient with glanzmann thrombasthenia differentially affecting αIIbβ3 and αvβ3 expression.

Identification and functional study of novel PLP1 mutations in Chinese patients with Pelizaeus-Merzbacher disease.

Molecular analysis of Cypriot patients with Glutaric aciduria type I: identification of two novel mutations.

Identification of two novel GATA6 mutations in patients with nonsyndromic conotruncal heart defects.

Identification of novel mutations in Mexican patients with Aarskog-Scott syndrome.

osteomalacia.