Joumd of V~r~l~g~ca~ Method, 34 (1991) 149-160 0 1991 Elsevier Science Publishers B.V. 1 All rights reserved/0166-0934/91/$03.50 ADONIS 0166093491004250

149

VIRMET 01215

Competitive polymerase chain reaction assay for quantitation of HIV-I DNA and RNA M. Stieger’, C. Dimolliere’,

L. Ahlborn-Laake2

and J. Mous2

‘~jugnosfic~ D~yisio~and ‘Central Research Units, F. NojTmann-La R&e (Accepted

Ltd., Basel, Switzerland

1 May 1991)

Summary

A qu~u~tative PCR assay for the detection of HIV-I nucleic acids is described. The assay is based on a competitive internal standard nucleic acid which can be discriminated from target sequences by the presence of a new restriction enzyme site. The method was used to quantitate plasmid molecules containing HIV-1 sequences, HIV-1 DNA and HIV-l RNA purified from HIV-l-infected tissue culture cells as well as HIV-l DNA present in the peripheral blood mononuclear cells of an AIDS patient. The assay will be valuable for assessing viral load in AIDS patients and for the study of viral gene expression. Polymerase chain reaction; HIV-l; Quantitative PCR; Virus quanti~cation

Introduction Recently several drugs interfering with the life cycle of the human immunodeficiency virus 1 (HIV-l), the causative agent of the acquired immunode~cien~y syndrome (AIDS) award-Sinoussi et al,, 1983; Gallo et al., 1984), have been discovered (Mitsuya et al., 1990; Roberts et al., 1990). To follow the effect of such drugs on HIV-l replication in AIDS patients, methods are urgently needed to diagnose and quantify accurately HIV-l, Viral load can be measured by cultivating HIV-1 in tissue culture of susceptible cells as described by Ho et al. (1989). The growth of HIV-1 in tissue culture is not Co~re~~~~e~ce to: Basei, Switzerland.

M. Stieger, F. Hoffmann-La Roche Ltd., Diagnostics Division, 205/308, CH-4002

150

adequate for strains of HIV-l that are noncytopathic or slowly replicating (Asjo et al., 1986; Fenyd et al., 1988; Sakai et al., 1988; Ma et al., 1990). Furthermore, the method is time consuming, laborious and expensive. The measurement of levels of the core protein p24 (Goudsmit et al., 1986, 1987), reverse transcriptase activity (Feorino et al., 1987) or the detection of antibodies directed against viral proteins does not directly measure viral load. In addition, these techniques are currently not sensitive enough for measuring the low concentrations of virus present in body fluids of asymptomatic HIV-l carriers. Measurement of the number of CD4+ T-cells (Lifson and Engelman, 1989) or of serum &-microglobulin levels (Hofmann et al., 1990) identify the consequences of HIV-l infection but do not detect the causative agent as such. With the development of the polymerase chain reaction (PCR) it is now possible to detect viral nucleic acids in very low concentrations (Ou et al., 1988; Rogers et al., 1989). Because of sample to sample variability in amplification efficiency, the quantification of target nucleic acids by PCR is not simple. A method is described to quantitate reliably HIV-l nucleic acids by PCR. The method makes use of a competitive internal standard which can be distinguished from the target nucleic acid by the presence of an additional restriction enzyme site. This method is of potential benefit for monitoring the viral load during drug treatment in AIDS patients. In addition, the technique can be used to quantitate viral gene expression during different stages of the disease, thereby increasing the understanding of HIV- 1 pathology. Materials and Methods

Construction of the internal standard A PvuII-Hind111 fragment of the gag gene of HIV-l [nucleotide position 1144-1709 of the HIV-l nucleotide sequence according to Ratner et al. (1985)] was equipped with BamHI linkers on both ends by standard molecular biology techniques (Maniatis et al., 1982) and cloned into the vector pGEM-7Zf( -t ) (Promega, Madison, WI) linearized with BarnHI. The resulting plasmid pGEM-7Zf( +)-gag190 was used to construct the internal standard DNA for the quantitative PCR assay. 10 ng of pGEM-7Zf( + )-gag1 90 DNA were used in two PCR reactions using the following primers: Reaction 1: BJ60 SGGCCCTGCATGCACTAGATCTACTCTATC3 BJ61 S’GACGTCGCATGCTCCTCTAG3’ Reaction 2: BJ69 S’GGAAACAGCTATGACCATG3’ BJ72 rTAGAGTAGATCTAGTGCATGC3 PCR was carried out using the GeneAmp kit (Perkin Elmer Cetus, Norwalk, CT) in a Perkin-Elmer Cetus thermocycler. The following temperature profile was used: denaturation at 95°C for 1 min, annealing at 40°C for 1 min and extension at 72°C for 1 min. A total of 30 cycles were run. 10 ng of the

151

fragments obtained in reactions 1 and 2 were mixed and the resulting mixture was used in an additional PCR amplification with the primers B&l and BJ69. The resulting fragment was digested with Ba~nH1 and cloned into pGEM7Zf( + ) linearized with BarnHI. The resulting plasmid pGEM-7Zf( + )gagl9Omut contains three nucleotide exchanges which create a new BgBI restriction enzyme site if compared to pGEM-7Zf( + )-gag190. The nucleotide sequences of the relevant regions of both plasmids were verified using a Sequenase kit (USB, Cleveland, OH) according to the instructions of the manufacturer. Internal standard RNA

The plasmid pGEM-7Zf( ~)-gagl9~ut was used to synthesize the RNA used as an internal standard in RNA-PCR. 1 pg of plasmid DNA was linearized with Sac1 and used in an in vitro transcription reaction using T7 RNA polymerase and an RNA transcription kit (Stratagene, La Jolla, CA). After RNA transcription, plasmid DNA was eliminated by addition of DNAseI (Pharmacia, Uppsala, Sweden). The number of RNA molecules obtained was quantitated by dot-blot hybridization with the oligonu~leotide BJ81 (SGAT~~CTGGT~GATA~~CT~ATG~ACG3’~. The stren~h of the signal obtained was compared with the one obtained with known amounts of pGEM-7Zf( +)-gagl90mut DNA in the same dot-blot hybridization. The absence of plasmid DNA in the RNA preparation was verified by hybridization with an anti-sense oligonucleotide. RNA was stored at - 20°C in the presence of RNAsin (Promega). extraction ofL)NA and RNA from ~IV-l-infected

cuZture cells

H9 cells chronically infected with HIV-l, HTLV IIIB (Popovic et al., 1984) were maintained in RPMI-1640 medium (Gibco, Gaithersburg, MD) supplemented with 5% fetal calf serum (Amimed, Switzerland), 1 mM sodium pyruvate, 2 mM glutamine, 1 x nonessential amino acids (all from G&co). For the preparation of total DNA, 10 ml of HIV-l-infected H9 cells, or as a control uninfected cells, adjusted to lo6 cells per ml were centrifuged for 5 min at 2000 x g. The cell pellet was washed twice with PBS and subsequently resuspended in 200 ~1 of 10 mM Tris-HCl, pH 8.3, 100 mM KCl, 2.5 mM MgC12. Then 200 ~1 of 10 mM Tris-HCl, pH 8.3, 2.5 mM MgC12, 1% Tween-20, 1% NP-40 and 10 ~1 of a 5 mg/ml solution of proteinase K (Boehringer Mannheim, F.R.G.) were added and the mixture was incubated for 1 h at 56°C. After heat inactivation of the proteinase K at 95°C for 10 min the resulting lysate could be directly used in the polymerase chain reaction.

DNA amplification experiments were carried out with 50 mM KCl, 10 mM

152

Tris-HCl, pH 8.3, 2.5 mM MgCl2, 0.01% gelatin, 0.2 mM of each nucleotide and 50 pmol of the primers SK145 (SAGTGGGGGGACATCAAGCAGCCATGCAAAT3’) and SK43 1 (STGCTATGTCACTTCCCCTTGGTTCTCT3’) and 2.5 U of Taq-polymerase. The reactions were covered with light white mineral oil to prevent evaporation. The cycling conditions were as follows: denaturation at 95°C for 30 s, annealing at 55°C for 30 s and.extension at 72°C for 1 min. A total of 30 cycles was run. Final extension was at 72°C for 10 min. After the amplification, 40 ~1 of the reaction mixture were withdrawn and digested with 10 U of BgliI at 37°C for 1 h. 10 ,LJ of the BglII-digested amplification products were loaded on a 2% agarose gel while the rest was hybridized to a probe oligonucleotide. Amplifications of plasmid DNA contained the number of plasmids indicated in the figures. Amplification of DNA from cell culture contained the DNA extracted from 50 000 cells. Before ampli~cation RNA was first reverse transcribed in 20 ~1of 50 mM KCl, 10 mM Tris-HCI, pH 8.3, 2.5 mM MgC12, 0.01% gelatin, I mM of each nucleotide, 10 U RNAsin, 50 pmol random hexamer and 100 U of M-MLV reverse transcriptase (Gibco). Reverse transcription was carried out at 42°C for 30 min. The enzyme was then heat-inactivated by incubation at 95°C for 5 min. To the tube were then added 80 ~1 of 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 2.5 mM MgCIZ, 0.01% gelatin containing 50 pmol of the primers SK145 and SK431 and 2.5 U of Taq-pofymerase. The cycling parameters were as described above. hybridization

30 ~1 of the BgZII digested amplification products were hybridized with the oligonucleotide probe SK 102 (S’GAGACCATCAATGAGGAAGCTGCAGAATGGGAT3’). The sample was mixed with 9 ~1 of OH-diluent (44 mM EDTA, 66 mM NaCI, pH 8) and 1~1 of oligonucleotide SK102 which had been radioactively labeled by standard techniques (5 x lO’cpm/~l, 107cpm/pmol). The samples were covered with 50 1.11 of light white mineral oil and DNA was denatured by incubation at 95°C for 5 min. Hybridization was allowed to proceed for 15 min at 55°C. 10 ~1 of gel dye marker (2.5 mg/ml bromophenol blue, 250 mg/ml Ficoll400) and 50 ~1 chloroform were added and 25 ~1 of the floating blue foam was loaded on a 10% polyacrylamide gel. The gel was run at 150 V for 2 h and then exposed to X-ray film (Eastman Kodak, Rochester, NY) at -70°C with intensifying screens. Results Verification of the assay principle with plasmid molecules

The principle of the quantitative PCR assay is shown in Fig. 1. Identical amounts of a sample containing a unknown number of target DNA molecules are mixed with different amounts of internal standard DNA. After

153 QUANTITATIVEHIV-PCR ASSAY Primer:

SK145,SK431

Probe:

SK102

[email protected] with

unknown

quantity

of HIV nucleic arid

106

105

104

103

molecules

of lntenwl

-

-

102

10’

standard

QPCR JJ &Ill-digestion

Solution

hybrldisatton,

Gel elertro@wesls

Fig. 1. Principle of the quantitative HIV-PCR assay.

B

C

II

moleculesof internalstandard 1MlJld

Fig. 2. Quantitative HIV-l PCR with mixtures of a plasmid containing the wild-type HIV-l sequence with a plasmid containing the internal standard sequence. A: IO’ molecules; B: IO*molecules; C: IO3molecules; D: lo4 molecules of the wild-type HIV-l sequence. The number of molecules of the internal standard sequence is indicated on top of each lane.

154

amplification the PCR products are digested with BglII, hybridized to the internal probe and resolved by gel electrophoresis. BgflI will only digest PCR products derived from the internal standard. As a result, products amplified from the target DNA can be discriminated from products derived from the internal standard DNA by their size on gels. Identical starting amounts of target and internal standard DNA will give two bands of equal intensity after BglrI digestion and hybridization. An unknown concentration of target DNA can be quantitated by identifying the amount of internal standard DNA which has to be added to obtain two bands of equal intensity after amplification, BgflI digestion, hybridization and gel electrophoresis. The validity of this approach was tested by mixing known amounts of plasmid DNA containing the target sequence with known amounts of plasmid DNA containing the internal standard sequence. As demonstrated in Fig. 2, identical amounts of the two plasmid molecules yield two bands of roughly equal intensity after ampli~cation, Bg&I digestion, hyb~dization and gel ele~trophoresis. Quantification of viral DNA in HIV-l-infected

tissue culture cells

In a subsequent series of experiments the assay principle was used to quantitate the viral DNA content of H9 cells chronically infected with HIV-l. For this purpose DNA from infected cells was mixed with DNA from noninfected H9 cells in different ratios. The DNA extracted from a total of 50000 cells was used for every ampli~cation reaction. First, the viral DNA content of 50 000 HIV-l-infected cells was quantitated. Then the virus-infected cells were diluted tenfold with uninfected cells. The quantification at the bottom of Fig, 3 contained DNA isolated from 5 HIV-l-infected cells in a background of 50 000 noninfected H9 cells. Analysis of the results presented in Fig. 3 indicates that every HIV-l-infected cell contains approximately 60 molecules of viral DNA. The assay quantitates integrated proviral DNA as well as extra~hromosomal proviral genomes. The existence of many copies of extrachromosomal viral DNA in HIV-l-infected cells has already been described in the literature (Pang et al., 1990; Pauza and Singh, 1990). Quantification of HIV-I RNA in HIV-I-iqfected

tissue culture cells

The same principle which was used for the quantification of HIV-I DNA was used for the quanti~cation of HIV-l RNA. Before performing the quantitative PCR assay, RNA derived from HIV-l-infected cells was reverse transcribed. The internal standard RNA used was synthesized by cloning the DNA internal standard behind a promoter recognized by T7 RNA polymerase and producing synthetic RNA with T7 RNA polymerase. The quantitative RNA PCR was used to measure HIV-l RNA in tissue culture cells grown or infected in the presence or absence of an inhibitor of the HIV-l protease (Roberts et al., 1990). Fig. 4A demonstrates that the level of HIV-l RNA is increased by about

1.55

Mcl~ules

of intemat standard

H9/H9-HlVcelki 5x104/5x104

Fig. 3. Quantitative HIV-l PCR with DNA derived from HIV-l-infected tissue culture mixed with uninfected cells in different ratios. Every lane contains the DNA from a total of 50000 cells. Top panel: all 50000 cells were HIV-1 infected; second panel: 5000 HIV-l-infected cells in a total of 50000 cells; third panel: 500 HIV-l-infected cells in 50000 c&s; fourth panek 50 HIV-l-infected cells in 50000 cells; bottom panel: 5 HIV-l-infected cells in 50 000 cells.

fivefold in chronically infected cells grown in the presence of the inhibitor. The different intensities of the wild-type signal in the lanes of the central and right panels are a reflection of the sample to sample variability of reverse transcription and PCR, The use of an internal standard controls the influence of such variables. Probably the protease inhibitor stops the release of mature viral particles from the cells, thereby causing an increase in HIV-1 RNA levels in the chronically infected cells. Fig. 4B shows results obtained with ceils that were acutely infected with HIV-l in the absence or presence of the protease inhibitor. Clearly in the absence of the drug more viral RNA is produced than in its presence in the acutely infected cells. The protease inhibitor leads to an estimated ZOO-fold decrease in viral RNA levels.

156

QUANTITATIVERNA-PCR

2001~~ RNAfrom

Af

H9-cells

-HIV

+HIVa

+HIVa

-31-8959

- 31-8959

+31-8959

200119 RNA from MTkells

6) -HIV

+HfVb

*HI@

-31-8959

-31-8959

+ 31-8959

a~c~ca~l~ hacutely

infected infected

cells

cells

C. 2ng RNA,106molecu(es

internal

standard

Fig. 4. A: H9 cells chronically infected with HIV-I were grown in the absence or presence of the protease inhibitor 3 l-8959 and HIV-I RNA concentrations were determined by quantitative RNA PCR. 200 ng total RNA was used in each panel. Left panel: uninfected H9 cells; middle panel: HIV-l-infected H9 cells; right panel: HIV-l-infected H9 cells grown for 3 days in the presence of 108 nM 318959. B: MT-4 ceils were acutely infected with HIV-I in the absence or presence of 31-8959 and HIV-1 RNA con~ntrations were determined as described above. Left panel: uninfected MT-4 cells; middle panel: MT-4 ceils infected with HIV-I and grown for 3 days; right panel: MT-4 cells infected with HIV-I and grown for three days in the presence of 100 nM 31-8959. Only the first two lanes were loaded.

Quantification of HIV-l DNA in lymphocytes of an AIDS patient After the successful quanti~cation of viral DNA derived from HIV-linfected cell culture, the amount of HIV-l DNA in the peripheral blood mononuclear cells of an AIDS patient at CDC stage IV was determined. The cells were purified by Ficoll centrifugation and the cellular DNA was released

157

A)

Fig. 5. A: Amplification of HIV-l DNA from the l~ph~~es of an AIDS patient. (-) Negative control; ( + ): DNA isolated from l~ph~ytes. Two ampli~cations of the same DNA are shown. B: Quanti~~tion of HIV-l DNA from the lymphocytes of an AIDS patient.

by digestion of the cells with proteinase K. The sample’s capacity for amplification was verified by straight PCR without addition of internal standard DNA (Fig. 5A) as well as by amplification of a fragment from the HLA class II gene (Ehrlich et al., 1989) (data not shown), For quantification of HIV-l DNA copy number the DNA derived from the peripheral blood mononuclear cells in 50 ~1 of blood was mixed with different amounts of internal standard DNA. Analysis of Fig. 53 shows that 50 ,~l of blood contain approximately 40 copies of HIV-l DNA (800 copies per ml of blood). From inspection of the agarose gel it is evident that with the conditions used unspecific bands are amplified from genomic DNA. These bands do not hybridize with the internal oligonucleotide probe and do not interfere with the assay. Discussion

Several methods for quantitating HIV-l nucleic acids have been described. Most of the methods use a standard curve generated with plasmid DNA or HIV-l-infected cells to relate the amount of PCR products to the initial concentration of target DNA (Abbott et al., 1988; Dickover et al., 1990; Oka et al., 1990). A different approach quantitates HIV-l DNA relative to cellular

IS8

sequences (Kellogg et al., 1990). Such an assay is only useful for measuring intracellular DNA, Due to the exponential character of PCR, small sample to sample differences in amplification efficiency will lead to large differences in product yield. In order to exclude the influence of sample to sample variability on the performance of the assay, we used an internal standard for the quantification of target DNA concentration. Quantitative PCR assays using a competitive internal standard that is amplified by the same primers as the target DNA but that contains an altered restriction enzyme site (Becker-Andre and Hahlbrock, 1989; Gilliland et al., 1990) or yields a product of different size (Wang et al., 1989) have been described. We constructed an internal standard DNA containing three base-pair changes in the amplified fragment compared to the original HIV-I sequence (Ratner et al., 1985) which create a new BgfiI restriction enzyme site. The introduction of three base-pair changes minimizes the chance of an occasional HIV-l isolate occurring with a Bg/II site at the same position. The assay was shown to work with HIV-l nucleic acids isolated from HIV-linfected tissue culture cells as well with DNA isolated from clinical material. Analysis of the assay by visual inspection gives semiquantitative results. A more precise analysis is possible by diluting the samples in smaller steps or by analysing the autoradiograms by densitometric screening. Theoretically the assay will not work with occasional HIV-l isolates containing a DNA sequence nonhomologous to the primer sequences used in the PCR. To reduce this possibility, primers from a region of the HIV-l genome which is highly conserved amongst different isolates have been selected. Experiments using plasmid molecules have indicated that the assay is not suitable for target concentrations exceeding 100 000 starting molecules (data not shown). This is due to the fact that at high target concentrations heteroduplex molecules are formed during the last cycles of PCR. These molecules are not digested by Bg/II although one of the strands contains a Bg&I site. The problem can be solved by diluting the sample or by reducing the number of PCR cycles. This assay will be valuable for quantifying intra- as well as extracellular HIV-l DNA or RNA. The use of PCR for measuring plasma viremia will serve as a rapid alternative to virus cultivation, especially for monitoring drug therapy of AIDS patients. Furthermore, quantitative PCR will allow detailed studies of the viral life cycle and gene expression during disease progression. Analogous assays can be envisaged for the investigation and monitoring of any pathogen. References Abbott, M.A., Poiesz, B.J., Byrne, B.C., Kwok, S., Sninsky, J. and Ehrlich, G.D. (1988) Enzymatic gene amplification: qualitative and quantitative methods for detecting proviral DNA amplified in vitro. J. Infect. Dis. 158, 1 IS&1169.

159 Asj8, B., Morfeldt-Manson, L., Albert, J., Biberfeld, G., Karlsson, A., Lidman, K. and Fenyo, E.M. (1986) Replicative capacity of human immunodeticiency virus from patients with varying severity of HIV infection. Lancet 2, 66&662. Barre-Sinoussi, F., Chermann, J.C., Rey, F., Nugeyre, M.T., Chamaret, S., GNeSt, J., Dauguet, C., Axler-Blin, C., Vezinet-Brun, F., Rouzioux, F., Rozenbaum, C. and Montagnier, L. (1983) Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 220, 868-871. Becker-Andre, M. and Hahlbrock, K. (1989) Absolute mRNA quantification using the polymerase chain reaction (PCR). A novel approach by a PCR-aided transcript titration assay (PATTY). Nucleic Acids Res. 17, 9437-9446. Dickover, R.E., Donovan, R.M., Goldstein, E., Dandekar, S., Bush, C.E. and Carlson, J.R. (1990) Quantitation of human immunodeficiency virus DNA by using the polymerase chain reaction. J. Clin. Microbial. 28, 2130-2133. Erhch, H.A., Saiki, R.K. and Gyllensten, U.(1989) HLA class II gene polymorphism: detection, evolution and relationship to disease susceptibility. In: Current communications in molecular biology: polymerase chain reaction, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 125-131. Fenyii, E.M., Morfeldt-Manson, L., Chiodi, F., Lind, B., von Gegerfelt, A., Albert, J., Olausson, E., Asjii, B.J. (1988) Distinct replicative and cytopathic characteristics of human immunodeficiency virus isolates. Virology 62, 44144419. Feorino, P., Forrester, B. and Schable, C. (1987) Comparison of antigen assay and reverse transcriptase assay for detecting human immunodeficiency in culture. J. Chn. Microbial. 25, 23442346. Gallo, R.C., Salahuddin, S.Z., Popovic, M., Shearer, G.M., Kaplan, M., Haynes, B.F., Palker, T.J., Redfield, R., Oleske, J., Safai, B., White, G., Foster, P. and Markham, P.D. (1984) Frequent detection and isolation of cytopathic retroviruses (HTLV-III) from patients with AIDS and at risk for AIDS. Science 224, 50&504. Gilliland, G., Perrin, S., Blanchard, K. and Bunn, H.F. (1990) Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction. Proc. Nat]. Acad. Sci. USA 87, 2725-2729. Goudsmit, J., Paul, D.A. and Lange, J. (1986) Expression of human immunodeficiency virus antigen (HIV-Ag) in serum and cerebrospinal fluid during acute and chronic infection. Lancet 2, 177180. Goudsmit, J., Lange, J., Paul, D. and Dawson, G. (1987) Antigenemia and antibody titers to core and envelope antigens in AIDS, AIDS related complex and subclinical human immunodeficiency virus infection. J. Infect. Dis. 155, 558-560. Ho, D.D., Moudgil, T. and Alam, M. (1989) Quantitation of human immunodeticiency virus type 1 in the blood of infected persons. N. Engl. J. Med., 321, 1621-1625. Hofmann, B., Wang, Y., Cumberland, W.G., Detels, R., Bozorgmehri, M. and Fahey, J.L. (1990) Serum µglobulin level increases in HIV infection; relation to seroconversion, CD4 T-cell fall and prognosis. AIDS 4, 207-214. Kellogg, D.E., Sninsky, J.J. and Kwok, S. (1990) Quantitation of HIV-1 proviral DNA relative to cellular DNA by the polymerase chain reaction. Anal. Biochem. 189, 202-208. Lifson, J.D. and Engelman, E.G. (1989) Role of CD4 in normal immunity and HIV infection. Immunol. Rev. 109, 93-l 17. Ma, X., Sakai, K., Sinangil, F., Golub, E. and Volsky, D.J. (1990) Interaction of a noncytopathic human immunodeficiency virus type 1 (HIV-l) with target cells: efficient virus entry followed by delayed expression of its RNA and protein. Virology 176, 184194. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Mitsuya, H., Yarchoan, R. and Broder, S. (1990) Molecular targets for AIDS therapy. Science 249, 1533-1544. Oka, S., Urayama, K., Hirabayashi, Y., Ohnishi, K., Goto, H., Mitamura, K., Kimura, S. and Shimada, K. (1990) Quantitative analysis of human immunodeticiency virus type 1 DNA in

160 asymptomatic carriers using the polymerase chain reaction. Biochem. Biophys. Res. Commun. 167, 1-8. Ou, C-Y., Kwok, S. and Mitchell, S.W. (1988) DNA amplification for direct detection of HIV-I in DNA of peripheral blood mononuclear cells. Science 239, 2955297. Pang, S., Koyanagi, Y., Miles, S., Wiley, C., Vinters, H.V. and Chen, I.S.Y. (1990) High levels of unintegrated HIV-l DNA in brain tissue of AIDS dementia patients. Nature 343, 85589. Pauza, C.D. and Singh, M. (1990) Extrachromosomal HIV-l DNA in persistently infected U937 cells. AIDS Res. Hum. Retroviruses 6, 1027-1030. Popovic, M., Sarngadharan, M.G., Read, E. and Gallo, R.C. (1984) Detection, isolation and continuous production of cytopathic retroviruses (HTLV-III) from patients with AIDS and preAIDS. Science 224, 4977500. Ratner, L., Haseltine, W., Patarca, R., Livak, K.J., Starcich, B., Josephs, S.F., Doran, E.R., Rafalski, J.A., Whitehorn, E.A., Baumeister, K., Ivanoff, L., Petteway, S.R. Jr., Pearson, M.L., Lautenberger, J.A., Papas, T.S., Ghrayeb, J., Chang, N.T., Gallo, R.C. and Wong-Staal, F. (1985) Complete nucleotide sequence of the AIDS virus, HTLV-III. Nature 313, 277-284. Roberts, N.A., Martin, J.A., Kinchington, D., Broadhurst, A.V., Craig, J.C., Duncan, I.B., Galpin, S.A., Handa, B.K., Kay, J., KrBhn, A., Lambert, R.W., Merrett, J.H., Mills, J.S., Parkes, K.E.B., Redshaw, S., Ritchie, A.J., Taylor, D.L., Thomas, G.J. and Machin, P.J. (1990) Rational design of peptide based HIV proteinase inhibitors. Science 248, 3588361. Rogers, M.F., Ou, C.-Y. and Raytield, M. (1989) Use of the polymerase chain reaction for early detection of the proviral sequences of human immunodeticiency virus in infants born to seropositive mothers. N. Engl. J. Med. 320, 164991654. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn G.T. and Mullis, K.B. (1988) Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 4877491. Sakai, K., Dewhurst, S., Ma, X. and Volsky, D.J. (1988) Differences in cytopathogenicity and host cell range among infectious molecular clones of human immunodeticiency virus type 1 simultaneously isolated from an individual. J. Virol. 62, 40784085. Wang, A.M., Doyle, M.V. and Mark, D.F. (1989) Quantitation of mRNA using the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86, 9717-9721.