Journal of Virological Methods, 39 (1992) 259-268 0 1992 Elsevier Science Publishers B.V. / All rights reserved / 0166-0934/92/%05.00
259
VIRMET 01384
Competitive polymerase chain reaction using an internal standard: application to the quantitation of viral DNA A. Telenti, P. Imboden and D. Germann Institute of Medical Microbiology,
University of Berne, Berne (Switzerland)
(Accepted 22 April, 1992)
Summary
A general strategy for the construction of an internal standard for the polymerase chain reaction (PCR) is described together with its application in the evaluation of clinical samples. This internal standard is a plasmid containing a modified target sequence that is co-amplified with the native target using the same set of primers. The co-amplification reaction will generate two fragments of different size that are readily separated without the need for restriction enzyme digestion. Thereafter, they are detected and quantitated by hybridization to the same probe. Detection of HIV proviral DNA was chosen as a model for this competitive PCR. The assay proved to be a sensitive tool for the detection of PCR inhibitors and allowed quantitation of HIV with a 2030% variation coefficient. Despite limitations that appear inherent to the amplification process, internal standards appear to be useful tools for quantitative analysis by PCR. HIV quantitation; Splicing by overlap extension; Recombinant DNA; Polymerase chain reaction (PCR) internal standard
Introduction
Quantitative analysis by PCR relies usually on external standards (Davis et al., 1990; Genesca et al., 1990; Semple et al., 1991). The use of an internal Correspondence to:
Beme, Switzerland.
Dr. A. Telenti, Institute of Medical Microbiology, Friedbuehlstrasse 51, 3010 Beme,
260
standard (IS) would offer control on the efficiency of the amplification reaction for each individual sample, and therefore, a more precise quantitation (Gilliland et al., 1990; Kellogg et al., 1990). Internal controls appear particularly attractive for PCR because of the multiple steps (amplification, electrophoresis, blotting, hybridization, autoradiography) required for the evaluation of results, and because they may allow the detection of inhibitors of the reaction. Previous reports on internal standards for PCR have focussed on quantitation of RNA via cDNA (Gilliland et al., 1990; Wang et al., 1990), product discrimination by the introduction of new restriction sites (Stieger et al., 1991), or co-amplification of unrelated targets (Kellogg et al., 1990). We describe a strategy for rapid construction of a plasmid that serves as an internal standard for HIV PCR, and its application to the quantitation of proviral DNA in clinical samples from HIV-infected patients. This method can be applied for the construction of other internal standard plasmids for competitive PCR.
Materials and Methods Construction of the internal standard plasmid
The PCR technique ‘gene splicing by overlap extension’ that allows the generation of recombinant DNA constructs without reliance on restriction enzyme sites was used (Horton et al., 1989; 1990). A 500 base pair (bp) fragment of Lambda phage DNA was inserted at a defined location within the HIV-gag proviral sequence. The resulting ‘long’ construct was then cloned into a plasmid. Amplification of this plasmid generates a PCR product that is larger (611 bp) than the product of amplification of a native HIV target (115 bp). Amplification and spkcing Four consecutive PCR reactions followed by a cloning step were necessary for the construction of the IS plasmid (Fig. 1). The process required 6 primer pairs: primers SK38 and SK39 for the amplification of HIV (Ou et al., 1988), Lambda phage primers (Perkin-Elmer Cetus PCR amplification Kit) to generate the fragment of heterologous DNA, and the overlapping primers OLl and 0L2. To allow the splicing, one part of the sequence of these overlapping primers is homologous to lambda and the remaining part to the HIV target (Fig. 1). Their sequences are:
OLl: 5’ cggacacgaactcatctaaatttctcctactggg OL2: 5’ ggctgatttcgataaccagatggataatcctggg (lambda sequence is shown in italics, HIV in bold print). Amplification reactions were carried out in 30 cycles (PCR 1 and 2) and 25 cycles (PCR 3 and 4), respectively; 1.5 min at 94°C 1.5 min annealing at 55°C (PCR l), 50°C
261 HIV
SK38_ \
lambda
CPL
\
\
\ ,
“‘SK39
-.
Tcp?
I
c
(la)
(lb)
fraamont A
fraamont B
-
fragmoat C \
P
-
SK39
1
(3)
. -
SK39
\
\ I
SK39
Cloning Fig. 1. Construction of the internal standard plasmid. Four consecutive PCR reactions are necessary to insert a fragment of heterologous DNA within the HIV-gag sequence. PCR 1. Amplification of fragment A: a 115 bp HIV-gag product, using HIV proviral DNA as target and HIV primers SK38 and SK39 (PCR la), and amplification of fragment B, a 500 bp fragment of phage lambda DNA, using specific lambda primers (PCR lb). PCR 2. Amplifkation of two HIV-lambda overlapping fragments in two independent reactions using fragment A as a target: a 97 bp fragment C is amplified by primers SK39 and 0L2 (PCR 2a, 80 bp from HIV and 17 bp ‘tail’ from lambda), and a 47 bp fragment D is amplified by primers SK38 and OLl (PCR2b, 31 bp from HIV and 16 bp ‘tail’ of lambda). PCR 3. Generation of fragment E: a 580 bp ‘lambda-gag’ fragment is obtained by splicing the overlapping fragment C to the 500 bp lambda fragment B. This reaction can be driven with only one primer. PCR 4. Generation of the final ‘gag-lambda-gag’ fragment F: a 611 bp product is obtained by splicing the second overlapping fragment (D) to the product from PCR 3 (E) using primers SK38 and SK39. PCR 3 and PCR 4 generates accessory products; however, the following cloning step allows the separation and purification of the gag-lambda-gag target.
262
(PCR 2 and 4), or 45°C (PCR 3), and 2 min at 72°C. The composition of the PCR mixture (100 ~1) was: 50 mM KCl, 10 mM Tris-HCl (pH 8.4) 1.5 mM MgClz, 0.01% gelatin, 200 PM each dNTP, and 2.5 U of Cetus AmpliTaq polymerase. Primers were used at a final concentration of 1 ,uM. Cloning Direct cloning of the 611 bp fragment F (gag-lambda-gag) was accomplished by the following steps. a. Klenow reaction to generate blunt ends: 10 ~1 of the reaction PCR 4 (fragment F) were incubated for 15 min at 30°C with 1 unit of Klenow enzyme and 1 ~1 of 50 mM MgC12, and purified by phenol-chloroform extraction and ethanol precipitation (Tabor et al., 1989). b. Ligation: 50 ng of fragment F were blunt-ligated to 200 ng of SmaIdigested plasmid pT7T3 18U (Pharmacia) in a 20 ~1 reaction at 16°C overnight (Scharf et al., 1990). c. Transformation: 4 ~1 of the ligation reaction were incubated with 100 ~1 of competent Escherichiu co/i NM522 (Pharmacia), colonies were selected by bluewhite screening (Sambrook et al., 1989), and the presence of the appropriate insert was established by PCR of single colonies lysed in 0.1% Tween. d. Purification: Plasmids containing the appropriate insert were purified in a separate laboratory to avoid contamination with native amplified gag sequences or gag-containing plasmids. The concentration of plasmid DNA was established by fluorometry and a working stock solution of 6000 copies/p1 was prepared. Final adjustment of the copy number for PCR was done by comparing the amplification signals of the IS to that of dilutions of a cell line containing 1 HIV proviral copy (8A5-LAV, National Institute of Allergy and Infectious Diseases, USA). Performance
experiments
A fixed number of copies of the standard (100 copies) were amplified in the presence of different concentrations of a HIV target (dilutions of a plasmid containing a native gag sequence, or of cell line 8A5-LAV, containing one HIV copy/cell) in order to evaluate the performance of the internal standard plasmid. Experiments were carried out in the presence or absence of 1 ,ug of genomic DNA. After PCR, amplification products were analysed by agarose gel electrophoresis, Southern blot transfer, and hybridization with 32P-labelled oligonucleotide SK19 (Ou et al., 1988). Hybridization signals were evaluated by densitometric scanning (Desaga C60, Heidelberg, Germany), and/or radioanalysis (Ambis radioanalysis system, San Diego, CA, USA). The ratio HIV/IS was calculated from the corresponding peak areas obtained by densitometry, or from cpm values obtained by radioanalysis. Data from triplicate experiments were used to calculate the variation coefficient.
263
Clinical application
DNA was obtained by direct lysis of peripheral mononuclear cells from 31 HIV-infected subjects (Wolinsky et al., 1989), and 42 samples were provided as extracted purified DNA by two other laboratories (courtesy of Dr. L. Perrin and S. Yerly, Cantonal University Hospital, Geneva; and Dr. J. Biini, National Center for Retroviruses, Zurich). DNA (1 pg) was added to each reaction tube. The internal standard was added to the PCR mix immediately prior to aliquoting into the individual reaction vials to ensure optimal and homogeneous distribution of the standard (100 copies/tube). The HIV/IS ratios from 34 patients were correlated with the absolute CD4 cell counts and with CDC clinical stage. Correlations between variables were assessed by the Spearman’s rank coefficient; the Kruskel Wallis test was used for the evaluation of differences among clinical groups.
Results Dilution experiments
Fig. 2 shows the results of the co-amplification of different concentrations of native HIV target and 100 copies of IS. There was a linear relationship between the estimated number of native HIV copies added to the reaction and the HIV/ IS ratios obtained after amplification. Linearity was maintained for the range evaluated (< 10 to 1000 HIV copies); however, competition between both IS and native HIV targets was observed when more than 2500 HIV copies were present during the reaction. Ratio values from HIV dilution experiments carried out in the absence of genomic DNA exhibited an average variation coefficient of 20%. This value increased to 27% when the experiments were performed in the presence of 1 pg of genomic DNA. The addition of 100 copies of IS to the reaction did not prevent the efficient amplification of the low amounts of native target present in dilution experiments (Fig. 2) or in clinical samples (Fig. 3). Clinical samples
For the 77 patient samples evaluated, HIV/IS ratios ranged from ~0.1 to 22.3. CD4 count information was available for 34 patients. Ratio values were greater among 18 patients with CD4 counts below 200 cells/mm3 than among 16 patients with more than 200 CD4 cells/mm3 (mean* SD, 4.6f 4.0 vs. 1.5 + 1.6, P= 0.013), despite depletion of those relevant target cells. Patients in CDC clinical stage IV had greater HIV/IS ratio than those on clinical stage III or II (5.1+ 5.7, 3.1+ 2.1,2.3 + 2.9, respectively); the differences were significant (P=O.O014) after normalizing for the CD4 count (Ratio X lOO/CD4 count). The efficiency of amplification of the IS was used as an indicator for the
264 M
1 2
3
4
5
6
7
8
9 10 II
I
I
HI V-Std
HI V-Sam
._I
10
100 NUMBER
1000
OF HIV COPIES
Fig. 2. Performance of the internal standard in dilution experiments. A. Southern blot analysis of products from the amplification of 500, 250, 125, 62, 31, 16, 8, 4, and 0 copies (lanes 1-9) of a HIV target in the presence of 100 copies of the internal standard (HIV-Std). Lane 10 is a negative HIV and plasmid control. M, molecular weight marker (32P-labelled #X174 HaeIII digest). B. Quantitative evaluation of the Southern blot shown in panel A. A linear relationship is observed between the calculated HIV/IS ratios and the number of HIV copies added to the reaction. The experiment was done in triplicate (three independent amplification reactions), and shown are the mean values and SEM.
presence of inhibitory substances in patient samples. The amplification efficiency of the IS depended on the source of the clinical material: a 19% variation coefficient of the IS peak areas was observed among 17 samples of purified DNA from one laboratory, and up to 53% among the 25 samples of purified DNA from a second reference center. High grade inhibition was
265
WITHOUT STANOARIJ C
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16 17
WITH STANDARD C
Fig. 3. Use of extracted from absence (upper HIV sequences
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16 17
the internal standard with clinical samples. Amplification of HIV sequences from DNA peripheral mononuclear cells of 17 HIV-infected patients. PCR was carried out in the panel) or presence (lower panel) of 100 copies of the internal standard. Detection of native was not significantly altered by the presence of the internal standard. C, Positive HIV and plasmid control.
observed in 2 of 31 samples prepared by simple lysis; and overall, lysates exhibited the greatest variation in IS amplification efficiency. Samples found inhibitory in HIV PCR rendered an adequate amplification signal when evaluated by human fl-globin primers. Dilution of selected samples confirmed the inhibitory characteristics of those DNA preparations (Fig. 4). Discussion
Our experience with the construction and application of an internal standard for HIV PCR showed the feasibility of coamplitication and detection of two
266
,HIV
Fig. 4. Use of the internal standard for the detection of inhibitors of the PCR. This figure illustrates the detection of PCR inhibitors in a patient’s sample despite a satisfactory amplification of human B-globin sequences. Lane 1. The cell lysate equivalent of 1 pg DNA was added to the PCR reaction containing 100 copies of the Internal Standard (IS). The Southern blot demonstrates a weak HIV amplification, and no IS amplification. Lane 2. Dilution of the sample (1:lO) demonstrates the presence of enough inhibition to prevent amplification of 100 copies of target (IS) but not of a larger number of native HIV targets. Lane 3. Further dilution (1:lOO) finally allows the detection of the IS and of HIV. Lane B. Successful amplification of human B-globin target in the undiluted sample despite significant inhibition of the amplification of HIV and IS targets. M, Molecular weight marker.
targets using the same set of primers and probe. In addition, for the assay range evaluated (< 10 to 1000 target copies), there was a linear relationship between the number of target copies added to the IS-containing reaction and the target/ IS ratio obtained after amplification. The IS permitted the expression of results from the amplification of clinical samples as ratio values. Quantitative estimates of HIV proviral DNA correlated with the CD4 cell count and patient clinical stage in a pattern similar to that reported in previous quantitative evaluations of HIV infection (Ho et al., 1989, Genesca et al., 1990; O’Shea et al., 1991). The degree of intertest and intratest variability observed (20-30%) appears inherent to the process of amplification (Davis et al., 1990): minor events taking place in the first cycles of amplification, such as small pipetting errors, lack of homogeneity of the sample, the different availability of a few target molecules present within ‘complex’ sample lysates, and the purity of the DNA, will have a definite impact on the final amount of amplified product (Kellogg et al., 1990). The difference in size between the native target and the standard (500 bp) was chosen to optimally separate their products without the need for a restriction enzyme digestion step. However, this approach may result in
261
different amplification efficiencies for the two targets, and we cannot exclude that a smaller IS insert size would result in a more precise assay. Clinical samples, particularly those prepared by simple cell lysis, had a marked variation in sample-to-sample amplification efficiency of the IS that reflected the presence of PCR inhibitory factors (Kellogg et al., 1990). Thus, the use of the IS appeared more sensitive for the detection of inhibition than ‘conventional’ methods such as the amplification of human /?-globin sequence (Telenti et al., 1990): significant inhibition that will result in poor amplification of 100 copies of the IS, could still allow a ‘satisfactory’ amplification of several thousand copies of a human sequence. An additional consideration when attempting quantitation by PCR is that the progressive exhaustion of reaction components limits the exponential accumulation of products, the ‘plateau effect’ (Mullis, K., 1991). The use of an IS represents a rational way of monitoring this phenomenon: the ‘plateau effect’ will be limiting for the amplification of both the IS and the native target. The main advantages of this IS format are: (1) the flexibility of the construction process, that does not depend on restriction sites, allows a precise ‘tailoring’ of inserts (i.e. accommodating multiple primers); (2) native target and IS have identical priming and probing sites; (3) products are differentiated by size without the need for restriction enzyme digestion steps. The general strategy described can be applied to the development of internal standards for the amplification reactions of other viral, bacterial or eukaryotic DNA sequences. The construction process can be completed in less than two weeks by laboratories familiar with PCR and cloning procedures.
Acknowledgements Supported in part by Grant AIDS research.
90-7020 from the Swiss National
Program
for
References Davis, G.R., Blumeyer, K., DiMichele, L.J., Whittield, K.M., Chappelle, H., Riggs, N., Ghosh, S.S., Kao, P.M., Fahy, E., Kwoh, D.Y ., Guatelli, J.C., Spector, S.A., Richman, D.D. and Gingeras, T.R. (1990) Detection of human immunodeficiency virus type 1 in AIDS patients using amplification-mediated hybridization analysis: reproducibility and quantitative limitations. J. Infect. Dis. 162, 13-20. Genesca, J., Wang, R.W.H., Alter, H.J. and Shih, J.W.K. (1990) Clinical correlation and genetic polymorphism of the human immunodeliciency virus proviral DNA obtained after polymerase chain reaction amplification. J. Infect. Dis. 162, 1025-1030. Gilliland, G., Perrin, S. and Bunn, H.F. (1990) Competitive PCR for quantitation of mRNA. In M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White (Eds), PCR Protocols. Academic Press Inc., San Diego, CA, pp. 6&69. Ho, D.D., Moudgil, T. and Alam, M. (1989) Quantitation of human immunodeficiency virus type 1 in the blood of infected persons. N. Engl. J. Med. 321, 1621-1625.
268 Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.K. and Pease, L.R. (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 6168. Horton, R.M., Cai, Z., Ho, S.N. and Pease, L.R. (1990) Gene splicing by overlap extension: tailormade genes using the polymerase chain reaction. BioTechniques 8, 528-535. Kellogg, D.E., Sninsky, J.J. and Kwok, S. (1990) Quantitation of HIV-l proviral DNA relative to cellular DNA by the polymerase chain reaction. Analyt. Biochem. 189, 202-208. Mullis, K.B. (1991) The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion. PCR Methods Appl. 1, 14. O’Shea, S., Rostron, T., Hamblin, A.S., Palmer, S.J. and Banatvala, J.E. (1991) Quantitation of HIV: correlation with clinical, virological, and immunological status. J. Med. Virol. 35, 6569. Ou, C.-Y., Kwok, S., Mitchell, S.W., Mack, D.H., Sninsky, J.J., Krebs, J.W., Feorino, P., Wartield, D. and Schochetman, G. (1988) DNA amplification for direct detection of HIV-l in DNA of peripheral blood mononuclear cells. Science 239, 295297. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory. Cold Spring Harbor, NY. Semple, M., Loveday, C., Weller, I. and Tedder, R. (1991) Direct measurement of viraemia in patients infected with HIV-l and its relationship to disease progression and zidovudine therapy. J. Virol. Methods 35, 38-45. Scharf, S.J. (1990) Cloning with PCR. In: M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White (Eds), PCR Protocols. Academic Press Inc., San Diego, CA., pp. 84-91. Stieger, M., Dtmolliere, C., Ahlborn-Laake, L. and Mous, J. (1991) Competitive polymerase chain reaction assay for quantitation of HIV-l DNA and RNA. J. Virol. Methods 34, 149-160. Tabor, S. and Struhl, K. (1989) Enzymatic manipulation of DNA and RNA. In: F.A. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl (Eds), Current Protocols in Molecular Biology. Green Publishing and Wiley-Interscience, N.Y. pp. 3, 5, 9. Telenti, A., Marshall, W.F. and Smith, T.F. (1990) Detection of Epstein-Barr virus by polymerase chain reaction. J. Clin. Microbial. 28, 2187-2190. Wang, A.M. and Mark, D.F. (1990) Quantitative PCR. In: M.A. Innis, D.H. Gelfand, J.J. Sninski and T.J. White (Eds), PCR Protocols. Academic Press Inc., San Diego, CA. pp. 7&75. Wolinsky, S.M., Rinaldo, C.R., Kwok, S., Sninsky, J.J., Gupta, P., Imagawa, D., Farzadegan, H., Jacobson, L.P., Grovit, K.S., Lee, M.H., Chmiel, J.S., Ginzburg, H., Kaslow, R.A. and Phair, J.P. (1989) Human immunodeficiency virus type1 infection a median of 18 months before a diagnostic Western blot. Ann. Intern. Med. 111, 961-972.
259
VIRMET 01384
Competitive polymerase chain reaction using an internal standard: application to the quantitation of viral DNA A. Telenti, P. Imboden and D. Germann Institute of Medical Microbiology,
University of Berne, Berne (Switzerland)
(Accepted 22 April, 1992)
Summary
A general strategy for the construction of an internal standard for the polymerase chain reaction (PCR) is described together with its application in the evaluation of clinical samples. This internal standard is a plasmid containing a modified target sequence that is co-amplified with the native target using the same set of primers. The co-amplification reaction will generate two fragments of different size that are readily separated without the need for restriction enzyme digestion. Thereafter, they are detected and quantitated by hybridization to the same probe. Detection of HIV proviral DNA was chosen as a model for this competitive PCR. The assay proved to be a sensitive tool for the detection of PCR inhibitors and allowed quantitation of HIV with a 2030% variation coefficient. Despite limitations that appear inherent to the amplification process, internal standards appear to be useful tools for quantitative analysis by PCR. HIV quantitation; Splicing by overlap extension; Recombinant DNA; Polymerase chain reaction (PCR) internal standard
Introduction
Quantitative analysis by PCR relies usually on external standards (Davis et al., 1990; Genesca et al., 1990; Semple et al., 1991). The use of an internal Correspondence to:
Beme, Switzerland.
Dr. A. Telenti, Institute of Medical Microbiology, Friedbuehlstrasse 51, 3010 Beme,
260
standard (IS) would offer control on the efficiency of the amplification reaction for each individual sample, and therefore, a more precise quantitation (Gilliland et al., 1990; Kellogg et al., 1990). Internal controls appear particularly attractive for PCR because of the multiple steps (amplification, electrophoresis, blotting, hybridization, autoradiography) required for the evaluation of results, and because they may allow the detection of inhibitors of the reaction. Previous reports on internal standards for PCR have focussed on quantitation of RNA via cDNA (Gilliland et al., 1990; Wang et al., 1990), product discrimination by the introduction of new restriction sites (Stieger et al., 1991), or co-amplification of unrelated targets (Kellogg et al., 1990). We describe a strategy for rapid construction of a plasmid that serves as an internal standard for HIV PCR, and its application to the quantitation of proviral DNA in clinical samples from HIV-infected patients. This method can be applied for the construction of other internal standard plasmids for competitive PCR.
Materials and Methods Construction of the internal standard plasmid
The PCR technique ‘gene splicing by overlap extension’ that allows the generation of recombinant DNA constructs without reliance on restriction enzyme sites was used (Horton et al., 1989; 1990). A 500 base pair (bp) fragment of Lambda phage DNA was inserted at a defined location within the HIV-gag proviral sequence. The resulting ‘long’ construct was then cloned into a plasmid. Amplification of this plasmid generates a PCR product that is larger (611 bp) than the product of amplification of a native HIV target (115 bp). Amplification and spkcing Four consecutive PCR reactions followed by a cloning step were necessary for the construction of the IS plasmid (Fig. 1). The process required 6 primer pairs: primers SK38 and SK39 for the amplification of HIV (Ou et al., 1988), Lambda phage primers (Perkin-Elmer Cetus PCR amplification Kit) to generate the fragment of heterologous DNA, and the overlapping primers OLl and 0L2. To allow the splicing, one part of the sequence of these overlapping primers is homologous to lambda and the remaining part to the HIV target (Fig. 1). Their sequences are:
OLl: 5’ cggacacgaactcatctaaatttctcctactggg OL2: 5’ ggctgatttcgataaccagatggataatcctggg (lambda sequence is shown in italics, HIV in bold print). Amplification reactions were carried out in 30 cycles (PCR 1 and 2) and 25 cycles (PCR 3 and 4), respectively; 1.5 min at 94°C 1.5 min annealing at 55°C (PCR l), 50°C
261 HIV
SK38_ \
lambda
CPL
\
\
\ ,
“‘SK39
-.
Tcp?
I
c
(la)
(lb)
fraamont A
fraamont B
-
fragmoat C \
P
-
SK39
1
(3)
. -
SK39
\
\ I
SK39
Cloning Fig. 1. Construction of the internal standard plasmid. Four consecutive PCR reactions are necessary to insert a fragment of heterologous DNA within the HIV-gag sequence. PCR 1. Amplification of fragment A: a 115 bp HIV-gag product, using HIV proviral DNA as target and HIV primers SK38 and SK39 (PCR la), and amplification of fragment B, a 500 bp fragment of phage lambda DNA, using specific lambda primers (PCR lb). PCR 2. Amplifkation of two HIV-lambda overlapping fragments in two independent reactions using fragment A as a target: a 97 bp fragment C is amplified by primers SK39 and 0L2 (PCR 2a, 80 bp from HIV and 17 bp ‘tail’ from lambda), and a 47 bp fragment D is amplified by primers SK38 and OLl (PCR2b, 31 bp from HIV and 16 bp ‘tail’ of lambda). PCR 3. Generation of fragment E: a 580 bp ‘lambda-gag’ fragment is obtained by splicing the overlapping fragment C to the 500 bp lambda fragment B. This reaction can be driven with only one primer. PCR 4. Generation of the final ‘gag-lambda-gag’ fragment F: a 611 bp product is obtained by splicing the second overlapping fragment (D) to the product from PCR 3 (E) using primers SK38 and SK39. PCR 3 and PCR 4 generates accessory products; however, the following cloning step allows the separation and purification of the gag-lambda-gag target.
262
(PCR 2 and 4), or 45°C (PCR 3), and 2 min at 72°C. The composition of the PCR mixture (100 ~1) was: 50 mM KCl, 10 mM Tris-HCl (pH 8.4) 1.5 mM MgClz, 0.01% gelatin, 200 PM each dNTP, and 2.5 U of Cetus AmpliTaq polymerase. Primers were used at a final concentration of 1 ,uM. Cloning Direct cloning of the 611 bp fragment F (gag-lambda-gag) was accomplished by the following steps. a. Klenow reaction to generate blunt ends: 10 ~1 of the reaction PCR 4 (fragment F) were incubated for 15 min at 30°C with 1 unit of Klenow enzyme and 1 ~1 of 50 mM MgC12, and purified by phenol-chloroform extraction and ethanol precipitation (Tabor et al., 1989). b. Ligation: 50 ng of fragment F were blunt-ligated to 200 ng of SmaIdigested plasmid pT7T3 18U (Pharmacia) in a 20 ~1 reaction at 16°C overnight (Scharf et al., 1990). c. Transformation: 4 ~1 of the ligation reaction were incubated with 100 ~1 of competent Escherichiu co/i NM522 (Pharmacia), colonies were selected by bluewhite screening (Sambrook et al., 1989), and the presence of the appropriate insert was established by PCR of single colonies lysed in 0.1% Tween. d. Purification: Plasmids containing the appropriate insert were purified in a separate laboratory to avoid contamination with native amplified gag sequences or gag-containing plasmids. The concentration of plasmid DNA was established by fluorometry and a working stock solution of 6000 copies/p1 was prepared. Final adjustment of the copy number for PCR was done by comparing the amplification signals of the IS to that of dilutions of a cell line containing 1 HIV proviral copy (8A5-LAV, National Institute of Allergy and Infectious Diseases, USA). Performance
experiments
A fixed number of copies of the standard (100 copies) were amplified in the presence of different concentrations of a HIV target (dilutions of a plasmid containing a native gag sequence, or of cell line 8A5-LAV, containing one HIV copy/cell) in order to evaluate the performance of the internal standard plasmid. Experiments were carried out in the presence or absence of 1 ,ug of genomic DNA. After PCR, amplification products were analysed by agarose gel electrophoresis, Southern blot transfer, and hybridization with 32P-labelled oligonucleotide SK19 (Ou et al., 1988). Hybridization signals were evaluated by densitometric scanning (Desaga C60, Heidelberg, Germany), and/or radioanalysis (Ambis radioanalysis system, San Diego, CA, USA). The ratio HIV/IS was calculated from the corresponding peak areas obtained by densitometry, or from cpm values obtained by radioanalysis. Data from triplicate experiments were used to calculate the variation coefficient.
263
Clinical application
DNA was obtained by direct lysis of peripheral mononuclear cells from 31 HIV-infected subjects (Wolinsky et al., 1989), and 42 samples were provided as extracted purified DNA by two other laboratories (courtesy of Dr. L. Perrin and S. Yerly, Cantonal University Hospital, Geneva; and Dr. J. Biini, National Center for Retroviruses, Zurich). DNA (1 pg) was added to each reaction tube. The internal standard was added to the PCR mix immediately prior to aliquoting into the individual reaction vials to ensure optimal and homogeneous distribution of the standard (100 copies/tube). The HIV/IS ratios from 34 patients were correlated with the absolute CD4 cell counts and with CDC clinical stage. Correlations between variables were assessed by the Spearman’s rank coefficient; the Kruskel Wallis test was used for the evaluation of differences among clinical groups.
Results Dilution experiments
Fig. 2 shows the results of the co-amplification of different concentrations of native HIV target and 100 copies of IS. There was a linear relationship between the estimated number of native HIV copies added to the reaction and the HIV/ IS ratios obtained after amplification. Linearity was maintained for the range evaluated (< 10 to 1000 HIV copies); however, competition between both IS and native HIV targets was observed when more than 2500 HIV copies were present during the reaction. Ratio values from HIV dilution experiments carried out in the absence of genomic DNA exhibited an average variation coefficient of 20%. This value increased to 27% when the experiments were performed in the presence of 1 pg of genomic DNA. The addition of 100 copies of IS to the reaction did not prevent the efficient amplification of the low amounts of native target present in dilution experiments (Fig. 2) or in clinical samples (Fig. 3). Clinical samples
For the 77 patient samples evaluated, HIV/IS ratios ranged from ~0.1 to 22.3. CD4 count information was available for 34 patients. Ratio values were greater among 18 patients with CD4 counts below 200 cells/mm3 than among 16 patients with more than 200 CD4 cells/mm3 (mean* SD, 4.6f 4.0 vs. 1.5 + 1.6, P= 0.013), despite depletion of those relevant target cells. Patients in CDC clinical stage IV had greater HIV/IS ratio than those on clinical stage III or II (5.1+ 5.7, 3.1+ 2.1,2.3 + 2.9, respectively); the differences were significant (P=O.O014) after normalizing for the CD4 count (Ratio X lOO/CD4 count). The efficiency of amplification of the IS was used as an indicator for the
264 M
1 2
3
4
5
6
7
8
9 10 II
I
I
HI V-Std
HI V-Sam
._I
10
100 NUMBER
1000
OF HIV COPIES
Fig. 2. Performance of the internal standard in dilution experiments. A. Southern blot analysis of products from the amplification of 500, 250, 125, 62, 31, 16, 8, 4, and 0 copies (lanes 1-9) of a HIV target in the presence of 100 copies of the internal standard (HIV-Std). Lane 10 is a negative HIV and plasmid control. M, molecular weight marker (32P-labelled #X174 HaeIII digest). B. Quantitative evaluation of the Southern blot shown in panel A. A linear relationship is observed between the calculated HIV/IS ratios and the number of HIV copies added to the reaction. The experiment was done in triplicate (three independent amplification reactions), and shown are the mean values and SEM.
presence of inhibitory substances in patient samples. The amplification efficiency of the IS depended on the source of the clinical material: a 19% variation coefficient of the IS peak areas was observed among 17 samples of purified DNA from one laboratory, and up to 53% among the 25 samples of purified DNA from a second reference center. High grade inhibition was
265
WITHOUT STANOARIJ C
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16 17
WITH STANDARD C
Fig. 3. Use of extracted from absence (upper HIV sequences
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16 17
the internal standard with clinical samples. Amplification of HIV sequences from DNA peripheral mononuclear cells of 17 HIV-infected patients. PCR was carried out in the panel) or presence (lower panel) of 100 copies of the internal standard. Detection of native was not significantly altered by the presence of the internal standard. C, Positive HIV and plasmid control.
observed in 2 of 31 samples prepared by simple lysis; and overall, lysates exhibited the greatest variation in IS amplification efficiency. Samples found inhibitory in HIV PCR rendered an adequate amplification signal when evaluated by human fl-globin primers. Dilution of selected samples confirmed the inhibitory characteristics of those DNA preparations (Fig. 4). Discussion
Our experience with the construction and application of an internal standard for HIV PCR showed the feasibility of coamplitication and detection of two
266
,HIV
Fig. 4. Use of the internal standard for the detection of inhibitors of the PCR. This figure illustrates the detection of PCR inhibitors in a patient’s sample despite a satisfactory amplification of human B-globin sequences. Lane 1. The cell lysate equivalent of 1 pg DNA was added to the PCR reaction containing 100 copies of the Internal Standard (IS). The Southern blot demonstrates a weak HIV amplification, and no IS amplification. Lane 2. Dilution of the sample (1:lO) demonstrates the presence of enough inhibition to prevent amplification of 100 copies of target (IS) but not of a larger number of native HIV targets. Lane 3. Further dilution (1:lOO) finally allows the detection of the IS and of HIV. Lane B. Successful amplification of human B-globin target in the undiluted sample despite significant inhibition of the amplification of HIV and IS targets. M, Molecular weight marker.
targets using the same set of primers and probe. In addition, for the assay range evaluated (< 10 to 1000 target copies), there was a linear relationship between the number of target copies added to the IS-containing reaction and the target/ IS ratio obtained after amplification. The IS permitted the expression of results from the amplification of clinical samples as ratio values. Quantitative estimates of HIV proviral DNA correlated with the CD4 cell count and patient clinical stage in a pattern similar to that reported in previous quantitative evaluations of HIV infection (Ho et al., 1989, Genesca et al., 1990; O’Shea et al., 1991). The degree of intertest and intratest variability observed (20-30%) appears inherent to the process of amplification (Davis et al., 1990): minor events taking place in the first cycles of amplification, such as small pipetting errors, lack of homogeneity of the sample, the different availability of a few target molecules present within ‘complex’ sample lysates, and the purity of the DNA, will have a definite impact on the final amount of amplified product (Kellogg et al., 1990). The difference in size between the native target and the standard (500 bp) was chosen to optimally separate their products without the need for a restriction enzyme digestion step. However, this approach may result in
261
different amplification efficiencies for the two targets, and we cannot exclude that a smaller IS insert size would result in a more precise assay. Clinical samples, particularly those prepared by simple cell lysis, had a marked variation in sample-to-sample amplification efficiency of the IS that reflected the presence of PCR inhibitory factors (Kellogg et al., 1990). Thus, the use of the IS appeared more sensitive for the detection of inhibition than ‘conventional’ methods such as the amplification of human /?-globin sequence (Telenti et al., 1990): significant inhibition that will result in poor amplification of 100 copies of the IS, could still allow a ‘satisfactory’ amplification of several thousand copies of a human sequence. An additional consideration when attempting quantitation by PCR is that the progressive exhaustion of reaction components limits the exponential accumulation of products, the ‘plateau effect’ (Mullis, K., 1991). The use of an IS represents a rational way of monitoring this phenomenon: the ‘plateau effect’ will be limiting for the amplification of both the IS and the native target. The main advantages of this IS format are: (1) the flexibility of the construction process, that does not depend on restriction sites, allows a precise ‘tailoring’ of inserts (i.e. accommodating multiple primers); (2) native target and IS have identical priming and probing sites; (3) products are differentiated by size without the need for restriction enzyme digestion steps. The general strategy described can be applied to the development of internal standards for the amplification reactions of other viral, bacterial or eukaryotic DNA sequences. The construction process can be completed in less than two weeks by laboratories familiar with PCR and cloning procedures.
Acknowledgements Supported in part by Grant AIDS research.
90-7020 from the Swiss National
Program
for
References Davis, G.R., Blumeyer, K., DiMichele, L.J., Whittield, K.M., Chappelle, H., Riggs, N., Ghosh, S.S., Kao, P.M., Fahy, E., Kwoh, D.Y ., Guatelli, J.C., Spector, S.A., Richman, D.D. and Gingeras, T.R. (1990) Detection of human immunodeficiency virus type 1 in AIDS patients using amplification-mediated hybridization analysis: reproducibility and quantitative limitations. J. Infect. Dis. 162, 13-20. Genesca, J., Wang, R.W.H., Alter, H.J. and Shih, J.W.K. (1990) Clinical correlation and genetic polymorphism of the human immunodeliciency virus proviral DNA obtained after polymerase chain reaction amplification. J. Infect. Dis. 162, 1025-1030. Gilliland, G., Perrin, S. and Bunn, H.F. (1990) Competitive PCR for quantitation of mRNA. In M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White (Eds), PCR Protocols. Academic Press Inc., San Diego, CA, pp. 6&69. Ho, D.D., Moudgil, T. and Alam, M. (1989) Quantitation of human immunodeficiency virus type 1 in the blood of infected persons. N. Engl. J. Med. 321, 1621-1625.
268 Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.K. and Pease, L.R. (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 6168. Horton, R.M., Cai, Z., Ho, S.N. and Pease, L.R. (1990) Gene splicing by overlap extension: tailormade genes using the polymerase chain reaction. BioTechniques 8, 528-535. Kellogg, D.E., Sninsky, J.J. and Kwok, S. (1990) Quantitation of HIV-l proviral DNA relative to cellular DNA by the polymerase chain reaction. Analyt. Biochem. 189, 202-208. Mullis, K.B. (1991) The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion. PCR Methods Appl. 1, 14. O’Shea, S., Rostron, T., Hamblin, A.S., Palmer, S.J. and Banatvala, J.E. (1991) Quantitation of HIV: correlation with clinical, virological, and immunological status. J. Med. Virol. 35, 6569. Ou, C.-Y., Kwok, S., Mitchell, S.W., Mack, D.H., Sninsky, J.J., Krebs, J.W., Feorino, P., Wartield, D. and Schochetman, G. (1988) DNA amplification for direct detection of HIV-l in DNA of peripheral blood mononuclear cells. Science 239, 295297. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory. Cold Spring Harbor, NY. Semple, M., Loveday, C., Weller, I. and Tedder, R. (1991) Direct measurement of viraemia in patients infected with HIV-l and its relationship to disease progression and zidovudine therapy. J. Virol. Methods 35, 38-45. Scharf, S.J. (1990) Cloning with PCR. In: M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White (Eds), PCR Protocols. Academic Press Inc., San Diego, CA., pp. 84-91. Stieger, M., Dtmolliere, C., Ahlborn-Laake, L. and Mous, J. (1991) Competitive polymerase chain reaction assay for quantitation of HIV-l DNA and RNA. J. Virol. Methods 34, 149-160. Tabor, S. and Struhl, K. (1989) Enzymatic manipulation of DNA and RNA. In: F.A. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl (Eds), Current Protocols in Molecular Biology. Green Publishing and Wiley-Interscience, N.Y. pp. 3, 5, 9. Telenti, A., Marshall, W.F. and Smith, T.F. (1990) Detection of Epstein-Barr virus by polymerase chain reaction. J. Clin. Microbial. 28, 2187-2190. Wang, A.M. and Mark, D.F. (1990) Quantitative PCR. In: M.A. Innis, D.H. Gelfand, J.J. Sninski and T.J. White (Eds), PCR Protocols. Academic Press Inc., San Diego, CA. pp. 7&75. Wolinsky, S.M., Rinaldo, C.R., Kwok, S., Sninsky, J.J., Gupta, P., Imagawa, D., Farzadegan, H., Jacobson, L.P., Grovit, K.S., Lee, M.H., Chmiel, J.S., Ginzburg, H., Kaslow, R.A. and Phair, J.P. (1989) Human immunodeficiency virus type1 infection a median of 18 months before a diagnostic Western blot. Ann. Intern. Med. 111, 961-972.
