Biochimica et Biophysica Acta, 1090(1991) 123-124
123
© 1991 ElsevierSciencePublishersB.V. 0167-4781/91/$03.50 ADONIS 016747819100208L BBAEXP 90255
Short Sequence-Paper
Cloning and nucleotide sequence of cDNA encoding human erythrocyte band 7 integral membrane protein C h r i s t i n e M . H i e b l - D i r s c h m i e d 1, B a r b a r a E n t l e r ~, C l a u d i a G l o t z m a n n t, I n g r i d M a u r e r - F o g y 2, C h r i s t i a n S t r a t o w a 2 a n d R a i n e r P r o h a s k a t Institute of Biochemistry, UnicersiO'of Vienna, Vienna (Austria) and 2 Ernst Boehringer hzstitute, Vienna (Austria)
(Received 18 June 1991) Key words: Erythrocyte;Membrane protein: Band 7: cDNA sequence: Protein structure analysis cDNA clones encoding the human erythrocyte band 7 membrane protein were isolated by immunoscreening from bone marrow and HeLa cell •gtll cDNA libraries, and their nucleotide sequences were determined. HeLa- and bone marrow cell-derived sequences were identical, except for one nucleotide; the deduced sequence of 287 amino acids was confirmed by sequence identity with peptides of the erythroid protein. Structure analysis assigned band 7 protein to the type Ib transmembrane proteins. Human erythrocyte band 7 protein has been described originally as a Mr 29000 integral membrane protein, which is exposed on the cytoplasmic surface of the membrane and susceptible to phosphorylation by a cAMP-dependent protein kinase [1,2]. A deficiency of this protein in red cells of patients with hereditary stomatocytosis or cryohydrocytosis [3] results in an increased Na+/K+-permeability and hence to a disorder of cell volume control. Using monoclonal antibodies to the human erythrocyte band 7 integral membrane protein we have recently identified related proteins in other mammalian red cells and in human cell lines of epithelial and lymphoid origin, notably in HeLa cells [4]. It was therefore possible to screen bone marrow and HeLa cell cDNA expression libraries with our antibodies in order to isolate cDNA clones, determine the nucleotide sequence and study the structure of this so far neglected erythrocyte membrane protein. Immunoscreening of Agtll expression libraries [5] from human bone marrow and HeLa cells (Clontech Labs., HLI058b and HL1022b) resulted in the isolation of 19 clones, four of which were subcloned into p G E M - 3 Z (Promega) and Bluescript II K S ( + )
The sequence data in this paper have been submitted to the EMBL/Genbank Data Libraries under the ;,ccession number X60067. Correspondence: R. Prohaska. Institute of Biocbemistry.University of Vienna, WiihringerStr. 17. A-1090 Vienna. Austria.
(Stratagene) vectors. The nucleotide sequences were determined by the dideoxynucleotide chain-termination method [6]. Sequence identity of the bone marrow and HeLa cell-derived clones was noticed, except for a single nucleotide substitution (at position 585) and the fact that only one bone marrow cDNA clone contained the putative start codon and additional 18 nucleotides at the 5' end, that were missing in the other, incomplete, clones. The compositg sequence of 919 nucleotides (Fig. l) contains an open reading frame from position l to 864 and encodes 288 amino acids including the start methionine: the protein (287 amino acids) has a calculated M, of 31563. Sequence information on the 5' side of the start codon is not available: 5' extension experiments using the polymerase chain reaction [7] indicated by fragment length, that the 5' untranslated region of band 7 protein is not present in the analysed h g t l l libraries. However. it is very likely that we isolated the complete coding region, because the calculated M r is in accordance with the M r 31000 recently reported for the mature protein [4]. The deduced amino acid sequence was confirmed by sequence identity with 42 amino acids of four peptides, isolated by reverse-phase HPLC after tryptic digestion [8] of the purified erythroid protein [4]. The nucleotide substitution observed at position 585 (A in HeLa cell-. G in bone marrow cell-derived sequences) did not cause an amino acid substitution. Structure analysis of the band 7 protein N-terminal region revealed a highly charged 24 residue N-terminal sequence, followed by a 29 residue hydrophobic stretch, the only putative transmembrane region [9], and a
124 H A E g R H T R D S E A Q R L P D S F X
ATGGCCGAG~GCGGCACACACGGGACTCCGAAGCCCAGCGGCTCCCCGACTCC~C~G
7a
9b
s;
1o;
.;
la;
F T ~ x T ~ x S X ~ , C X X Z z X z Y =C^CCa~*T~crrrccc~Tc~c~*~C^~TCC^T~G^~^T,'~-~C^CT^T 13a l,; 15~ x6; xT; is; ~x
^ z x ~R
cc
~ x LQCC
^x
C PC
c,~c^ccc^Tc^~rrr^c^mccTccc^rm^c~cc^cc^ccc.v, Acc^cc~cT 19; 2o; zso n; .~ 24; L F F I L P C T D S F I g V D N R T X S
m=-r~^mTcc~Tcc^cTc^c^ccm,Tc.~c~c^~c~cT,r,'rc^ 25; ~,; z~; zs; zo; ~o;
V V Y Y R V Q N A T L A V A N I T N A D
~c~^=^cc~c~=c^~cc~ccc~cc~c~c~^~c,cc~ccc~c,c
~c^~c~ccc~m"r~c^c~c~^~c~c^~c~c=c~c~cc^cc~c~
=c~c^c,~cc~c~c~c^c~^c~,.~=cc^c,c~c^~c^c~^c~c~cc,~,~
subsequent polar sequence. The net charges of the 15 amino acid segments flanking the putative transmembrane region are 0 for the N-terminal and + 2 for the C-terminal region. According to the charge-difference rule [10] the orientation of the transmembrane stretch is NexoCc~. Thus, the structural topography corresponds to a type Ib (bitopic) integral protein [11], which is characterized by the absence of a signal sequence, the presence of a short exoplasmic N-terminal region, followed by the transmembrane region and the bulk of the protein at the cytoplasmic side. This structure prediction is in accordance with the proteinchemical data [4]. The primary sequence contains nine putative phosphorylation sites, one for a cAMP-dependent protein kinase, three for a protein kinase C, and five for a casein kinase II [12]. Five potential N-glycosylation sites lie within the cytoplasmic domain. Secondary structure analysis [13] predicted 31% a-helix, 37% //-sheet and 21% turns. Homology searches of EMBL (Release 26.0, February 1991) and SWISS-PROT (Release 18.0, May 1991) data bases did not reveal a significant homology with a known gene or protein. This work was supported by the Fonds zur F6rderung der wissenschaftliehen Forschung (Austrian Science Foundation), grant No. P7410. We thank Klaus Hartmuth for his help with computer programs, and Drs. Heribert Hirt, Tim Skern, Hans-Dieter Liebig and Adoif Himmler for helpful discussions.
A T D A W G I K V E R V E I K D V K L P
CCC^CtC^~CC~C~CC~'~.'~CC~C*CCCTCTCC.~=,~C^~C~,'~CT^CC~
c~cc^cc~cc^c^~^cc~^~ccc~cc^c~cc^c~ccc~cccccc^cccccccccc~c
V I A A E G E H N A S R A L K E A S H V
G~A'rTGCAGCCG~GGACAAATG~TGCATCCAGGGCTCTG~ ~GCCTCCATGGTC 67;
680
69;
70;
71;
72;
~ T ~ S ? A A L ~ L R Y L Q T L T T I A ATCAC~TCTCGTGCAGCCC~CAGCTCCGATACC~CA~CAC~ACCACC^~GCT
A ~ g N S T I V F P L P Z D N L Q G Z I
~m^~,VaCTC~C~m~CmC~CZ~CCC^T^~^~C~CC~CC~TC^T^ G A K H S H L G • * GCGGCAAAACACACCCATCTAGGCTAGTGTAGAGATGACCGCTAGCC~CC~CC&TG~
GTCGGGGA¢CAAATTAGCG Fig. I. Composite nucleotide sequence of eDNA encoding band 7 integral membrane protein and predicted amino acid sequence. The underlined residues are those matched with the amino acid sequences obtained from tryptic peptides of purified band 7 pn)tein.
References i Steck, T.L. (1974)J. Cell Biol. 62, 1-19. 2 Plut. D.A_ Hosey, M.M. and Tao, M. (1978) Eur. J. Biochem. 82, 333-337. 3 Lande, W.M., Thicmann, P.V.W. and Mentzer, W.C. (1982) J. Clin. Invest. 70, 1273-1280. 4 Hicbl-Dirschmied, C.M., Adolf, G.R. and Prohaska, R. (1991) Biochim. Biophys. Acta, in press. 5 Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl. K. (1988) Current Protocols in Molecular Biology, Greene Publishing AssoCiates and Wiley-lnterscience, New York. 6 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 7 Tung, J.S., Daugherty, B.L., O'Neill, L., Law, S.W., Han, J. and Mark, G.E. (1989) in PCR Technology. Principles and Applications for DNA Amplification (Erlich, H.A., ed.), pp. 99-104, Stockton Press, New York. 8 Aebersold, R. (1989) in A Practical Guide to Protein and Peptide Purification for Microsequencing (Matsudaira, P.T., ed.), pp. 71-88, Academic Press, San Diego. 9 Kyte, J. and Doolittle, R.F. (1982) J. Mol. Biol. 157, 105-132. 10 Hartmann, E., Rapoport, T.M. and Lt~ish, H.F. (1989) Proc. Natl. Acad. Sci. USA 86, 5786-5790. II Singer, SJ. (1990) Annu. Rev. Cell Biol. 6, 247-296. 12 Kemp, B.E. and Pear.n, R.B. (1990) Trends Biochem. Sci. 15, 342-346. 13 Chou, P.Y. and Fasman, G.D. (1974) Biochemistry 13, 222-245.
Biochimica et Biophysica Acta. 10911( 1991) 125-128
125
© 1991 ElsevierScience PublishersB.V.OI67-4781/91/$03.50 ADONIS 0167478191002078 BBAEXP 90256
Short Sequence-Paper
Nucleotide sequence of a c D N A coding for the mitochondrial precursor protein of cytochrome c oxidase subunit IV from the slime mold Dictyostelium discoideum Rosario Rizzuto i, Dorianna Sandon~ i, Roderick A. Capaldi 2 and Roberto Bisson i t CNR Centro Studi per la Fisiologia dei Mitocondti e Laboratorio di Patologia e Biologla molecolare, lstimto di Patologia Generate, Unit'ersith di Padoca, Padoca (Italy) and 2 Institute of Molecular Biolog% Unicersity of Oregon, Eugene, OR (U.S.A.)
(Received 5 June 1991)
Key words: Cytochromec oxidase;SubunitIV; eDNA;Nucleotidesequence;Cleavablepresequence;Mitochondrion; ( Dictyostelium discoideum )
Subunit-specific polyclonal antibodies were used to isolate cDNA clones encoding subunit IV of D/ctyosteLium discoideum cytochrome c oxidase. DNA sequence analysis reveals an open reading frame of 149 amino acids. As shown by sequencing of the protein N-terminus, the subunit is synthesized with a 24 residue cleavable presequence which leads to a mature polypeptide of 14 305 Da. The slime mold subunit exhibits a low but significant degree of similarity with subunit Va of human and subunit VI of yeast cytochrome c oxidase.
The subunit composition of cytochrome c oxidase, the terminal enzyme of the respiratory chain, has changed dramatically throughout evolution. In eukaryotes, the three polypeptides homologous to the subunits of the bacterial enzyme are encoded by the mitochondrial DNA and assembled with a number of nuclear-encoded subunits of unknown function, ranging from four in the slime mold D. d i s c o i d e u m to ten in mammals [1-3]. Because of the low structural complexity, the characterization of the D. d i s c o i d e u m oxidase may offer new insights not only on the role of the nuclear subunits, but also on the structural evolution of this key enzyme of the aerobic metabolism. Recently, we have described the primary structure of the two smallest subunits of the complex, termed VI and Vlle [4,5], the latter being one of the two oxygen-regulated isoforms present in the organism [6]. In this paper we present the sequence of subunit IV, the largest nuclear-encoded subunit of the slime mold oxidase. As in the case of the previously characterized clones, the cDNAs were obtained by screening a Agtl I
The sequence data in this paper have been submitted to the EMBL/Genbank Data Libraries under the accession number X55670. Correspondence: R. Bisson, lstituto di PatologiaGenerate, U,iversitar di Padova,Via Trieste 75, 35121 Padova,Italy.
expression library (about 60000 pfu) with a subunit specific polyclonal antibody and the deduced amino acid sequence was confirmed by protein sequencing of the N-terminus. The full length, 634 bp long, cDNA (Fig. 1) contains an open reading frame coding for a protein of 149 amino acid residues and the characteristic poly(T) stretch which marks the 5' end of the Dictyostelium oxidase cDNAs isolated so far [4,5]. The comparison of the deduced amino acid sequence with the N-terminal sequence, as determined by Edman degradation of the protein purified by SDS-PAGE, reveals the presence of a 24 residues long cleavable mitochondrial presequence, the first one to be characterized in a slime mold. As shown by Fig. 2, the mature form of subunit IV is identical in 11 amino acid positions to yeast subunit Vl and in 14 to human subunit Va of cytochrome c oxidase. This optimal alignment of sequences requires two large gaps, one in the Dictyostelium sequence, one in the other two sequences. In comparison, yeast Vl and human Va show 31% identity, in spite of the low similarity, several reasons suggest that D. d/sco/deum subunit IV is homologue to these two polypeptides. First, residues that are identical between the slime mold and one of the two organisms remain invariant, or are clustered to invariant amino acids, when all three sequences are compared. This particular arrangement, more than an occasional distribution of residues, could reflect the presence in the folded sub-
126 EcoRI
linker - T T T T T T T T T T T T T T A T T A T T A T T A T T A T T T T A T T A T T A A T T A C T A T C A T A T T
TATACCTACACACACAAA
ATG TTT GCT TTA AGA TCA ATT CGT TCA GCT ACT AAA M e t Phe Ala L e u A r g Set Ile A r g Set A l a T h r Lys
(52) (106)
(-20) GCT T T C C A A A C C A C T T C A A T T G T T T C T C A A A G A G G A T T T T T A C A A A C T A C C Ala Phe G l n T h r T h r Set Ile Val Ser Gln A r g Gly P h e L e u G l n T h r T h r
(-10)
(-1)
(157)
(1)
CTT A A A A A C G T C C T C T T C C C A A C T G A A A G A C A A T T A A G A C G T C A A T A C T T A ~U Lys A s h V a l D e u p h e P r o T h r G l u A r a G l n L e u A r m A r a G l n T v r L e u
(1o)
(208)
(20)
GCT GAT AAT CAC ATC AAA GTA GGT TCA GGA GAA TTC GAT AAA TTT TAT GAA A l a 2%sp A S h H i s Ile Lys Val G I y SeT p ; o G l u P h e A s h L v s P h e T v r G l u
(259)
(30) G A T T T A C A A C C A T G A G A A CTC T C A A A A C A A T C T G G T T T A A G T G A T G C C C T C A s p Leu G l n P r o Set G l u Leu Ser Lys G l n Set G l y L e u Set A s p A l a L e u
(40)
(310)
(so)
CTC G A T G A C C C A A T C CTC CAC A T T T G T G T C A T C A A A T A C A A C A A A A A C A T T Leu A s p A s p P r o Ile Leu His Ile Cys Val Ile Lys T y r A S h Lys A S h Ile
(60)
(361)
(70)
G T C C A A A G A T A C A A C T T A A C C CCA G A A C A A G A A A A A G A T A T C A T G G A A A A C Val G l n A r g T y r A S h L e u Thr Pro G l u G l n G l u Lys A s p Ile M e t G l u A S h
(80)
(412)
(90)
TAT AAC GTT AGT GCT GGT GAC CCA TCA CTC GAA CAA ATT TTA CCA ATC CCA Tyr A S h V a l Ser A l a G l y A s p Pro Set L e u G l u G l n Ile L e u P r o Ile P r o (£00)
(463)
GTC CCA GCA CAT GTC TTC GAA GAG TTA CCA ATT GTC AAA GTT TTA AAT AAC Val Pro A l a H i s Ile Phe G l u G l u L e u P r o Ile V a l L y s V a l L e u A S h A S h (110) (120)
(514)
TAA ATAGGTTTATGTAATTACATACTGATGTACTTTCTTTTATTACACTGAATGGTGAAAAATATA
(581)
AATTTCAAAAAAAAATAAATAAATAAATAAAAAAACCCAA~-EcoRI l i n k e r (634) Fig. 1. Nucleotideand deduced aminoacidsequenceof a full-lengtheDNA for D. discoideum cytochromec oxidase subunitIV. The N-terminus of the matureprotein,determinedby Edmandegradation,is underlined.The putativepolyadenylationsignalis overlined.The numbers( - !) and (1) belowthe linesindicatethe last residueof the cleavablepresequenceand the first aminoacid of the mature subunit,respectively.
unit of functional or structural domains which have been conserved throughout evolution. Second, as shown in Fig. 3 and discussed below, similarities are found between the cleavable presequences of the three homologous subunits which are usually absent among unrelated polypeptides, even when they belong to the same complex. Finally, like its homologous yeast and human counterparts, subunit IV has a uniformly bydrophilic character. Some additional interesting features emerge from the comparison of the N-terminal cleavable extensions of the nuclear-encoded oxidase subunits. Though no sequence consensus exists among leader peptides, Fig. 3 shows that a low but evident degree of similarity is
maintained between homologous subunits. The primary structure of the precursor of Dictyostelium oxidase subunit IV adds further support to this observation. Interestingly, a remarkable degree of identity is also found between the N-terminus of the mature polypeptide (shown by capital letters in Fig. 3) and the C-terminal part of the yeast presequence. On the basis of the above data, the absence of a presequence in the slime mold subunit V! [4] and V (Rizzuto, R. et al, unpublished data) was unexpected. These apparently conflicting findings may be explained by the position of slime molds in evolution [7]. It is tempting to speculate that the specialized cleavable regions for mitochondriai import of the oxidase nuclear-encoded subunits were
127
Dd Hm
IV Va
SO
VI
Dd
Hm
IV Va
Sc Dd
VI IV
Hs
Va
10
20
FLQTTLKNVL
FPTERQLRRQ SHG
30
YLADNHIKVG SQETDEEFDA
60 70 .................... GLSDALLDDP ILHICVIKYN .....
40
SP~FDKF RWVTYFNKPDD~
80 90 ~NCFSMD~V ~PAVIEKAL KIN~IVQR~N~T [PEIQEKDIMEN I~TLVT~DMV JPEJPKIIDAAL
50
LQPS S QS IDAWIEL4R~JG-
100 RAARRVNDLP YNVSAGDPSL RACRRLNDFA
110 120 TAmRVFEALKYKVENEDQYKA¥-LDELKDVROHLGV PLK~-~FPSS S EQ~IJLPIP~P . . . . . . . . . . . . . . . . . . . . . . . . . . A HIF]EEL[PIV~--~LNN SLVRILEr41VKDKAGPHKEIYPYVIQELRPTL~IELGI STPEE~_~JGLD~K v | . . . , * ** *e* *** oee
Fig. 2. Amino acid sequence comparison of 19. discoideum subunit IV with subunit VI of the yeast S. cerecisiae [8] and subunit Va from man [9]. The top, middle and bottom lines show the yeast (Sc), the slime mold (Dd) and the human (Hs) sequences, respectively. Identifies involving the slime mold are boxed. Asterisks mark identities between yeast and man. Invariant residues are shown by ciosed circles. Numbers refer to the D. discoideum sequence. Dashes have been introduced to obtain optimum alignement among subonits.
Sc
VI
Dd
IV
Hs
Va
Sc
IV
Dd
V
Hs
Vb
Sc Dd
Va
Hs
VI IV
m I s~a~rnpv inr~l 1 r a r p g a y h aMr~t~t .falJzJs~rls:tk~f q tsivsqrgFL~JT~-K~_~WL mlgaalJrJr av~Jat radpr-gllhsartpgpavaiq$ • • * t * • • • • e
mls--Irqsirffkpatrtlcssryll ABSENT masrllrgagtlaaqalrargpsgaaamrsm
VIIa VIIe VIc
s ~ Y TE L y
QQ•
....
mlrntftragglsri-tsvrfABSENT mlatrvfslvgkraistsvcvr *
Sc Dd Hs
-~q
*
•
.ee
ABSENT ABSENT ABSENT
Fig. 3, O c a v a b l e p ~ q u e n c e s a t t ~ N - t c ~ i n i ~ t ~ n u c l e a r e n c o d e d ~ n i t s o f ~ ~o/de~oxi~andt~bomo~o~andhuman ~ptides[4~,8-15].S~lsasin~ffl~pitallette~re~rtot~matu~nit.
• e
•
128 still evolving when Dictyostelium diverged from its euo karyotic ancestor. As suggested by the similarities shown in Fig. 3, this process was triggered once, and independently for each subunit, it occurred early in subunit IV and later in subunit V a n d VI, after the slime mold divergence but before the y e a s t / m a m m a l s radiation. We t h a n k Dr. G. Schiavo for help in the p r e p a r a t i o n of the antibodies and Drs. R. Kessin (Columbia University, New York) and M. V e r o n (Institut Pasteur, Paris) for the e D N A library. This work was s u p p o r t e d by grants from the National Institute of H e a l t h (HL22050), the Markey Foundation, the Italian National Research Council (P.F. lngegner;a genetica, CNR) and the Italian Ministry of University a n d Scientific Research. References 1 Capaldi, R.A. (1990) Annu. Rev. Biochem. 59, 569-5%. 2 Kadenbach, B., Kuhn-Nentwig, L. and Buge, U. (1987) Curt. Top. Bioenerg. 15, i13-161.
3 Bisson, R., Schiavo, G. and Papini, E. (1985) Biochemistry 24, 7845-7852. 4 Rizzuto+ R.. Sandon/~, D., Capaldi. R. and Bisson, R. (1990) Nucleic Acids Res. 18, 6711. 5 Rizzuto. R.. Sandon~+ D.. Capaldi. R. and Bison, R. (1991) Biochim. Biophys. Acta. in press. 6 Schiavo, G. and Bismn. R. (1989) J. Biol. Chem. 264. 7129-7134. 7 Pace, N.R., Olsen, G.J. and Woese+ C.R. (1986) Cell 45, 325-326. 8 Wright. R.M., Ko, C., Cumsky, M.G. and Poyton, R.O. (1984) J. Biol. Chem. 259, 15401-15407. 9 Rizzuto, R., Nakase, H., Zeviani+ M., DiMauro. S. and Schon, E.A. (1988) Gene 69, 245-256. 10 Maarse, A.C., Van Loon, A.P.G.M.+ Riezman, H.. Gregor, !., Schatz, G. and Gr/vell, L.A. (1984) EMBO J. 3, 2831-2837. il Zcviani, M., Sakoda, S., Shcrbani, A.A.+ Nakas¢, H., Rizzuto, R., SamiU, C.E., Dikauro, S. and Schon, E.A. (1988) Gene 65, 1-11. 12 Cumsky, M.G.+ Trueblood, C.E., Ko, C. and Poyton, R.O. (1987) Mol. Cell. Biol. 7, 3511-3519. 13 Zeviani, M.. Nakagawa+ M.. Herbert, J.. Lomax, M.I., Grossman, L.I., Sherbany, A.A.. Miranda, A.. DiMauro, S. and Schon, E.A. (1987) Gene 55, 205-217. 14 Wright, R.M., Dircks, L.H. and Poyton, R.O. (1986) J. Biol. Chem. 261, 17183-17191. 15 Otsuka, M.. Mizuno+ Y., Yoshida, M., Kagawa, Y. an~l Ohta, S. (1988) Nucleic Acids Res. 16, 10916.
123
© 1991 ElsevierSciencePublishersB.V. 0167-4781/91/$03.50 ADONIS 016747819100208L BBAEXP 90255
Short Sequence-Paper
Cloning and nucleotide sequence of cDNA encoding human erythrocyte band 7 integral membrane protein C h r i s t i n e M . H i e b l - D i r s c h m i e d 1, B a r b a r a E n t l e r ~, C l a u d i a G l o t z m a n n t, I n g r i d M a u r e r - F o g y 2, C h r i s t i a n S t r a t o w a 2 a n d R a i n e r P r o h a s k a t Institute of Biochemistry, UnicersiO'of Vienna, Vienna (Austria) and 2 Ernst Boehringer hzstitute, Vienna (Austria)
(Received 18 June 1991) Key words: Erythrocyte;Membrane protein: Band 7: cDNA sequence: Protein structure analysis cDNA clones encoding the human erythrocyte band 7 membrane protein were isolated by immunoscreening from bone marrow and HeLa cell •gtll cDNA libraries, and their nucleotide sequences were determined. HeLa- and bone marrow cell-derived sequences were identical, except for one nucleotide; the deduced sequence of 287 amino acids was confirmed by sequence identity with peptides of the erythroid protein. Structure analysis assigned band 7 protein to the type Ib transmembrane proteins. Human erythrocyte band 7 protein has been described originally as a Mr 29000 integral membrane protein, which is exposed on the cytoplasmic surface of the membrane and susceptible to phosphorylation by a cAMP-dependent protein kinase [1,2]. A deficiency of this protein in red cells of patients with hereditary stomatocytosis or cryohydrocytosis [3] results in an increased Na+/K+-permeability and hence to a disorder of cell volume control. Using monoclonal antibodies to the human erythrocyte band 7 integral membrane protein we have recently identified related proteins in other mammalian red cells and in human cell lines of epithelial and lymphoid origin, notably in HeLa cells [4]. It was therefore possible to screen bone marrow and HeLa cell cDNA expression libraries with our antibodies in order to isolate cDNA clones, determine the nucleotide sequence and study the structure of this so far neglected erythrocyte membrane protein. Immunoscreening of Agtll expression libraries [5] from human bone marrow and HeLa cells (Clontech Labs., HLI058b and HL1022b) resulted in the isolation of 19 clones, four of which were subcloned into p G E M - 3 Z (Promega) and Bluescript II K S ( + )
The sequence data in this paper have been submitted to the EMBL/Genbank Data Libraries under the ;,ccession number X60067. Correspondence: R. Prohaska. Institute of Biocbemistry.University of Vienna, WiihringerStr. 17. A-1090 Vienna. Austria.
(Stratagene) vectors. The nucleotide sequences were determined by the dideoxynucleotide chain-termination method [6]. Sequence identity of the bone marrow and HeLa cell-derived clones was noticed, except for a single nucleotide substitution (at position 585) and the fact that only one bone marrow cDNA clone contained the putative start codon and additional 18 nucleotides at the 5' end, that were missing in the other, incomplete, clones. The compositg sequence of 919 nucleotides (Fig. l) contains an open reading frame from position l to 864 and encodes 288 amino acids including the start methionine: the protein (287 amino acids) has a calculated M, of 31563. Sequence information on the 5' side of the start codon is not available: 5' extension experiments using the polymerase chain reaction [7] indicated by fragment length, that the 5' untranslated region of band 7 protein is not present in the analysed h g t l l libraries. However. it is very likely that we isolated the complete coding region, because the calculated M r is in accordance with the M r 31000 recently reported for the mature protein [4]. The deduced amino acid sequence was confirmed by sequence identity with 42 amino acids of four peptides, isolated by reverse-phase HPLC after tryptic digestion [8] of the purified erythroid protein [4]. The nucleotide substitution observed at position 585 (A in HeLa cell-. G in bone marrow cell-derived sequences) did not cause an amino acid substitution. Structure analysis of the band 7 protein N-terminal region revealed a highly charged 24 residue N-terminal sequence, followed by a 29 residue hydrophobic stretch, the only putative transmembrane region [9], and a
124 H A E g R H T R D S E A Q R L P D S F X
ATGGCCGAG~GCGGCACACACGGGACTCCGAAGCCCAGCGGCTCCCCGACTCC~C~G
7a
9b
s;
1o;
.;
la;
F T ~ x T ~ x S X ~ , C X X Z z X z Y =C^CCa~*T~crrrccc~Tc~c~*~C^~TCC^T~G^~^T,'~-~C^CT^T 13a l,; 15~ x6; xT; is; ~x
^ z x ~R
cc
~ x LQCC
^x
C PC
c,~c^ccc^Tc^~rrr^c^mccTccc^rm^c~cc^cc^ccc.v, Acc^cc~cT 19; 2o; zso n; .~ 24; L F F I L P C T D S F I g V D N R T X S
m=-r~^mTcc~Tcc^cTc^c^ccm,Tc.~c~c^~c~cT,r,'rc^ 25; ~,; z~; zs; zo; ~o;
V V Y Y R V Q N A T L A V A N I T N A D
~c~^=^cc~c~=c^~cc~ccc~cc~c~c~^~c,cc~ccc~c,c
~c^~c~ccc~m"r~c^c~c~^~c~c^~c~c=c~c~cc^cc~c~
=c~c^c,~cc~c~c~c^c~^c~,.~=cc^c,c~c^~c^c~^c~c~cc,~,~
subsequent polar sequence. The net charges of the 15 amino acid segments flanking the putative transmembrane region are 0 for the N-terminal and + 2 for the C-terminal region. According to the charge-difference rule [10] the orientation of the transmembrane stretch is NexoCc~. Thus, the structural topography corresponds to a type Ib (bitopic) integral protein [11], which is characterized by the absence of a signal sequence, the presence of a short exoplasmic N-terminal region, followed by the transmembrane region and the bulk of the protein at the cytoplasmic side. This structure prediction is in accordance with the proteinchemical data [4]. The primary sequence contains nine putative phosphorylation sites, one for a cAMP-dependent protein kinase, three for a protein kinase C, and five for a casein kinase II [12]. Five potential N-glycosylation sites lie within the cytoplasmic domain. Secondary structure analysis [13] predicted 31% a-helix, 37% //-sheet and 21% turns. Homology searches of EMBL (Release 26.0, February 1991) and SWISS-PROT (Release 18.0, May 1991) data bases did not reveal a significant homology with a known gene or protein. This work was supported by the Fonds zur F6rderung der wissenschaftliehen Forschung (Austrian Science Foundation), grant No. P7410. We thank Klaus Hartmuth for his help with computer programs, and Drs. Heribert Hirt, Tim Skern, Hans-Dieter Liebig and Adoif Himmler for helpful discussions.
A T D A W G I K V E R V E I K D V K L P
CCC^CtC^~CC~C~CC~'~.'~CC~C*CCCTCTCC.~=,~C^~C~,'~CT^CC~
c~cc^cc~cc^c^~^cc~^~ccc~cc^c~cc^c~ccc~cccccc^cccccccccc~c
V I A A E G E H N A S R A L K E A S H V
G~A'rTGCAGCCG~GGACAAATG~TGCATCCAGGGCTCTG~ ~GCCTCCATGGTC 67;
680
69;
70;
71;
72;
~ T ~ S ? A A L ~ L R Y L Q T L T T I A ATCAC~TCTCGTGCAGCCC~CAGCTCCGATACC~CA~CAC~ACCACC^~GCT
A ~ g N S T I V F P L P Z D N L Q G Z I
~m^~,VaCTC~C~m~CmC~CZ~CCC^T^~^~C~CC~CC~TC^T^ G A K H S H L G • * GCGGCAAAACACACCCATCTAGGCTAGTGTAGAGATGACCGCTAGCC~CC~CC&TG~
GTCGGGGA¢CAAATTAGCG Fig. I. Composite nucleotide sequence of eDNA encoding band 7 integral membrane protein and predicted amino acid sequence. The underlined residues are those matched with the amino acid sequences obtained from tryptic peptides of purified band 7 pn)tein.
References i Steck, T.L. (1974)J. Cell Biol. 62, 1-19. 2 Plut. D.A_ Hosey, M.M. and Tao, M. (1978) Eur. J. Biochem. 82, 333-337. 3 Lande, W.M., Thicmann, P.V.W. and Mentzer, W.C. (1982) J. Clin. Invest. 70, 1273-1280. 4 Hicbl-Dirschmied, C.M., Adolf, G.R. and Prohaska, R. (1991) Biochim. Biophys. Acta, in press. 5 Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl. K. (1988) Current Protocols in Molecular Biology, Greene Publishing AssoCiates and Wiley-lnterscience, New York. 6 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 7 Tung, J.S., Daugherty, B.L., O'Neill, L., Law, S.W., Han, J. and Mark, G.E. (1989) in PCR Technology. Principles and Applications for DNA Amplification (Erlich, H.A., ed.), pp. 99-104, Stockton Press, New York. 8 Aebersold, R. (1989) in A Practical Guide to Protein and Peptide Purification for Microsequencing (Matsudaira, P.T., ed.), pp. 71-88, Academic Press, San Diego. 9 Kyte, J. and Doolittle, R.F. (1982) J. Mol. Biol. 157, 105-132. 10 Hartmann, E., Rapoport, T.M. and Lt~ish, H.F. (1989) Proc. Natl. Acad. Sci. USA 86, 5786-5790. II Singer, SJ. (1990) Annu. Rev. Cell Biol. 6, 247-296. 12 Kemp, B.E. and Pear.n, R.B. (1990) Trends Biochem. Sci. 15, 342-346. 13 Chou, P.Y. and Fasman, G.D. (1974) Biochemistry 13, 222-245.
Biochimica et Biophysica Acta. 10911( 1991) 125-128
125
© 1991 ElsevierScience PublishersB.V.OI67-4781/91/$03.50 ADONIS 0167478191002078 BBAEXP 90256
Short Sequence-Paper
Nucleotide sequence of a c D N A coding for the mitochondrial precursor protein of cytochrome c oxidase subunit IV from the slime mold Dictyostelium discoideum Rosario Rizzuto i, Dorianna Sandon~ i, Roderick A. Capaldi 2 and Roberto Bisson i t CNR Centro Studi per la Fisiologia dei Mitocondti e Laboratorio di Patologia e Biologla molecolare, lstimto di Patologia Generate, Unit'ersith di Padoca, Padoca (Italy) and 2 Institute of Molecular Biolog% Unicersity of Oregon, Eugene, OR (U.S.A.)
(Received 5 June 1991)
Key words: Cytochromec oxidase;SubunitIV; eDNA;Nucleotidesequence;Cleavablepresequence;Mitochondrion; ( Dictyostelium discoideum )
Subunit-specific polyclonal antibodies were used to isolate cDNA clones encoding subunit IV of D/ctyosteLium discoideum cytochrome c oxidase. DNA sequence analysis reveals an open reading frame of 149 amino acids. As shown by sequencing of the protein N-terminus, the subunit is synthesized with a 24 residue cleavable presequence which leads to a mature polypeptide of 14 305 Da. The slime mold subunit exhibits a low but significant degree of similarity with subunit Va of human and subunit VI of yeast cytochrome c oxidase.
The subunit composition of cytochrome c oxidase, the terminal enzyme of the respiratory chain, has changed dramatically throughout evolution. In eukaryotes, the three polypeptides homologous to the subunits of the bacterial enzyme are encoded by the mitochondrial DNA and assembled with a number of nuclear-encoded subunits of unknown function, ranging from four in the slime mold D. d i s c o i d e u m to ten in mammals [1-3]. Because of the low structural complexity, the characterization of the D. d i s c o i d e u m oxidase may offer new insights not only on the role of the nuclear subunits, but also on the structural evolution of this key enzyme of the aerobic metabolism. Recently, we have described the primary structure of the two smallest subunits of the complex, termed VI and Vlle [4,5], the latter being one of the two oxygen-regulated isoforms present in the organism [6]. In this paper we present the sequence of subunit IV, the largest nuclear-encoded subunit of the slime mold oxidase. As in the case of the previously characterized clones, the cDNAs were obtained by screening a Agtl I
The sequence data in this paper have been submitted to the EMBL/Genbank Data Libraries under the accession number X55670. Correspondence: R. Bisson, lstituto di PatologiaGenerate, U,iversitar di Padova,Via Trieste 75, 35121 Padova,Italy.
expression library (about 60000 pfu) with a subunit specific polyclonal antibody and the deduced amino acid sequence was confirmed by protein sequencing of the N-terminus. The full length, 634 bp long, cDNA (Fig. 1) contains an open reading frame coding for a protein of 149 amino acid residues and the characteristic poly(T) stretch which marks the 5' end of the Dictyostelium oxidase cDNAs isolated so far [4,5]. The comparison of the deduced amino acid sequence with the N-terminal sequence, as determined by Edman degradation of the protein purified by SDS-PAGE, reveals the presence of a 24 residues long cleavable mitochondrial presequence, the first one to be characterized in a slime mold. As shown by Fig. 2, the mature form of subunit IV is identical in 11 amino acid positions to yeast subunit Vl and in 14 to human subunit Va of cytochrome c oxidase. This optimal alignment of sequences requires two large gaps, one in the Dictyostelium sequence, one in the other two sequences. In comparison, yeast Vl and human Va show 31% identity, in spite of the low similarity, several reasons suggest that D. d/sco/deum subunit IV is homologue to these two polypeptides. First, residues that are identical between the slime mold and one of the two organisms remain invariant, or are clustered to invariant amino acids, when all three sequences are compared. This particular arrangement, more than an occasional distribution of residues, could reflect the presence in the folded sub-
126 EcoRI
linker - T T T T T T T T T T T T T T A T T A T T A T T A T T A T T T T A T T A T T A A T T A C T A T C A T A T T
TATACCTACACACACAAA
ATG TTT GCT TTA AGA TCA ATT CGT TCA GCT ACT AAA M e t Phe Ala L e u A r g Set Ile A r g Set A l a T h r Lys
(52) (106)
(-20) GCT T T C C A A A C C A C T T C A A T T G T T T C T C A A A G A G G A T T T T T A C A A A C T A C C Ala Phe G l n T h r T h r Set Ile Val Ser Gln A r g Gly P h e L e u G l n T h r T h r
(-10)
(-1)
(157)
(1)
CTT A A A A A C G T C C T C T T C C C A A C T G A A A G A C A A T T A A G A C G T C A A T A C T T A ~U Lys A s h V a l D e u p h e P r o T h r G l u A r a G l n L e u A r m A r a G l n T v r L e u
(1o)
(208)
(20)
GCT GAT AAT CAC ATC AAA GTA GGT TCA GGA GAA TTC GAT AAA TTT TAT GAA A l a 2%sp A S h H i s Ile Lys Val G I y SeT p ; o G l u P h e A s h L v s P h e T v r G l u
(259)
(30) G A T T T A C A A C C A T G A G A A CTC T C A A A A C A A T C T G G T T T A A G T G A T G C C C T C A s p Leu G l n P r o Set G l u Leu Ser Lys G l n Set G l y L e u Set A s p A l a L e u
(40)
(310)
(so)
CTC G A T G A C C C A A T C CTC CAC A T T T G T G T C A T C A A A T A C A A C A A A A A C A T T Leu A s p A s p P r o Ile Leu His Ile Cys Val Ile Lys T y r A S h Lys A S h Ile
(60)
(361)
(70)
G T C C A A A G A T A C A A C T T A A C C CCA G A A C A A G A A A A A G A T A T C A T G G A A A A C Val G l n A r g T y r A S h L e u Thr Pro G l u G l n G l u Lys A s p Ile M e t G l u A S h
(80)
(412)
(90)
TAT AAC GTT AGT GCT GGT GAC CCA TCA CTC GAA CAA ATT TTA CCA ATC CCA Tyr A S h V a l Ser A l a G l y A s p Pro Set L e u G l u G l n Ile L e u P r o Ile P r o (£00)
(463)
GTC CCA GCA CAT GTC TTC GAA GAG TTA CCA ATT GTC AAA GTT TTA AAT AAC Val Pro A l a H i s Ile Phe G l u G l u L e u P r o Ile V a l L y s V a l L e u A S h A S h (110) (120)
(514)
TAA ATAGGTTTATGTAATTACATACTGATGTACTTTCTTTTATTACACTGAATGGTGAAAAATATA
(581)
AATTTCAAAAAAAAATAAATAAATAAATAAAAAAACCCAA~-EcoRI l i n k e r (634) Fig. 1. Nucleotideand deduced aminoacidsequenceof a full-lengtheDNA for D. discoideum cytochromec oxidase subunitIV. The N-terminus of the matureprotein,determinedby Edmandegradation,is underlined.The putativepolyadenylationsignalis overlined.The numbers( - !) and (1) belowthe linesindicatethe last residueof the cleavablepresequenceand the first aminoacid of the mature subunit,respectively.
unit of functional or structural domains which have been conserved throughout evolution. Second, as shown in Fig. 3 and discussed below, similarities are found between the cleavable presequences of the three homologous subunits which are usually absent among unrelated polypeptides, even when they belong to the same complex. Finally, like its homologous yeast and human counterparts, subunit IV has a uniformly bydrophilic character. Some additional interesting features emerge from the comparison of the N-terminal cleavable extensions of the nuclear-encoded oxidase subunits. Though no sequence consensus exists among leader peptides, Fig. 3 shows that a low but evident degree of similarity is
maintained between homologous subunits. The primary structure of the precursor of Dictyostelium oxidase subunit IV adds further support to this observation. Interestingly, a remarkable degree of identity is also found between the N-terminus of the mature polypeptide (shown by capital letters in Fig. 3) and the C-terminal part of the yeast presequence. On the basis of the above data, the absence of a presequence in the slime mold subunit V! [4] and V (Rizzuto, R. et al, unpublished data) was unexpected. These apparently conflicting findings may be explained by the position of slime molds in evolution [7]. It is tempting to speculate that the specialized cleavable regions for mitochondriai import of the oxidase nuclear-encoded subunits were
127
Dd Hm
IV Va
SO
VI
Dd
Hm
IV Va
Sc Dd
VI IV
Hs
Va
10
20
FLQTTLKNVL
FPTERQLRRQ SHG
30
YLADNHIKVG SQETDEEFDA
60 70 .................... GLSDALLDDP ILHICVIKYN .....
40
SP~FDKF RWVTYFNKPDD~
80 90 ~NCFSMD~V ~PAVIEKAL KIN~IVQR~N~T [PEIQEKDIMEN I~TLVT~DMV JPEJPKIIDAAL
50
LQPS S QS IDAWIEL4R~JG-
100 RAARRVNDLP YNVSAGDPSL RACRRLNDFA
110 120 TAmRVFEALKYKVENEDQYKA¥-LDELKDVROHLGV PLK~-~FPSS S EQ~IJLPIP~P . . . . . . . . . . . . . . . . . . . . . . . . . . A HIF]EEL[PIV~--~LNN SLVRILEr41VKDKAGPHKEIYPYVIQELRPTL~IELGI STPEE~_~JGLD~K v | . . . , * ** *e* *** oee
Fig. 2. Amino acid sequence comparison of 19. discoideum subunit IV with subunit VI of the yeast S. cerecisiae [8] and subunit Va from man [9]. The top, middle and bottom lines show the yeast (Sc), the slime mold (Dd) and the human (Hs) sequences, respectively. Identifies involving the slime mold are boxed. Asterisks mark identities between yeast and man. Invariant residues are shown by ciosed circles. Numbers refer to the D. discoideum sequence. Dashes have been introduced to obtain optimum alignement among subonits.
Sc
VI
Dd
IV
Hs
Va
Sc
IV
Dd
V
Hs
Vb
Sc Dd
Va
Hs
VI IV
m I s~a~rnpv inr~l 1 r a r p g a y h aMr~t~t .falJzJs~rls:tk~f q tsivsqrgFL~JT~-K~_~WL mlgaalJrJr av~Jat radpr-gllhsartpgpavaiq$ • • * t * • • • • e
mls--Irqsirffkpatrtlcssryll ABSENT masrllrgagtlaaqalrargpsgaaamrsm
VIIa VIIe VIc
s ~ Y TE L y
QQ•
....
mlrntftragglsri-tsvrfABSENT mlatrvfslvgkraistsvcvr *
Sc Dd Hs
-~q
*
•
.ee
ABSENT ABSENT ABSENT
Fig. 3, O c a v a b l e p ~ q u e n c e s a t t ~ N - t c ~ i n i ~ t ~ n u c l e a r e n c o d e d ~ n i t s o f ~ ~o/de~oxi~andt~bomo~o~andhuman ~ptides[4~,8-15].S~lsasin~ffl~pitallette~re~rtot~matu~nit.
• e
•
128 still evolving when Dictyostelium diverged from its euo karyotic ancestor. As suggested by the similarities shown in Fig. 3, this process was triggered once, and independently for each subunit, it occurred early in subunit IV and later in subunit V a n d VI, after the slime mold divergence but before the y e a s t / m a m m a l s radiation. We t h a n k Dr. G. Schiavo for help in the p r e p a r a t i o n of the antibodies and Drs. R. Kessin (Columbia University, New York) and M. V e r o n (Institut Pasteur, Paris) for the e D N A library. This work was s u p p o r t e d by grants from the National Institute of H e a l t h (HL22050), the Markey Foundation, the Italian National Research Council (P.F. lngegner;a genetica, CNR) and the Italian Ministry of University a n d Scientific Research. References 1 Capaldi, R.A. (1990) Annu. Rev. Biochem. 59, 569-5%. 2 Kadenbach, B., Kuhn-Nentwig, L. and Buge, U. (1987) Curt. Top. Bioenerg. 15, i13-161.
3 Bisson, R., Schiavo, G. and Papini, E. (1985) Biochemistry 24, 7845-7852. 4 Rizzuto+ R.. Sandon/~, D., Capaldi. R. and Bisson, R. (1990) Nucleic Acids Res. 18, 6711. 5 Rizzuto. R.. Sandon~+ D.. Capaldi. R. and Bison, R. (1991) Biochim. Biophys. Acta. in press. 6 Schiavo, G. and Bismn. R. (1989) J. Biol. Chem. 264. 7129-7134. 7 Pace, N.R., Olsen, G.J. and Woese+ C.R. (1986) Cell 45, 325-326. 8 Wright. R.M., Ko, C., Cumsky, M.G. and Poyton, R.O. (1984) J. Biol. Chem. 259, 15401-15407. 9 Rizzuto, R., Nakase, H., Zeviani+ M., DiMauro. S. and Schon, E.A. (1988) Gene 69, 245-256. 10 Maarse, A.C., Van Loon, A.P.G.M.+ Riezman, H.. Gregor, !., Schatz, G. and Gr/vell, L.A. (1984) EMBO J. 3, 2831-2837. il Zcviani, M., Sakoda, S., Shcrbani, A.A.+ Nakas¢, H., Rizzuto, R., SamiU, C.E., Dikauro, S. and Schon, E.A. (1988) Gene 65, 1-11. 12 Cumsky, M.G.+ Trueblood, C.E., Ko, C. and Poyton, R.O. (1987) Mol. Cell. Biol. 7, 3511-3519. 13 Zeviani, M.. Nakagawa+ M.. Herbert, J.. Lomax, M.I., Grossman, L.I., Sherbany, A.A.. Miranda, A.. DiMauro, S. and Schon, E.A. (1987) Gene 55, 205-217. 14 Wright, R.M., Dircks, L.H. and Poyton, R.O. (1986) J. Biol. Chem. 261, 17183-17191. 15 Otsuka, M.. Mizuno+ Y., Yoshida, M., Kagawa, Y. an~l Ohta, S. (1988) Nucleic Acids Res. 16, 10916.
