Biochimie (1992) 74, 695-704 © Soci6t6 franfaise de biochimie et biologie mol6culaire / Elsevier, Paris
695
Cloning and sequencing of the Bacillus megaterium spollA operon YP Tao**, DSS Hudspeth, PS Vary* Department of Biological Sciences, Northern Illinois University,Dekaib, IL 60115, USA (Received 5 January 1992: accepted 20 February 1992)
Summary - - The spollA operon of Bacillus megaterium has been cloned and the nucleotide sequence determined. The spoliA sequence contains three open reading frames coding for putative proteins of 116 aa, 147 aa, and 253 aa; the first and the third genes are preceded by a ribosomal binding site. The genes are in the same order as those of B subtilis and B licheniformis. The deduced amino acid sequences of these three open reading frames show 78-92% homology with SpolIAA, SpolIAB and SpolIAC of B subtilis and B licheniformis. Northern hybridization revealed that B megaterium also has two spollA transcripts, 1.77 kb and 2.92 kb, auaining maximum expression at t~ and t3, respectively. In addition, homology to a possible penicillin binding protein gene upstream and the first part of a spoVA operon downstream has been identified on the 3.34-kb fragment. The spollA and the downstream spoVA promoter regions are highly conserved among these three species. Sequence analysis of the spoVA promoter revealed a region upstream to the -35 that is highly conserved across Bacillus species.
Bacillus megaterium / sporulation / spollA / spoVA / pbp
Introduction Cells of the Gram-positive genus Bacillus can differentiate into dormant spores upon nutrient deprivation [ 1, 2]. This process of spore formation in Bacillus provides a relative simple experimental system for use in the study of cellular development and differentiation. Sporulation is divided into six or seven distinct morphological stages and involves the coordinated expression of at least 50 spo loci [3, 4]. Many of the spo genes have now been cloned and sequenced, and the function of their gene products is beginning to be understood. Several mechanisms have been found to be involved in the complex regulation of these genes. For example, sequential appearance of new sigma factors that bind to core enzyme and confer different promoter specificity allows transcription of new sets of sporulation genes [5-7]. A second mechanism is the release of spo genes through a two-component system from the repressive effects of a repressor such as AbrB [8]. Increase of sigma factor concentration *Correspondence and reprints **Present address: Waksman Institute of Microbiology, Rutgers University, Piscataway, NJ 08854, USA. Abbreviations: bp, pase pair(s); X-gal, 5-bromo-4-chloro-3indolyl-[~-D-galacto pyranoside; IPTG, isopropyl-~-D-thiogalactopyranoside; rbs, ribosomal-binding site(s); PBP, penicillin-binding proteins; ORF, open reading frame; PG, peptidoglycan; aa, amino acid(s).
during sporulation is a third mechanism. For example, o H increases five-fold in stationary phase from vegetative phase levels because of increased translation or stability of the spoOH mRNA and decreased turnover of o H [9]. Auxiliary factors other than sigma factors can serve as activators or repressors of transcription such as the 'switch protein' SpoIIID [10], which is a transcriptional activator of the spolVCB promoter, but is also a repressor of cotA and corD genes. Other regulatory mechanisms include the activation of sigma factors or processing of pro-o factors into mature forms. Examples are oK and oE processing [11], as well as changes in oF activity, which is inhibited by SpoIIAB [12, 13], but then released by SpoIIAA, the antagonist of SpoIIAB [13]. It is obvious that there are controls at transcription: post-transcription, translation, and post-translation levels. In B subtilis, there exist at lea~t nine different sigma factors in phage-uninfected cells [6]. It was previously proposed that developmental gene expression during sporulation is controlled by cascade of sigma factors [5]. It is now well established that the program of sporulation gene expression is largely governed by the regulated appearance of new sigma factors in the following dependent order: oa --> oF --> aE --> Ot:; --> OK [7]. One of these, oF, is encoded by the spollAC (or sigF) gene. The spollAC gene is the promoter-distal gene of the tricistron operon in B subtilis called spollA, the promoter-proximal cistrons being spollAA and spollAB [14, 15]. Strains mutated in spollAC
696 form aberrantly septated sporangia that are either disporic or multiseptate cells, which suggests that o F is required for the transcription of genes involved in forespore engulfment [16]. Recently, Partridge et al [12] have shown by using an inducible promoter to activate spollA expression in vegetative cells, that oF itself is necessary and sufficient to direct spolllG (o~3) transcription. Their results also indicated that another function of o F (independent of its sigma factor function) is the processing of o E. The work of Schmidt et ai [13] has shown that S p o l I A A is an antagonist o f S p o I I A B and that SpoIIAB is, in turn, an antagonist of SpolIAC. They speculated that the S p o l I A A / S p o I I A B / S p o l I A C regulatory system could play a role in controlling the timing and/or the location (the forespore chamber of the sporangium) for oF-directed gene expression. Interestingly, Margolis et al [17] have shown that o F is only active in the forespore, yet is required for the processing o f o E in the mother cell. Thus, the spollA operon is o f great interest and of central importance because it helps to govern the transition from a single cell to a sporangium consisting of two cellular compartments with different developmental fates. Since B megaterium is very efficient at both sporulation and germination, it is well suited for the studies of sporulation and has been used extensively for biochemical analysis of both sporulation and germination (for review see [18]). It is also a more divergent species from B subtilis and B iicheniformis [19] so that a study of sporulation in this species provides a unique opportunity to also compare sporulation among Bacillus species. The information that emerges from the comparison should be very useful in elucidating conserved (and thus critical) regulation of sporulation and in understanding the evolution of sporulation. In the past few years, we have developed genetic techniques in this species and have isolated several mutants by transposon-mediated mutagenesis [20]. We have characterized several Tn917-1acZ fusion spo mutants [21 ] and showed by electron microscopy that one of these, spo-58, formed aberrant multiple spore septa and expressed ~-galactosidase activity at approximately to. We report here the cloning and sequencing of the spo-58 gene as well as the entire B megaterium spollA operon. The gene organization, expression, and the predicted amino acid sequences of the operon are then compared with those of B subtilis and B licheniformis. M a t e r i a l s a n d methods Strains and plasmids All B megaterium strains used in this study were derived from QM B1551 (ATCC 12872). PV361 (plasmidless, wild-type) was constructed by curing all seven resident plasmids (p-T)
[20]. PV447 (p-7 lac-3 iac-6) is a Lac- derivative of PV361 120]. PV510 (p-7 iac-3 lac-6 spo-58::Tn917-1acZ-cat) was constructed by selecting a Tn917-1acZ-cat fusion insertion spo mutant in PV447 and was used to isolate genomic DNA for cloning spollA mutant gene [21]. E coli strain TGI [supE hsdD5 thi (Alac-proAB)/F'(traD36 proA+B+ laciq lacZ AMI5)] (a gift from J Rapoport, Institute Pasteur) was used as host. Integratior~al plasmid pJHl02 was provided by JA Hoch (Scripps Clinic). Media LB (Luria-Bertani) medium [22] was used for plasmid isolation and growing E coli for transformation. M9 medium [23] with 25 ~tg/ml of thiamine was used for maintaining TGI with its F'. B megaterium strains were grown in supplemented nutrient broth (SNB) medium, described previously [24]. Antibiotic concentrations were 5 ttg/ml erythromycin, 250 I.tg/ml lincomycin (MLS), 50-100 I.tg/ml ampicillin, and 4 I.tg/ml chloramphenicoi. Nucleic acid isolation The miniscreen procedure of Kawamura et ai [25], a modification of the Birnboim and Doly procedure [26], was used to isolate small amounts of plasmid DNA. Larger-scale plasmid DNA preparation was done by the method of Birnboim and Doly [26]. The method of Bovre and Szybalski [27] was used to isolate B megaterium genomic DNA. RNA was prepared by the method of Wu et ai [40] with the following modifications. PV361 was grown in SNB broth at 30°C with shaking at 300 rpm. The time when growth deviated from exponential at ODt,60 was designated as to. PV361 cultures (60 ml) taken from to to t5 were harvested by centrifugation in centrifuge bottles containing a half volume (30 ml) of semi-frozen IX Spizizen salts [29] and RNA was isolated by the method of T Henkin (personal communication). Cells were disrupted by vortexing with glass beads in the presence of vanadyl ribonucleoside complexes [30] (BRL) to inhibit RNAase activity. Finally, RNA was resuspended in diethylpyrocarbonate-treated water (0.1% by volume), and RNasin (1301, Promega) was added to the final concentration of 2 U per ~tl. Nucleic acid hybridization The method of Grunstein and Hogness [31] was followed for colony hybridization using Nylon-I (BRL) or 85-mm nitrocellulose circles (Schleicher and Schuell). Prehybridization was done according to the protocol from Amersham. Hybridization was carried out in the same solution as above, with the addition of DNA probe labeled by random priming (BRL) using [tx-32p] dATP. Hybridization was carded out for at least 12 h at 65°C. Filters were then washed twice in 2 × SSC, 15 min each time, once in 2 x SSC with 0. ! % SDS for 30 min, and finally in 0.1 x SSC for 10 min. For autoradiography, the filters were wrapped in Saran wrap and exposed to Kodak XAR-film with intensifying screen (DuPont Lightning Plus) at -70°C for the desired time. Transfer hybridizations were done by the alkaline capillary blotting method of Reed and Mann [32]. The method of Ausubel et al [33] was used for Northern hybridizations with the following modifications. About 10 ~tg of RNA from each sample was loaded into a 1.2% agarose denaturing gel containing 37% formaldehyde, with an RNA ladder (0.24-9.5 kb, BRL) as a size marker. Transfer to Hyband-N+ nylon membrane (Amersham) instead of a nitrocellulose membrane was carded out in 20 x SSC overnight.
697 Prehybridization was at 65°C as described for colony hybridizations.
DNA manipulation Restriction enzymes were purchased from IBI, BRL or Boehringer Mannbeim and were used as recommended by the suppliers. Restriction DNA fragments were recovered from agarose gels by electroelution (IBI). The Random Primers DNA Labeling System (BRL) was used to radioactively label probes. The Stratagene Klenow Fill-in Kit was used to make blunt ends of insert or vector DNA which had 5'-overhangs. Dephosphorylation of vector DNA was carded out as described by Sambrook et al [23] using calf intestine alkaline phosphatase (Boehringer Mannheim). Ligation reactions were done using T4 DNA ligase (BRL) in 20 I.d volume at 12.5°C overnight with a 1:3 molar ratio of vector:insert DNA and 2 lal of T4 ligase.
The wild-type gene was then cloned by probing with the 1.64-kb AvaI-HindIII fragment from pYP4 (containing B megaterium D N A plus 10 bases from the distal end of Tn917). Southern hybridization and autoradiography of HindIII-digested PV361 genomic DNA identified a 3.34-kb band (data not shown). The fragments were recovered and ligated to pUC18 cut with HindIII and transformed into TG1. Among 475 white ampr colonies tested, two hybridized with the probe. Restriction analysis and Southern hybridization showed that one of them (termed pYPS, see fig 1 ) had the correct size insert (3.34 kb). The promoter region was subcloned by ligating a 0.7-kb HindIII-EcoRI fragment from pYP5 to HindIII-EcoRI digested pUC 19 to yield pYP9 (fig 1).
Transformations
Complementation analysis
E coli competent cells and transformation were as described by Sambrook et al [23]. The PEG-mediated protoplast transfor-
In order to prove that the correct gene had been cloned, the genes on the 3.34-kb fragment were introduced into the spo-58 mutant to see if it would complement the mutation. The 3.34-kb HindIII fragment was treated with PolI, Klenow fragment to generate blunt ends, and the fragment was cloned into pJM 102 cut with Sinai to yield pYP10. Vector p J M l 0 2 was constructed as an integrational plasmid in B subtilis (J Hoch, M Perego, personal communication). It has the ability to replicate autonomously in E coli, but not in Bacillus and contains a cat gene which can be selected in Bacillus. Plasmid p Y P I 0 (about 10 t.tg) was used to transform the spo-58 mutant (PVSI0). Four colonies were recovered on SNB containing 4 ~tg/ml Cm and were streaked and incubated on the same medium. After 24 h incubation, about 80% became free spores while no spores were detected in the mutant strain PV510 grown under the same conditions (but with MLS for maintaining Tn917). Therefore, the result verified genetically that the 3.34-kb fragment contains a region complementing the spo-58 mutant.
mation method of Von Tersch and Carlton [34] was used for megaterium except that cells were regenerated on non-selective RHAF plates overnight at 30°C, then replicated to SNB plus selective antibiotic plates. Transformants were seen after 24 h incubation at 30°C.
B
Doume-sirunued DNA sequencing The Sequenase version 2.0 (USB) protocol for dideoxysequencing was followed. After beat-denaturation, samples were loaded into sequencing gels containing 6% polyacrylamide or 5% 'Long Ranger' (AT Biochem, Malvern, PA) with 8.3 M urea. Electrophoresis was carried out in 1 x TBE buffer (0.1 M Tris base, 0.1 M boric acid, 2 mM Na2EDTA, pH 8.3). Primers were synthesized on an oligonucleotide synthesizer (ABI PCR-Mate). Results
Cloning of the B megaterium spollA genes We took advantage of the Tn917 insertion in spo-58 to clone the mutant gene by probing with a HindIlI-Aval fragment containing about 1 kb of the distal end of T n g 1 7 from plasmid p T V I [35]. Total chromosomal D N A from strain PV510 was cut with HindIII and hybridization with the probe gave a band of approximately 2.6 kb. HindIII-fragments in the 2.0-2.9 kb range were then recovered by electroelution, tested by dot hybridization, and ligated to HindIII-cut pUCI 8. E coli T G I competent cells were transformed and plated on LB amp X-gal plates. About 210 white ampr colonies were then tested by colony hybridization and two hybridized strongly with the original Tn917 probe. Restriction analysis and Southern hybridization showed that these two colonies had the correct insert (data not shown). One clone was saved as plasmid pYP4 (fig 1). This 2.6 kb insert consisted of about 1 kb from the Tn917-distal end and 1.6 kb from the spo-58 mutant downstream of the Tn917 insertion.
[
pYP9
I
F
,,,c
pYP5 Hill
I
RV RI
I I
I
pYP4-r
I I v,,
BII
HI
I
I
n
Iv,D] Sl
PI
Hill
I
I
I
I
1 ,500~
,
. i ~ ,iIP qlI
I !
Fig 1, Plasmids pYP4, pYP5 and pYP9. The solid triangle indicates the Tn917 insertion in spo-58. The bars indicate the two probes used in Northern hybridization (fig 4). Restriction sites are indicated as Cl (ClaD, HI (HgiAl), HIII (HindIII), RV (EcoRV), RI (EcoRI), BII (BgaIII), SI (Stul), PI (Pstl).
698 --
O&
box
GATATCGATGCTGCTTCTTGGTGGAAGATATTC~AACGTACATTCTCTATTTTCTCT~AAA~ATCTTAA~CAGCTAA%TGTGA~GA~ATAGAACTAGTTT 100 t
t
*
*
*
.
*
*
t
-35 zeg£oa -10 zQg£on rbs TGTCGGTGAGAAGGATT~TATT~TGTCGGCAGCGAkAGACTGACTATA~GATTTCCGAC~A~TTTGTATAGT~AGTCTTTCGATTGAATT~GAATTCAA 200 AC~AG~TGTCTTGTTGGTTCGATTAACAGGAG~ATTAGAT~ATCATACGGCAG~G~GCTAAGA~GC~%ATCACCGAAGCGATAGAGAAGGAATCT~TC 300 AGcC•TTTGATTTTAAATTTACAGCATTTAACCTTTATG••CA•CTCTGGCTTGGGGGTTATTTT•GGGAGATACAAAC•GGTTCATAATAACGGCGGGG t
t
*
.
.
.
.
~
400
t
AAATGGTTGTATGCGCTATTTCTCCTGCCATAGAACGTTTGTTTAATATGTCAGGCTTATTTAAAATTATTCGTTTTGAACCTAATGAAGCAAACGCG~T 500 TCAAAAATTGGGGGTGGCATAAT•AAAAATCAAATGAACCTCCAATTTTCCGCGCTCAGTCAAAATGAATCGTTTGCTCGCGTCACGGTAGCATCATTTA 600 TTACGCAGTTAGATCCAACAATGGATGAGTTAACAGAAATTAAAACAGTCGTATCTGAAGCAGTAACAAATGCTATTATTCACGGCTACGAAAGCAATTC 700 GGATGGCGTGGTATATATTTCTGTGACGCTTCATGAAGACGGTGTAGTCGAGCTGATGATTCGTGATGAAGGAATTGGTATCGATAACGTGGATGAAGCC 800 AA•CAGCCTTTATACACAACGAAACCAGATCTAGAACGTTCTGGAATGGGTTTCACCATAATGGAAAACTTTATGGACGAAATTCGAGTGGAGTCTACTG 900 rb. TATTAGAAGGTACGACCTTATATTTAAAAAAGCACTTAACAAATAGTAAAGCGCTATGTAATTAAGGAGACTTGCCAATGGATGTGGAGGTCAAAAAAAA 1000 TAAAAACGAACCGTATTTA~GGATCATGAAGTTAAAGACCTCATCAAGCGCAGTCAGCAAGGTGATCAAATTGCACGAGATACAATCGT~ABAAAAAT
II00
AT~G~CTCGTTT~TCGGTTGTTC~CGTTTTATTAACcGTGGTTAT~AGCCCGATGATTTATTTCAAATT~AT~TATA~G~CTATTAAAGTCCGTT~
1200
ATAAATTTGACTTATC~TAT~AT~TTAAATTTTCAA~ATAT~CTGTTCCAATGATTATTGGTGAAATTCAG~ATTTATTC~T~AT~AT~CAC~TAAA
1300
~QTTA~CC~TTCTCT~AAA~AAAT~A~CAATAAAATAC~TAAA~CAAAAQAC~A~CTTTCCAAATTACTT~QAC~c~TCCCTACA~TC~CTQA~QTTQ~A 1400 GAACATTTG~ATCTCACTCCTGAAGAA~TAGTGCTAGCTCAAGAAGCTAATCGT~CTCCTTC~TCTATTCACGA~ACCGTCTAT~AAAAT~AT~A~ATC
1500
CAATTACCC;TCTTGACCA~A TTGCTGAT;ATACGGAAG;GAAGTGGTT;GA TAAAATT;CCTTAAAAGIAGCAATTGAIGAACTTGAT:AGCGTGAAAA 1600 W
•
W
W
W
t
~
.
.
ATCTTAAAACAAATGAAGCTGCATATGAATGATACGTAATACT~AAGAAGCAATCCGTTTTGCTATTCAGAAGAATAGTGAAACGGATTGCTTTTTTTAT t
,
20 n~ box
.
-35
,
.
zegion
>>>>>>>>>>>>>>>>>>>
-10
zegion
695
Cloning and sequencing of the Bacillus megaterium spollA operon YP Tao**, DSS Hudspeth, PS Vary* Department of Biological Sciences, Northern Illinois University,Dekaib, IL 60115, USA (Received 5 January 1992: accepted 20 February 1992)
Summary - - The spollA operon of Bacillus megaterium has been cloned and the nucleotide sequence determined. The spoliA sequence contains three open reading frames coding for putative proteins of 116 aa, 147 aa, and 253 aa; the first and the third genes are preceded by a ribosomal binding site. The genes are in the same order as those of B subtilis and B licheniformis. The deduced amino acid sequences of these three open reading frames show 78-92% homology with SpolIAA, SpolIAB and SpolIAC of B subtilis and B licheniformis. Northern hybridization revealed that B megaterium also has two spollA transcripts, 1.77 kb and 2.92 kb, auaining maximum expression at t~ and t3, respectively. In addition, homology to a possible penicillin binding protein gene upstream and the first part of a spoVA operon downstream has been identified on the 3.34-kb fragment. The spollA and the downstream spoVA promoter regions are highly conserved among these three species. Sequence analysis of the spoVA promoter revealed a region upstream to the -35 that is highly conserved across Bacillus species.
Bacillus megaterium / sporulation / spollA / spoVA / pbp
Introduction Cells of the Gram-positive genus Bacillus can differentiate into dormant spores upon nutrient deprivation [ 1, 2]. This process of spore formation in Bacillus provides a relative simple experimental system for use in the study of cellular development and differentiation. Sporulation is divided into six or seven distinct morphological stages and involves the coordinated expression of at least 50 spo loci [3, 4]. Many of the spo genes have now been cloned and sequenced, and the function of their gene products is beginning to be understood. Several mechanisms have been found to be involved in the complex regulation of these genes. For example, sequential appearance of new sigma factors that bind to core enzyme and confer different promoter specificity allows transcription of new sets of sporulation genes [5-7]. A second mechanism is the release of spo genes through a two-component system from the repressive effects of a repressor such as AbrB [8]. Increase of sigma factor concentration *Correspondence and reprints **Present address: Waksman Institute of Microbiology, Rutgers University, Piscataway, NJ 08854, USA. Abbreviations: bp, pase pair(s); X-gal, 5-bromo-4-chloro-3indolyl-[~-D-galacto pyranoside; IPTG, isopropyl-~-D-thiogalactopyranoside; rbs, ribosomal-binding site(s); PBP, penicillin-binding proteins; ORF, open reading frame; PG, peptidoglycan; aa, amino acid(s).
during sporulation is a third mechanism. For example, o H increases five-fold in stationary phase from vegetative phase levels because of increased translation or stability of the spoOH mRNA and decreased turnover of o H [9]. Auxiliary factors other than sigma factors can serve as activators or repressors of transcription such as the 'switch protein' SpoIIID [10], which is a transcriptional activator of the spolVCB promoter, but is also a repressor of cotA and corD genes. Other regulatory mechanisms include the activation of sigma factors or processing of pro-o factors into mature forms. Examples are oK and oE processing [11], as well as changes in oF activity, which is inhibited by SpoIIAB [12, 13], but then released by SpoIIAA, the antagonist of SpoIIAB [13]. It is obvious that there are controls at transcription: post-transcription, translation, and post-translation levels. In B subtilis, there exist at lea~t nine different sigma factors in phage-uninfected cells [6]. It was previously proposed that developmental gene expression during sporulation is controlled by cascade of sigma factors [5]. It is now well established that the program of sporulation gene expression is largely governed by the regulated appearance of new sigma factors in the following dependent order: oa --> oF --> aE --> Ot:; --> OK [7]. One of these, oF, is encoded by the spollAC (or sigF) gene. The spollAC gene is the promoter-distal gene of the tricistron operon in B subtilis called spollA, the promoter-proximal cistrons being spollAA and spollAB [14, 15]. Strains mutated in spollAC
696 form aberrantly septated sporangia that are either disporic or multiseptate cells, which suggests that o F is required for the transcription of genes involved in forespore engulfment [16]. Recently, Partridge et al [12] have shown by using an inducible promoter to activate spollA expression in vegetative cells, that oF itself is necessary and sufficient to direct spolllG (o~3) transcription. Their results also indicated that another function of o F (independent of its sigma factor function) is the processing of o E. The work of Schmidt et ai [13] has shown that S p o l I A A is an antagonist o f S p o I I A B and that SpoIIAB is, in turn, an antagonist of SpolIAC. They speculated that the S p o l I A A / S p o I I A B / S p o l I A C regulatory system could play a role in controlling the timing and/or the location (the forespore chamber of the sporangium) for oF-directed gene expression. Interestingly, Margolis et al [17] have shown that o F is only active in the forespore, yet is required for the processing o f o E in the mother cell. Thus, the spollA operon is o f great interest and of central importance because it helps to govern the transition from a single cell to a sporangium consisting of two cellular compartments with different developmental fates. Since B megaterium is very efficient at both sporulation and germination, it is well suited for the studies of sporulation and has been used extensively for biochemical analysis of both sporulation and germination (for review see [18]). It is also a more divergent species from B subtilis and B iicheniformis [19] so that a study of sporulation in this species provides a unique opportunity to also compare sporulation among Bacillus species. The information that emerges from the comparison should be very useful in elucidating conserved (and thus critical) regulation of sporulation and in understanding the evolution of sporulation. In the past few years, we have developed genetic techniques in this species and have isolated several mutants by transposon-mediated mutagenesis [20]. We have characterized several Tn917-1acZ fusion spo mutants [21 ] and showed by electron microscopy that one of these, spo-58, formed aberrant multiple spore septa and expressed ~-galactosidase activity at approximately to. We report here the cloning and sequencing of the spo-58 gene as well as the entire B megaterium spollA operon. The gene organization, expression, and the predicted amino acid sequences of the operon are then compared with those of B subtilis and B licheniformis. M a t e r i a l s a n d methods Strains and plasmids All B megaterium strains used in this study were derived from QM B1551 (ATCC 12872). PV361 (plasmidless, wild-type) was constructed by curing all seven resident plasmids (p-T)
[20]. PV447 (p-7 lac-3 iac-6) is a Lac- derivative of PV361 120]. PV510 (p-7 iac-3 lac-6 spo-58::Tn917-1acZ-cat) was constructed by selecting a Tn917-1acZ-cat fusion insertion spo mutant in PV447 and was used to isolate genomic DNA for cloning spollA mutant gene [21]. E coli strain TGI [supE hsdD5 thi (Alac-proAB)/F'(traD36 proA+B+ laciq lacZ AMI5)] (a gift from J Rapoport, Institute Pasteur) was used as host. Integratior~al plasmid pJHl02 was provided by JA Hoch (Scripps Clinic). Media LB (Luria-Bertani) medium [22] was used for plasmid isolation and growing E coli for transformation. M9 medium [23] with 25 ~tg/ml of thiamine was used for maintaining TGI with its F'. B megaterium strains were grown in supplemented nutrient broth (SNB) medium, described previously [24]. Antibiotic concentrations were 5 ttg/ml erythromycin, 250 I.tg/ml lincomycin (MLS), 50-100 I.tg/ml ampicillin, and 4 I.tg/ml chloramphenicoi. Nucleic acid isolation The miniscreen procedure of Kawamura et ai [25], a modification of the Birnboim and Doly procedure [26], was used to isolate small amounts of plasmid DNA. Larger-scale plasmid DNA preparation was done by the method of Birnboim and Doly [26]. The method of Bovre and Szybalski [27] was used to isolate B megaterium genomic DNA. RNA was prepared by the method of Wu et ai [40] with the following modifications. PV361 was grown in SNB broth at 30°C with shaking at 300 rpm. The time when growth deviated from exponential at ODt,60 was designated as to. PV361 cultures (60 ml) taken from to to t5 were harvested by centrifugation in centrifuge bottles containing a half volume (30 ml) of semi-frozen IX Spizizen salts [29] and RNA was isolated by the method of T Henkin (personal communication). Cells were disrupted by vortexing with glass beads in the presence of vanadyl ribonucleoside complexes [30] (BRL) to inhibit RNAase activity. Finally, RNA was resuspended in diethylpyrocarbonate-treated water (0.1% by volume), and RNasin (1301, Promega) was added to the final concentration of 2 U per ~tl. Nucleic acid hybridization The method of Grunstein and Hogness [31] was followed for colony hybridization using Nylon-I (BRL) or 85-mm nitrocellulose circles (Schleicher and Schuell). Prehybridization was done according to the protocol from Amersham. Hybridization was carried out in the same solution as above, with the addition of DNA probe labeled by random priming (BRL) using [tx-32p] dATP. Hybridization was carded out for at least 12 h at 65°C. Filters were then washed twice in 2 × SSC, 15 min each time, once in 2 x SSC with 0. ! % SDS for 30 min, and finally in 0.1 x SSC for 10 min. For autoradiography, the filters were wrapped in Saran wrap and exposed to Kodak XAR-film with intensifying screen (DuPont Lightning Plus) at -70°C for the desired time. Transfer hybridizations were done by the alkaline capillary blotting method of Reed and Mann [32]. The method of Ausubel et al [33] was used for Northern hybridizations with the following modifications. About 10 ~tg of RNA from each sample was loaded into a 1.2% agarose denaturing gel containing 37% formaldehyde, with an RNA ladder (0.24-9.5 kb, BRL) as a size marker. Transfer to Hyband-N+ nylon membrane (Amersham) instead of a nitrocellulose membrane was carded out in 20 x SSC overnight.
697 Prehybridization was at 65°C as described for colony hybridizations.
DNA manipulation Restriction enzymes were purchased from IBI, BRL or Boehringer Mannbeim and were used as recommended by the suppliers. Restriction DNA fragments were recovered from agarose gels by electroelution (IBI). The Random Primers DNA Labeling System (BRL) was used to radioactively label probes. The Stratagene Klenow Fill-in Kit was used to make blunt ends of insert or vector DNA which had 5'-overhangs. Dephosphorylation of vector DNA was carded out as described by Sambrook et al [23] using calf intestine alkaline phosphatase (Boehringer Mannheim). Ligation reactions were done using T4 DNA ligase (BRL) in 20 I.d volume at 12.5°C overnight with a 1:3 molar ratio of vector:insert DNA and 2 lal of T4 ligase.
The wild-type gene was then cloned by probing with the 1.64-kb AvaI-HindIII fragment from pYP4 (containing B megaterium D N A plus 10 bases from the distal end of Tn917). Southern hybridization and autoradiography of HindIII-digested PV361 genomic DNA identified a 3.34-kb band (data not shown). The fragments were recovered and ligated to pUC18 cut with HindIII and transformed into TG1. Among 475 white ampr colonies tested, two hybridized with the probe. Restriction analysis and Southern hybridization showed that one of them (termed pYPS, see fig 1 ) had the correct size insert (3.34 kb). The promoter region was subcloned by ligating a 0.7-kb HindIII-EcoRI fragment from pYP5 to HindIII-EcoRI digested pUC 19 to yield pYP9 (fig 1).
Transformations
Complementation analysis
E coli competent cells and transformation were as described by Sambrook et al [23]. The PEG-mediated protoplast transfor-
In order to prove that the correct gene had been cloned, the genes on the 3.34-kb fragment were introduced into the spo-58 mutant to see if it would complement the mutation. The 3.34-kb HindIII fragment was treated with PolI, Klenow fragment to generate blunt ends, and the fragment was cloned into pJM 102 cut with Sinai to yield pYP10. Vector p J M l 0 2 was constructed as an integrational plasmid in B subtilis (J Hoch, M Perego, personal communication). It has the ability to replicate autonomously in E coli, but not in Bacillus and contains a cat gene which can be selected in Bacillus. Plasmid p Y P I 0 (about 10 t.tg) was used to transform the spo-58 mutant (PVSI0). Four colonies were recovered on SNB containing 4 ~tg/ml Cm and were streaked and incubated on the same medium. After 24 h incubation, about 80% became free spores while no spores were detected in the mutant strain PV510 grown under the same conditions (but with MLS for maintaining Tn917). Therefore, the result verified genetically that the 3.34-kb fragment contains a region complementing the spo-58 mutant.
mation method of Von Tersch and Carlton [34] was used for megaterium except that cells were regenerated on non-selective RHAF plates overnight at 30°C, then replicated to SNB plus selective antibiotic plates. Transformants were seen after 24 h incubation at 30°C.
B
Doume-sirunued DNA sequencing The Sequenase version 2.0 (USB) protocol for dideoxysequencing was followed. After beat-denaturation, samples were loaded into sequencing gels containing 6% polyacrylamide or 5% 'Long Ranger' (AT Biochem, Malvern, PA) with 8.3 M urea. Electrophoresis was carried out in 1 x TBE buffer (0.1 M Tris base, 0.1 M boric acid, 2 mM Na2EDTA, pH 8.3). Primers were synthesized on an oligonucleotide synthesizer (ABI PCR-Mate). Results
Cloning of the B megaterium spollA genes We took advantage of the Tn917 insertion in spo-58 to clone the mutant gene by probing with a HindIlI-Aval fragment containing about 1 kb of the distal end of T n g 1 7 from plasmid p T V I [35]. Total chromosomal D N A from strain PV510 was cut with HindIII and hybridization with the probe gave a band of approximately 2.6 kb. HindIII-fragments in the 2.0-2.9 kb range were then recovered by electroelution, tested by dot hybridization, and ligated to HindIII-cut pUCI 8. E coli T G I competent cells were transformed and plated on LB amp X-gal plates. About 210 white ampr colonies were then tested by colony hybridization and two hybridized strongly with the original Tn917 probe. Restriction analysis and Southern hybridization showed that these two colonies had the correct insert (data not shown). One clone was saved as plasmid pYP4 (fig 1). This 2.6 kb insert consisted of about 1 kb from the Tn917-distal end and 1.6 kb from the spo-58 mutant downstream of the Tn917 insertion.
[
pYP9
I
F
,,,c
pYP5 Hill
I
RV RI
I I
I
pYP4-r
I I v,,
BII
HI
I
I
n
Iv,D] Sl
PI
Hill
I
I
I
I
1 ,500~
,
. i ~ ,iIP qlI
I !
Fig 1, Plasmids pYP4, pYP5 and pYP9. The solid triangle indicates the Tn917 insertion in spo-58. The bars indicate the two probes used in Northern hybridization (fig 4). Restriction sites are indicated as Cl (ClaD, HI (HgiAl), HIII (HindIII), RV (EcoRV), RI (EcoRI), BII (BgaIII), SI (Stul), PI (Pstl).
698 --
O&
box
GATATCGATGCTGCTTCTTGGTGGAAGATATTC~AACGTACATTCTCTATTTTCTCT~AAA~ATCTTAA~CAGCTAA%TGTGA~GA~ATAGAACTAGTTT 100 t
t
*
*
*
.
*
*
t
-35 zeg£oa -10 zQg£on rbs TGTCGGTGAGAAGGATT~TATT~TGTCGGCAGCGAkAGACTGACTATA~GATTTCCGAC~A~TTTGTATAGT~AGTCTTTCGATTGAATT~GAATTCAA 200 AC~AG~TGTCTTGTTGGTTCGATTAACAGGAG~ATTAGAT~ATCATACGGCAG~G~GCTAAGA~GC~%ATCACCGAAGCGATAGAGAAGGAATCT~TC 300 AGcC•TTTGATTTTAAATTTACAGCATTTAACCTTTATG••CA•CTCTGGCTTGGGGGTTATTTT•GGGAGATACAAAC•GGTTCATAATAACGGCGGGG t
t
*
.
.
.
.
~
400
t
AAATGGTTGTATGCGCTATTTCTCCTGCCATAGAACGTTTGTTTAATATGTCAGGCTTATTTAAAATTATTCGTTTTGAACCTAATGAAGCAAACGCG~T 500 TCAAAAATTGGGGGTGGCATAAT•AAAAATCAAATGAACCTCCAATTTTCCGCGCTCAGTCAAAATGAATCGTTTGCTCGCGTCACGGTAGCATCATTTA 600 TTACGCAGTTAGATCCAACAATGGATGAGTTAACAGAAATTAAAACAGTCGTATCTGAAGCAGTAACAAATGCTATTATTCACGGCTACGAAAGCAATTC 700 GGATGGCGTGGTATATATTTCTGTGACGCTTCATGAAGACGGTGTAGTCGAGCTGATGATTCGTGATGAAGGAATTGGTATCGATAACGTGGATGAAGCC 800 AA•CAGCCTTTATACACAACGAAACCAGATCTAGAACGTTCTGGAATGGGTTTCACCATAATGGAAAACTTTATGGACGAAATTCGAGTGGAGTCTACTG 900 rb. TATTAGAAGGTACGACCTTATATTTAAAAAAGCACTTAACAAATAGTAAAGCGCTATGTAATTAAGGAGACTTGCCAATGGATGTGGAGGTCAAAAAAAA 1000 TAAAAACGAACCGTATTTA~GGATCATGAAGTTAAAGACCTCATCAAGCGCAGTCAGCAAGGTGATCAAATTGCACGAGATACAATCGT~ABAAAAAT
II00
AT~G~CTCGTTT~TCGGTTGTTC~CGTTTTATTAACcGTGGTTAT~AGCCCGATGATTTATTTCAAATT~AT~TATA~G~CTATTAAAGTCCGTT~
1200
ATAAATTTGACTTATC~TAT~AT~TTAAATTTTCAA~ATAT~CTGTTCCAATGATTATTGGTGAAATTCAG~ATTTATTC~T~AT~AT~CAC~TAAA
1300
~QTTA~CC~TTCTCT~AAA~AAAT~A~CAATAAAATAC~TAAA~CAAAAQAC~A~CTTTCCAAATTACTT~QAC~c~TCCCTACA~TC~CTQA~QTTQ~A 1400 GAACATTTG~ATCTCACTCCTGAAGAA~TAGTGCTAGCTCAAGAAGCTAATCGT~CTCCTTC~TCTATTCACGA~ACCGTCTAT~AAAAT~AT~A~ATC
1500
CAATTACCC;TCTTGACCA~A TTGCTGAT;ATACGGAAG;GAAGTGGTT;GA TAAAATT;CCTTAAAAGIAGCAATTGAIGAACTTGAT:AGCGTGAAAA 1600 W
•
W
W
W
t
~
.
.
ATCTTAAAACAAATGAAGCTGCATATGAATGATACGTAATACT~AAGAAGCAATCCGTTTTGCTATTCAGAAGAATAGTGAAACGGATTGCTTTTTTTAT t
,
20 n~ box
.
-35
,
.
zegion
>>>>>>>>>>>>>>>>>>>
-10
zegion
