Protein Expression and Purification 92 (2013) 230–234
Contents lists available at ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
Construction and expression of an antimicrobial peptide scolopin 1 from the centipede venoms of Scolopendra subspinipes mutilans in Escherichia coli using SUMO fusion partner Huanhuan Hou, Weili Yan, Kexing Du, Yangjing Ye, Qianqian Cao, Wenhua Ren ⇑ Jiangsu Province Key Laboratory for Molecular and Medical Biotechnology, College of Life Sciences, Nanjing Normal University, Nanjing 210023, China
a r t i c l e
i n f o
Article history: Received 20 September 2013 and in revised form 30 September 2013 Available online 18 October 2013 Keywords: Centipede Scolopendra subspinipes mutilans Antimicrobial peptide AMP-scolopin 1 SUMO
a b s t r a c t Antimicrobial peptide scolopin 1 (AMP-scolopin 1) is a small cationic peptide identified from centipede venoms of Scolopendra subspinipes mutilans. It has broad-spectrum activities against bacteria, fungi, and tumor cells, which may possibly be used as an antimicrobial agent. We first report here the application of small ubiquitin-related modifier (SUMO) fusion technology to the expression and purification of cationic antimicrobial peptide AMP-scolopin 1. The fusion protein expressed in a soluble form was purified to a purity of 95% by Ni-IDA chromatography. After the SUMO-scolopin 1 fusion protein was cleaved by the SUMO protease at 30 °C for 1 h, the cleaved sample was reapplied to a Ni-IDA. The recombinant scolopin1 had similar antimicrobial properties to the synthetic scolopin 1. Thus, we successfully established a system for purifying peptide of centipede, which could be used for further research. Ó 2013 Elsevier Inc. All rights reserved.
Introduction Antimicrobial peptides (AMPS)1 represent a group of naturally occurring molecules which play an important role in the maintenance of innate immunity [1]. Much attention has been paid to antimicrobial peptides since they have been found to be excellent candidates for developing novel antimicrobial agents. A few antimicrobial peptides have already entered clinical trials. For example, Magainin, an antimicrobial peptide identified from Xenopus laevis has been used to treat diabetic foot ulcers [2]. As we all know, arthropods have no acquired immune system. In order to resist invading microorganisms, arthropods have developed a large number of constitutive and inducible antimicrobial peptides in their innate immune system to defense complex pathogens. Many antimicrobial peptides in arthropods such as insects and scorpions have been intensively studied [3]. The centipede Scolopendra subspinipes mutilans is widely used in traditional medicine for the treatment of neural, respiratory and cardiovascular diseases in many Asian countries [4]. However, only a few reports are available about purification and characterization of proteins/ peptides from the centipedes. No antimicrobial peptides have been fully characterized from centipede venoms except a few papers
⇑ Corresponding author. Tel./fax: +86 25 86963329. E-mail address: [email protected] (W. Ren). Abbreviations used: LB, Luria-Bertani; IPTG, isopropylthiogalactoside; SDS–PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; MIC, minimal inhibitory concentration. 1
1046-5928/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pep.2013.10.004
talking a bit about antimicrobial activities of centipede venoms. A homogeneous antibacterial peptide called scolopendrin I, with a molecular mass of 4498, has been identified from the crude venom of the centipede of S. s. mutilans after stress by injecting with Escherichia coli K12D31 for 3–4 days [5]. A novel antimicrobial peptide called scolopin 1 was identified from centipede venoms of S. s. mutilans. The amino acid sequence was FLPKMSTKLRVPYRRGTKDYH with a molecular mass of 2593.9. It showed strong antimicrobial activities against tested microorganisms including Gram-positive/negative bacteria and fungi [6]. Its wide range of activities provide the possibility that AMP-scolopin 1 can be used as an antimicrobial and anticancer agent in the future. The E. coli is still the preferred host for recombinant protein expression because of its high expression level, simplicity, and low cost. However, it is difficult to express soluble heterologous proteins. Small ubiquitin-related modifier (SUMO) is a protein that covalently links to other proteins. It has an external hydrophilic surface and an inner hydrophobic core, which may exert a detergent-like effect on otherwise insoluble proteins. Several difficultto-express proteins have been successfully expressed in E. coli using SUMO as a fusion tag based on its many advantages, such as protection from degradation, improved protein folding, and simple purification [7]. Most important, cleaving SUMO protease will result in a native-like target protein when fused directly with the C-terminus of the SUMO tag [8]. AMP-CM4, an antibacterial peptide isolated from the hemolymph of the silkworm Bombyx mori [9] was successfully expressed by the SUMO-mediated expression
H. Hou et al. / Protein Expression and Purification 92 (2013) 230–234
231
and purification system [10]. Subsequently, we subclone the AMPscolopin 1 into pSUMO vector for production. In this paper, a new coding sequence of scolopin 1 was synthesized using favored codons for E. coli. This is the first time that SUMO-mediated expression and purification of recombinant AMP-scolopin 1 has been achieved in E. coli. The cloning of the AMP-scolopin 1 gene into pSUMO vector, the expression of SUMO-scolopin 1 in a soluble form, purification, and the biological assay of recombinant AMP-scolopin 1 was described in detail. Materials and methods Reagents, bacterial strains, vectors, and enzymes The linearized pSUMO vector with StuI and HindIII restriction sites and T7 promoter and kanamycin resistance was purchased from LifeSensors (LifeSensors, Malvern, PA, USA). E. coli DH5a (maintained in our laboratory) was used for subcloning and plasmid amplification. E. coli BL21 (DE3) (Novagen, USA) was used as the expression host. E. coli K12D31 was conserved by our laboratory. Restriction enzymes and T4 DNA ligase were from TaKaRa Biotech (Shiga, Japan). The plasmid extraction kit and PCR production purification kit were from Promega (Fitchburg, WI, USA). All of the primers used in this paper were synthesized by Invitrogen. The synthetic peptide of scolopin 1 for bioactivity assay was synthesized by GL Biochem (Shanghai). All other reagents were made in China and were of analytical grade.
Fig. 1. Schematic representation of the expression vector pSUMO-scolopin 1. Scolopin1 was expressed as a fusion protein with the SUMO.
Synthesis of AMP-scolopin 1 gene by PCR According to the amino acid sequence of scolopin 1, this E. coli preferred. Codons based software (http://www.ebi.ac.uk/Tools/st/ emboss_backtranseq/) was used to synthesis its template primers. A synthetic DNA encoding the scolopin 1 was assembled by rPCR with the two overlapping primers (P1: 50 -TTTCCTGCCGAAA AT G TCTACCAAACTGCGTGTTCCGTAC-30 , P2: 50 -CCCAA GCTT TCAA TG GTAGTCTTTGGTACCACGACGGTACGGAACA C GCAG-30 ). The PCR product was then used as the template for another PCR amplification. The primers are: (P3: 50 -TTTCCTGCCGAAAATGTCTA-30 , P4: 50 CCCAAGCTTTCAATGGTAGT-30 ). Each primer contains restriction site for StuI and HindIII, respectively. Construction of expression vector The PCR product was separated by 2.5% agarose gel electrophoresis, purified with a DNA gel extraction kit (AxyGEN Union, USA). The resulting PCR product was digested with StuI and HindIII, and ligated into the pSUMO plasmid at the corresponding restriction sites. The ligation mixture was transformed into E. coli DH5a cells for verification by sequencing. Expression and purification of pSUMO-scolopin 1 fusion protein The constructed recombinant plasmid pSUMO-scolopin 1 was transformed into competent E. coli BL21 (DE3) cells. Overnight cultures of E. coli BL21 cells harboring pSUMO-scolopin 1 constructs were subcultured (1:100) in fresh LB medium supplied with 50 lg/ml kanamycin and vigorously shaken (200 rpm) at 37 °C. Expression of the SUMO fusion protein was induced by the addition of IPTG to a final concentration of 0.5 mM (OD600 0.6). After induction, the cultures were incubated at 37 °C for 8 h. The pellet from 200 ml culture was resuspended in 15 ml binding buffer (20 mM Tris, 500 mM NaCl, 20 mM imidazole, pH 8.0), and disrupted by Sonication at 200 W for 100 cycles (4 s working,
Fig. 2. SDS–PAGE analyses of target protein expression under different IPTG concentrations. M, molecular weight marker; lane 1, total proteins before induction; lanes 2–5, soluble proteins when cultured at 0.1, 0.5, 0.8 and 1.0 mM IPTG, respectively. The arrow indicates the location of the recombinant fusion protein.
8 s free). The supernatant of the cell lysate resulting from centrifugation at 12,000g at 4 °C for 20 min was applied to a Ni2+-chelating column. After extensive washing with binding buffer (20 mM Tris, 500 mM NaCl, and 20 mM imidazole, pH 8.0), the fusion protein was eluted with five column volumes of elution buffer (20 mM Tris, 500 mM NaCl, and 250 mM imidazole, pH 8.0) at a flow rate of 1 ml/min. The peak fractions containing the fusion protein were pooled and dialyzed overnight at 4 °C in phosphate-buffered saline (PBS). Cleavage of SUMO fusion and purification of AMP-scolopin 1 The fusion protein was reacted with 1 U SUMO-specific protease per 50 lg proteins at 30 °C for 1 h to release AMP-scolopin 1. Both SUMO and SUMO protease had 6 His tags, but AMP-scolopin 1 did not, the cleaved SUMO fusion samples could be reapplied to the nickel column to obtain the purified AMP-scolopin 1 by subtracting the 6 His-tagged proteins. After the SUMO fusions were cleaved by the SUMO protease, and the sample was loaded onto a nickel column with Ni-IDA resin, most of the AMP-scolopin 1 without 6 His tags were eluted in the flow-through (unbound) fractions, while the rest were recovered by washing the resin with binding buffer. The eluted and washed proteins appearing in fractions with high OD280 values were pooled as the final purified sample. The purified proteins were analyzed by Tricine/SDS–PAGE and the samples were stored at 70 °C for activity assay.
232
H. Hou et al. / Protein Expression and Purification 92 (2013) 230–234
Assay of antimicrobial activity The antimicrobial activity of purified recombinant AMP-scolopin 1 was tested by an inhibition zone assay [11], using Gramnegative bacteria E. coli K12D31 as test bacteria. Briefly, the samples were applied into the wells of a thin agar plate seeded with bacteria. Bacterial inhibition zones were detected after incubating at 37 °C overnight. The minimal inhibitory concentration (MIC) was defined as the lowest concentration of peptide at which there was no change in optical density. For preliminary study antibacterial mechanism, scanning electron microscopy (SEM) was then employed to visualize the structural effect of the interaction of scolopin 1 with the E. coli K12D31 cell envelope. In the SEM experiments, the E. coli cells were incubated at 37 °C with different concentrations of scolopin 1 (5, 10 and 20 lm) for 1 h. Control samples were treated with PBS. Time-dependent experiments were also carried out. All experiments were performed with duplicate cultures for each peptide.
Fig. 3. 12% SDS–PAGE analysis of the samples in affinity chromatography. M, molecular weight marker; lane 1, the flow washed by binding buffer; lanes 2 and 3, washed by washing buffer; lane 4, protein fractions eluted from the affinity column by 250 mM imidazole. The arrow indicates the purified fusion protein.
Results Plasmid construction and expression of pSUMO-scolopin 1 fusion protein AMP-scolopin 1 gene was obtained through a rPCR strategy. Restriction enzyme sites StuI and HindIII were added to the 50 end and 30 -end of the fusion sequence to yield a 63 bp DNA fragment. The fusion DNA fragment was subsequently inserted into the pSUMO vector to result in pSUMO-scolopin 1 which contained a His-tag for affinity purification (Fig. 1). The recombinant plasmid sequence was verified by DNA sequencing. For the expression vector with a T7lac promoter, the concentration of IPTG needs to be optimized because of its great contribution to recombinant protein expression and serious harm to cell growth [12]. In this study, the concentration of IPTG was examined from 0.1 to 1.0 mM. The SDS–PAGE showed SUMO-scolopin 1 fusion protein position (22.6 KD) (Fig. 2). The results showed the concentration of soluble product and the percentage of target protein reached the highest level at 0. 5 mM IPTG.
Purification of SUMO-scolopin 1 fusion protein The His6-SUMO-scolopin 1 fusion protein was purified from the supernatant of the cell lysate using Ni-IDA affinity chromatography. The proteins without 6 His tags were removed from the Ni-IDA resin using washing buffer containing 20 mM imidazole, and the 6 His-tagged SUMO-scolopin 1 was eluted using elution buffer containing 250 mM imidazole with more than 95% purity (Fig. 3).
Fig. 4. Tricine/SDS–PAGE analysis of SUMO-scolopin 1 fusion protein cleaved by SUMO protease and recombinant scolopin1 purification. (a) Tricine/SDS–PAGE analysis of SUMO-scolopin 1 fusion protein cleaved by SUMO protease. Lane M, low molecular weight marker; lane 1, purified SUMO-scolopin 1 fusion protein; lane 2, mixture of SUMO-scolopin 1 fusion protein by SUMO protease cleavage. (b) Tricine/ SDS–PAGE analysis of recombinant scolopin 1 purification. Lane M, low molecular weight marker; lane 1, scolopin 1 after the second Ni-column.
Table 1 Isolation of recombinant AMP-scolopin 1 from pSUMO-scolopin 1 fusion protein.a Purification step Sonicated supernatant After affinity chromatography After affinity chromatography Dialysis
Total protein (mg) b
850 160b NA NA
Fusion protein (mg) 128 95c 66b NA
c
NA not applicable. a Estimations are based on 1 l of bacterial culture (about 10 g wet weight). b Determined using a Bradford assay. c Percent of SUMO-scolopin 1 fusion protein from total proteins was estimated by SDS gel scanning. d The amount of AMP-scolopin 1 was calculated as a fraction of SUMO-scolopin 1 fusion protein. e Purity of protein or peptide was estimated by SDS gels stained by Coomassie Blue.
AMP-scolopin 1 (mg) d
35 28d 20d 16
Purity (%) NA NA NA >95%
e
H. Hou et al. / Protein Expression and Purification 92 (2013) 230–234 Table 2 The minimal inhibitory concentration of recombinant scolopin1 to selected microorganisms. Microorganisms
E. coli K12D31 Staphyloccocus aureu Aspergillus niger
Minimum inhibitory concentration (lM) Recombinant scolopin1
Synthetic scolopin1
10 6 6
10 5 7
233
of each purification step can be seen in Table 1. The results indicate that we successfully purified the fusion protein scolopin 1 and developed a new method for producing and purifying soluble scolopin1 in E. coli cells. Assay of antimicrobial activity The antimicrobial ability of the purified recombinant scolopin 1 was evaluated by determing its MICs against selected microorganisms (Table 2). Results showed the recombinant scolopin 1 had similar antimicrobial properties to the synthetic scolopin 1 (Fig. 5). The SEM experiments indicated that scolopin 1 progressively destroyed the bacterial envelope with the increase of concentration and caused the leakage of cell contents which led to cell death by binding to cell membranes of E. coli K12D31. Broadly speaking, the action of scolopin 1 resulted in a collapse of the bacterial envelope, particularly at the septal region. Some leaked contents and debris could also be detected around the partially disintegrated cells (Fig. 6). Discussion
Fig. 5. Antibacterial activity o f recombinant scolopin 1 against E. coli K12D31 by agar well assay. (1) The negative control, PBS. (2) Fusion protein sample (20 lM). (3) The positive control, synthetic scolopin 1 (20 lM). (4) Recombinant scolopin 1 solution (15 lM).
Cleavage and purification of recombinant AMP-scolopin 1 The SUMO-scolopin 1 protein (50 lg) was competently cleaved with a SUMO tag-specific protease (1 U) at 30 °C for 1 h, checked on a Tricine/SDS–PAGE. Following cleavage, the released peptide scolopin1 was further purified by using Ni-IDA affinity chromatography and the unbound scolopin 1 was collected. From the results of Tricine/SDS–PAGE an approximately 2.6 kDa band corresponding to recombinant scolopin 1 was observed (Fig. 4). The purity
It is known that centipedes live under rock piles and they usually come out at night to hunt their prey using their venoms, which are positioned in their forceps [13]. The work performed by Rates et al. showed us a neglected but important source of new bioactive compounds from centipede venoms [14]. AMP-scolopin 1 was first purified and characterized from the venoms of the centipede of S. s. mutilans. Its broad-spectrum activity against microorganisms, moderate hemolytic activities on human and rabbit red cells and release of histamine, all demonstrated the essential role in centipede innate immunity [6]. SUMO is superior to commonly used fusion tags in enhancing expression and solubility with the distinction of generating recombinant protein with native sequences [8,15]. In this paper, we successfully obtained the recombinant SUMO-scolopin 1 by SUMOmediated expression and purification system in E. coli as shown in Fig. 3. The appearance of the lower band in lane 1 was probably due to in vivo cleavage or in vitro degradation of the fusion protein as shown in Fig. 4a. In order to yield scolopin 1 with the correct amino terminus, the SUMO-scolopin 1 fusion protein was cleaved by the recommended SUMO protease, a small ubiquitin-like mod-
Fig. 6. Effect on E. coli K12D31 imaged by SEM. (A) The negative control, PBS, smooth surface. (B) 5 lM scolopin 1, membrane folds. (C) 10 lM scolopin 1, appearance of holes. (D) 20 lM scolopin 1, membrane blebbing.
234
H. Hou et al. / Protein Expression and Purification 92 (2013) 230–234
ifier protease that recognizes only the tertiary structure of SUMO and efficiently cleaves at the junction between SUMO and the protein of interest [16]. The SUMO-scolopin 1 fusion protein can be completely cleaved by SUMO protease as shown in Fig. 4. Conclusion We constructed an efficient system for the expression and purification of scolopin 1 in E. coli by the pSUMO expression vector. The recombinant strain can potentially be adapted for large scale production of biologically active antimicrobial peptide scolopin 1. The recombinant scolopin 1 had similar antimicrobial properties to the synthetic scolopin 1. The above provides us an efficient and convenient way to further study the antimicrobial mechanism and even the anticancer effect. Acknowledgments This research was financially supported by the National Natural Science Foundation of China (NSFC) Grant No. 31370401, the Natural Science Foundation of Jiangsu Province of China (No. BK2011074), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). References [1] M. Zasloff, Antimicrobial peptides of multicellular organisms, Nature 415 (2002) 389–395. [2] L.M. Rossi, P. Rangasamy, J. Zhang, X.Q. Qiu, G.Y. Wu, Research advances in the development of peptide antibiotics, J. Pharm. Sci. 97 (2008) 1060–1070.
[3] U. Muller, P. Vogel, G. Alber, G.A. Schaub, The innate immune system of mammals and insects, Contrib. Microbiol. 15 (2008) 21–44. [4] R.W. Pemberton, Insects and other arthropods used as drugs in Korean traditional medicine, J. Ethnopharmacol. 65 (1999) (1998) 207–216. [5] R. Wenhua, Z. Shuangquan, S. Daxiang, Z. Kaiya, Y. Guang, Induction, purification and characterization of an antibacterial peptide scolopendrin I from the venom of centipede Scolopendra subspinipes mutilans, Indian J. Biochem. Biophys. 43 (2006) 88–93. [6] K. Peng, Y. Kong, L. Zhai, X. Wu, P. Jia, J. Liu, H. Yu, Two novel antimicrobial peptides from centipede venoms, Toxicon 55 (2010) 274–279. [7] M. Satakarni, R. Curtis, Production of recombinant peptides as fusions with SUMO, Protein Expr. Purif. 78 (2011) 113–119. [8] T.R. Butt, S.C. Edavettal, J.P. Hall, M.R. Mattern, SUMO fusion technology for difficult-to-express proteins, Protein Expr. Purif. 43 (2005) 1–9. [9] L. Zhou, Q. Lin, B. Li, N. Li, S. Zhang, Expression and purification the antimicrobial peptide CM4 in Escherichia coli, Biotechnol. Lett. 31 (2009) 437–441. [10] J.F. Li, J. Zhang, R. Song, J.X. Zhang, Y. Shen, S.Q. Zhang, Production of a cytotoxic cationic antibacterial peptide in Escherichia coli using SUMO fusion partner, Appl. Microbiol. Biotechnol. 84 (2009) 383–388. [11] A.-Y.S. Hui Kang, Ya-Ling Shen, Dong-Zhi Wei, Refolding and structural characteristic of TRAIL/Apo2L inclusion bodies from different specific growth rates of recombinant Escherichia coli, Biotechnol. Prog. 23 (2007) 286–292. [12] Z. Xu, L. Peng, Z. Zhong, X. Fang, P. Cen, High-level expression of a soluble functional antimicrobial peptide, human beta-defensin 2, in Escherichia coli, Biotechnol. Prog. 22 (2006) 382–386. [13] M.B. Malta, M.S. Lira, S.L. Soares, G.C. Rocha, I. Knysak, R. Martins, S.P. Guizze, M.L. Santoro, K.C. Barbaro, Toxic activities of Brazilian centipede venoms, Toxicon 52 (2008) 255–263. [14] B. Rates, M.P. Bemquerer, M. Richardson, M.H. Borges, R.A. Morales, M.E. De Lima, A.M. Pimenta, Venomic analyses of Scolopendra viridicornis nigra and Scolopendra angulata (Centipede, Scolopendromorpha): shedding light on venoms from a neglected group, Toxicon 49 (2007) 810–826. [15] X. Zuo, S. Li, J. Hall, M.R. Mattern, H. Tran, J. Shoo, R. Tan, S.R. Weiss, T.R. Butt, Enhanced expression and purification of membrane proteins by SUMO fusion in Escherichia coli, J. Struct. Funct. Genomics 6 (2005) 103–111. [16] J.G. Marblestone, S.C. Edavettal, Y. Lim, P. Lim, X. Zuo, T.R. Butt, Comparison of SUMO fusion technology with traditional gene fusion systems: enhanced expression and solubility with SUMO, Protein Sci. 15 (2006) 182–189.
Contents lists available at ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
Construction and expression of an antimicrobial peptide scolopin 1 from the centipede venoms of Scolopendra subspinipes mutilans in Escherichia coli using SUMO fusion partner Huanhuan Hou, Weili Yan, Kexing Du, Yangjing Ye, Qianqian Cao, Wenhua Ren ⇑ Jiangsu Province Key Laboratory for Molecular and Medical Biotechnology, College of Life Sciences, Nanjing Normal University, Nanjing 210023, China
a r t i c l e
i n f o
Article history: Received 20 September 2013 and in revised form 30 September 2013 Available online 18 October 2013 Keywords: Centipede Scolopendra subspinipes mutilans Antimicrobial peptide AMP-scolopin 1 SUMO
a b s t r a c t Antimicrobial peptide scolopin 1 (AMP-scolopin 1) is a small cationic peptide identified from centipede venoms of Scolopendra subspinipes mutilans. It has broad-spectrum activities against bacteria, fungi, and tumor cells, which may possibly be used as an antimicrobial agent. We first report here the application of small ubiquitin-related modifier (SUMO) fusion technology to the expression and purification of cationic antimicrobial peptide AMP-scolopin 1. The fusion protein expressed in a soluble form was purified to a purity of 95% by Ni-IDA chromatography. After the SUMO-scolopin 1 fusion protein was cleaved by the SUMO protease at 30 °C for 1 h, the cleaved sample was reapplied to a Ni-IDA. The recombinant scolopin1 had similar antimicrobial properties to the synthetic scolopin 1. Thus, we successfully established a system for purifying peptide of centipede, which could be used for further research. Ó 2013 Elsevier Inc. All rights reserved.
Introduction Antimicrobial peptides (AMPS)1 represent a group of naturally occurring molecules which play an important role in the maintenance of innate immunity [1]. Much attention has been paid to antimicrobial peptides since they have been found to be excellent candidates for developing novel antimicrobial agents. A few antimicrobial peptides have already entered clinical trials. For example, Magainin, an antimicrobial peptide identified from Xenopus laevis has been used to treat diabetic foot ulcers [2]. As we all know, arthropods have no acquired immune system. In order to resist invading microorganisms, arthropods have developed a large number of constitutive and inducible antimicrobial peptides in their innate immune system to defense complex pathogens. Many antimicrobial peptides in arthropods such as insects and scorpions have been intensively studied [3]. The centipede Scolopendra subspinipes mutilans is widely used in traditional medicine for the treatment of neural, respiratory and cardiovascular diseases in many Asian countries [4]. However, only a few reports are available about purification and characterization of proteins/ peptides from the centipedes. No antimicrobial peptides have been fully characterized from centipede venoms except a few papers
⇑ Corresponding author. Tel./fax: +86 25 86963329. E-mail address: [email protected] (W. Ren). Abbreviations used: LB, Luria-Bertani; IPTG, isopropylthiogalactoside; SDS–PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; MIC, minimal inhibitory concentration. 1
1046-5928/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pep.2013.10.004
talking a bit about antimicrobial activities of centipede venoms. A homogeneous antibacterial peptide called scolopendrin I, with a molecular mass of 4498, has been identified from the crude venom of the centipede of S. s. mutilans after stress by injecting with Escherichia coli K12D31 for 3–4 days [5]. A novel antimicrobial peptide called scolopin 1 was identified from centipede venoms of S. s. mutilans. The amino acid sequence was FLPKMSTKLRVPYRRGTKDYH with a molecular mass of 2593.9. It showed strong antimicrobial activities against tested microorganisms including Gram-positive/negative bacteria and fungi [6]. Its wide range of activities provide the possibility that AMP-scolopin 1 can be used as an antimicrobial and anticancer agent in the future. The E. coli is still the preferred host for recombinant protein expression because of its high expression level, simplicity, and low cost. However, it is difficult to express soluble heterologous proteins. Small ubiquitin-related modifier (SUMO) is a protein that covalently links to other proteins. It has an external hydrophilic surface and an inner hydrophobic core, which may exert a detergent-like effect on otherwise insoluble proteins. Several difficultto-express proteins have been successfully expressed in E. coli using SUMO as a fusion tag based on its many advantages, such as protection from degradation, improved protein folding, and simple purification [7]. Most important, cleaving SUMO protease will result in a native-like target protein when fused directly with the C-terminus of the SUMO tag [8]. AMP-CM4, an antibacterial peptide isolated from the hemolymph of the silkworm Bombyx mori [9] was successfully expressed by the SUMO-mediated expression
H. Hou et al. / Protein Expression and Purification 92 (2013) 230–234
231
and purification system [10]. Subsequently, we subclone the AMPscolopin 1 into pSUMO vector for production. In this paper, a new coding sequence of scolopin 1 was synthesized using favored codons for E. coli. This is the first time that SUMO-mediated expression and purification of recombinant AMP-scolopin 1 has been achieved in E. coli. The cloning of the AMP-scolopin 1 gene into pSUMO vector, the expression of SUMO-scolopin 1 in a soluble form, purification, and the biological assay of recombinant AMP-scolopin 1 was described in detail. Materials and methods Reagents, bacterial strains, vectors, and enzymes The linearized pSUMO vector with StuI and HindIII restriction sites and T7 promoter and kanamycin resistance was purchased from LifeSensors (LifeSensors, Malvern, PA, USA). E. coli DH5a (maintained in our laboratory) was used for subcloning and plasmid amplification. E. coli BL21 (DE3) (Novagen, USA) was used as the expression host. E. coli K12D31 was conserved by our laboratory. Restriction enzymes and T4 DNA ligase were from TaKaRa Biotech (Shiga, Japan). The plasmid extraction kit and PCR production purification kit were from Promega (Fitchburg, WI, USA). All of the primers used in this paper were synthesized by Invitrogen. The synthetic peptide of scolopin 1 for bioactivity assay was synthesized by GL Biochem (Shanghai). All other reagents were made in China and were of analytical grade.
Fig. 1. Schematic representation of the expression vector pSUMO-scolopin 1. Scolopin1 was expressed as a fusion protein with the SUMO.
Synthesis of AMP-scolopin 1 gene by PCR According to the amino acid sequence of scolopin 1, this E. coli preferred. Codons based software (http://www.ebi.ac.uk/Tools/st/ emboss_backtranseq/) was used to synthesis its template primers. A synthetic DNA encoding the scolopin 1 was assembled by rPCR with the two overlapping primers (P1: 50 -TTTCCTGCCGAAA AT G TCTACCAAACTGCGTGTTCCGTAC-30 , P2: 50 -CCCAA GCTT TCAA TG GTAGTCTTTGGTACCACGACGGTACGGAACA C GCAG-30 ). The PCR product was then used as the template for another PCR amplification. The primers are: (P3: 50 -TTTCCTGCCGAAAATGTCTA-30 , P4: 50 CCCAAGCTTTCAATGGTAGT-30 ). Each primer contains restriction site for StuI and HindIII, respectively. Construction of expression vector The PCR product was separated by 2.5% agarose gel electrophoresis, purified with a DNA gel extraction kit (AxyGEN Union, USA). The resulting PCR product was digested with StuI and HindIII, and ligated into the pSUMO plasmid at the corresponding restriction sites. The ligation mixture was transformed into E. coli DH5a cells for verification by sequencing. Expression and purification of pSUMO-scolopin 1 fusion protein The constructed recombinant plasmid pSUMO-scolopin 1 was transformed into competent E. coli BL21 (DE3) cells. Overnight cultures of E. coli BL21 cells harboring pSUMO-scolopin 1 constructs were subcultured (1:100) in fresh LB medium supplied with 50 lg/ml kanamycin and vigorously shaken (200 rpm) at 37 °C. Expression of the SUMO fusion protein was induced by the addition of IPTG to a final concentration of 0.5 mM (OD600 0.6). After induction, the cultures were incubated at 37 °C for 8 h. The pellet from 200 ml culture was resuspended in 15 ml binding buffer (20 mM Tris, 500 mM NaCl, 20 mM imidazole, pH 8.0), and disrupted by Sonication at 200 W for 100 cycles (4 s working,
Fig. 2. SDS–PAGE analyses of target protein expression under different IPTG concentrations. M, molecular weight marker; lane 1, total proteins before induction; lanes 2–5, soluble proteins when cultured at 0.1, 0.5, 0.8 and 1.0 mM IPTG, respectively. The arrow indicates the location of the recombinant fusion protein.
8 s free). The supernatant of the cell lysate resulting from centrifugation at 12,000g at 4 °C for 20 min was applied to a Ni2+-chelating column. After extensive washing with binding buffer (20 mM Tris, 500 mM NaCl, and 20 mM imidazole, pH 8.0), the fusion protein was eluted with five column volumes of elution buffer (20 mM Tris, 500 mM NaCl, and 250 mM imidazole, pH 8.0) at a flow rate of 1 ml/min. The peak fractions containing the fusion protein were pooled and dialyzed overnight at 4 °C in phosphate-buffered saline (PBS). Cleavage of SUMO fusion and purification of AMP-scolopin 1 The fusion protein was reacted with 1 U SUMO-specific protease per 50 lg proteins at 30 °C for 1 h to release AMP-scolopin 1. Both SUMO and SUMO protease had 6 His tags, but AMP-scolopin 1 did not, the cleaved SUMO fusion samples could be reapplied to the nickel column to obtain the purified AMP-scolopin 1 by subtracting the 6 His-tagged proteins. After the SUMO fusions were cleaved by the SUMO protease, and the sample was loaded onto a nickel column with Ni-IDA resin, most of the AMP-scolopin 1 without 6 His tags were eluted in the flow-through (unbound) fractions, while the rest were recovered by washing the resin with binding buffer. The eluted and washed proteins appearing in fractions with high OD280 values were pooled as the final purified sample. The purified proteins were analyzed by Tricine/SDS–PAGE and the samples were stored at 70 °C for activity assay.
232
H. Hou et al. / Protein Expression and Purification 92 (2013) 230–234
Assay of antimicrobial activity The antimicrobial activity of purified recombinant AMP-scolopin 1 was tested by an inhibition zone assay [11], using Gramnegative bacteria E. coli K12D31 as test bacteria. Briefly, the samples were applied into the wells of a thin agar plate seeded with bacteria. Bacterial inhibition zones were detected after incubating at 37 °C overnight. The minimal inhibitory concentration (MIC) was defined as the lowest concentration of peptide at which there was no change in optical density. For preliminary study antibacterial mechanism, scanning electron microscopy (SEM) was then employed to visualize the structural effect of the interaction of scolopin 1 with the E. coli K12D31 cell envelope. In the SEM experiments, the E. coli cells were incubated at 37 °C with different concentrations of scolopin 1 (5, 10 and 20 lm) for 1 h. Control samples were treated with PBS. Time-dependent experiments were also carried out. All experiments were performed with duplicate cultures for each peptide.
Fig. 3. 12% SDS–PAGE analysis of the samples in affinity chromatography. M, molecular weight marker; lane 1, the flow washed by binding buffer; lanes 2 and 3, washed by washing buffer; lane 4, protein fractions eluted from the affinity column by 250 mM imidazole. The arrow indicates the purified fusion protein.
Results Plasmid construction and expression of pSUMO-scolopin 1 fusion protein AMP-scolopin 1 gene was obtained through a rPCR strategy. Restriction enzyme sites StuI and HindIII were added to the 50 end and 30 -end of the fusion sequence to yield a 63 bp DNA fragment. The fusion DNA fragment was subsequently inserted into the pSUMO vector to result in pSUMO-scolopin 1 which contained a His-tag for affinity purification (Fig. 1). The recombinant plasmid sequence was verified by DNA sequencing. For the expression vector with a T7lac promoter, the concentration of IPTG needs to be optimized because of its great contribution to recombinant protein expression and serious harm to cell growth [12]. In this study, the concentration of IPTG was examined from 0.1 to 1.0 mM. The SDS–PAGE showed SUMO-scolopin 1 fusion protein position (22.6 KD) (Fig. 2). The results showed the concentration of soluble product and the percentage of target protein reached the highest level at 0. 5 mM IPTG.
Purification of SUMO-scolopin 1 fusion protein The His6-SUMO-scolopin 1 fusion protein was purified from the supernatant of the cell lysate using Ni-IDA affinity chromatography. The proteins without 6 His tags were removed from the Ni-IDA resin using washing buffer containing 20 mM imidazole, and the 6 His-tagged SUMO-scolopin 1 was eluted using elution buffer containing 250 mM imidazole with more than 95% purity (Fig. 3).
Fig. 4. Tricine/SDS–PAGE analysis of SUMO-scolopin 1 fusion protein cleaved by SUMO protease and recombinant scolopin1 purification. (a) Tricine/SDS–PAGE analysis of SUMO-scolopin 1 fusion protein cleaved by SUMO protease. Lane M, low molecular weight marker; lane 1, purified SUMO-scolopin 1 fusion protein; lane 2, mixture of SUMO-scolopin 1 fusion protein by SUMO protease cleavage. (b) Tricine/ SDS–PAGE analysis of recombinant scolopin 1 purification. Lane M, low molecular weight marker; lane 1, scolopin 1 after the second Ni-column.
Table 1 Isolation of recombinant AMP-scolopin 1 from pSUMO-scolopin 1 fusion protein.a Purification step Sonicated supernatant After affinity chromatography After affinity chromatography Dialysis
Total protein (mg) b
850 160b NA NA
Fusion protein (mg) 128 95c 66b NA
c
NA not applicable. a Estimations are based on 1 l of bacterial culture (about 10 g wet weight). b Determined using a Bradford assay. c Percent of SUMO-scolopin 1 fusion protein from total proteins was estimated by SDS gel scanning. d The amount of AMP-scolopin 1 was calculated as a fraction of SUMO-scolopin 1 fusion protein. e Purity of protein or peptide was estimated by SDS gels stained by Coomassie Blue.
AMP-scolopin 1 (mg) d
35 28d 20d 16
Purity (%) NA NA NA >95%
e
H. Hou et al. / Protein Expression and Purification 92 (2013) 230–234 Table 2 The minimal inhibitory concentration of recombinant scolopin1 to selected microorganisms. Microorganisms
E. coli K12D31 Staphyloccocus aureu Aspergillus niger
Minimum inhibitory concentration (lM) Recombinant scolopin1
Synthetic scolopin1
10 6 6
10 5 7
233
of each purification step can be seen in Table 1. The results indicate that we successfully purified the fusion protein scolopin 1 and developed a new method for producing and purifying soluble scolopin1 in E. coli cells. Assay of antimicrobial activity The antimicrobial ability of the purified recombinant scolopin 1 was evaluated by determing its MICs against selected microorganisms (Table 2). Results showed the recombinant scolopin 1 had similar antimicrobial properties to the synthetic scolopin 1 (Fig. 5). The SEM experiments indicated that scolopin 1 progressively destroyed the bacterial envelope with the increase of concentration and caused the leakage of cell contents which led to cell death by binding to cell membranes of E. coli K12D31. Broadly speaking, the action of scolopin 1 resulted in a collapse of the bacterial envelope, particularly at the septal region. Some leaked contents and debris could also be detected around the partially disintegrated cells (Fig. 6). Discussion
Fig. 5. Antibacterial activity o f recombinant scolopin 1 against E. coli K12D31 by agar well assay. (1) The negative control, PBS. (2) Fusion protein sample (20 lM). (3) The positive control, synthetic scolopin 1 (20 lM). (4) Recombinant scolopin 1 solution (15 lM).
Cleavage and purification of recombinant AMP-scolopin 1 The SUMO-scolopin 1 protein (50 lg) was competently cleaved with a SUMO tag-specific protease (1 U) at 30 °C for 1 h, checked on a Tricine/SDS–PAGE. Following cleavage, the released peptide scolopin1 was further purified by using Ni-IDA affinity chromatography and the unbound scolopin 1 was collected. From the results of Tricine/SDS–PAGE an approximately 2.6 kDa band corresponding to recombinant scolopin 1 was observed (Fig. 4). The purity
It is known that centipedes live under rock piles and they usually come out at night to hunt their prey using their venoms, which are positioned in their forceps [13]. The work performed by Rates et al. showed us a neglected but important source of new bioactive compounds from centipede venoms [14]. AMP-scolopin 1 was first purified and characterized from the venoms of the centipede of S. s. mutilans. Its broad-spectrum activity against microorganisms, moderate hemolytic activities on human and rabbit red cells and release of histamine, all demonstrated the essential role in centipede innate immunity [6]. SUMO is superior to commonly used fusion tags in enhancing expression and solubility with the distinction of generating recombinant protein with native sequences [8,15]. In this paper, we successfully obtained the recombinant SUMO-scolopin 1 by SUMOmediated expression and purification system in E. coli as shown in Fig. 3. The appearance of the lower band in lane 1 was probably due to in vivo cleavage or in vitro degradation of the fusion protein as shown in Fig. 4a. In order to yield scolopin 1 with the correct amino terminus, the SUMO-scolopin 1 fusion protein was cleaved by the recommended SUMO protease, a small ubiquitin-like mod-
Fig. 6. Effect on E. coli K12D31 imaged by SEM. (A) The negative control, PBS, smooth surface. (B) 5 lM scolopin 1, membrane folds. (C) 10 lM scolopin 1, appearance of holes. (D) 20 lM scolopin 1, membrane blebbing.
234
H. Hou et al. / Protein Expression and Purification 92 (2013) 230–234
ifier protease that recognizes only the tertiary structure of SUMO and efficiently cleaves at the junction between SUMO and the protein of interest [16]. The SUMO-scolopin 1 fusion protein can be completely cleaved by SUMO protease as shown in Fig. 4. Conclusion We constructed an efficient system for the expression and purification of scolopin 1 in E. coli by the pSUMO expression vector. The recombinant strain can potentially be adapted for large scale production of biologically active antimicrobial peptide scolopin 1. The recombinant scolopin 1 had similar antimicrobial properties to the synthetic scolopin 1. The above provides us an efficient and convenient way to further study the antimicrobial mechanism and even the anticancer effect. Acknowledgments This research was financially supported by the National Natural Science Foundation of China (NSFC) Grant No. 31370401, the Natural Science Foundation of Jiangsu Province of China (No. BK2011074), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). References [1] M. Zasloff, Antimicrobial peptides of multicellular organisms, Nature 415 (2002) 389–395. [2] L.M. Rossi, P. Rangasamy, J. Zhang, X.Q. Qiu, G.Y. Wu, Research advances in the development of peptide antibiotics, J. Pharm. Sci. 97 (2008) 1060–1070.
[3] U. Muller, P. Vogel, G. Alber, G.A. Schaub, The innate immune system of mammals and insects, Contrib. Microbiol. 15 (2008) 21–44. [4] R.W. Pemberton, Insects and other arthropods used as drugs in Korean traditional medicine, J. Ethnopharmacol. 65 (1999) (1998) 207–216. [5] R. Wenhua, Z. Shuangquan, S. Daxiang, Z. Kaiya, Y. Guang, Induction, purification and characterization of an antibacterial peptide scolopendrin I from the venom of centipede Scolopendra subspinipes mutilans, Indian J. Biochem. Biophys. 43 (2006) 88–93. [6] K. Peng, Y. Kong, L. Zhai, X. Wu, P. Jia, J. Liu, H. Yu, Two novel antimicrobial peptides from centipede venoms, Toxicon 55 (2010) 274–279. [7] M. Satakarni, R. Curtis, Production of recombinant peptides as fusions with SUMO, Protein Expr. Purif. 78 (2011) 113–119. [8] T.R. Butt, S.C. Edavettal, J.P. Hall, M.R. Mattern, SUMO fusion technology for difficult-to-express proteins, Protein Expr. Purif. 43 (2005) 1–9. [9] L. Zhou, Q. Lin, B. Li, N. Li, S. Zhang, Expression and purification the antimicrobial peptide CM4 in Escherichia coli, Biotechnol. Lett. 31 (2009) 437–441. [10] J.F. Li, J. Zhang, R. Song, J.X. Zhang, Y. Shen, S.Q. Zhang, Production of a cytotoxic cationic antibacterial peptide in Escherichia coli using SUMO fusion partner, Appl. Microbiol. Biotechnol. 84 (2009) 383–388. [11] A.-Y.S. Hui Kang, Ya-Ling Shen, Dong-Zhi Wei, Refolding and structural characteristic of TRAIL/Apo2L inclusion bodies from different specific growth rates of recombinant Escherichia coli, Biotechnol. Prog. 23 (2007) 286–292. [12] Z. Xu, L. Peng, Z. Zhong, X. Fang, P. Cen, High-level expression of a soluble functional antimicrobial peptide, human beta-defensin 2, in Escherichia coli, Biotechnol. Prog. 22 (2006) 382–386. [13] M.B. Malta, M.S. Lira, S.L. Soares, G.C. Rocha, I. Knysak, R. Martins, S.P. Guizze, M.L. Santoro, K.C. Barbaro, Toxic activities of Brazilian centipede venoms, Toxicon 52 (2008) 255–263. [14] B. Rates, M.P. Bemquerer, M. Richardson, M.H. Borges, R.A. Morales, M.E. De Lima, A.M. Pimenta, Venomic analyses of Scolopendra viridicornis nigra and Scolopendra angulata (Centipede, Scolopendromorpha): shedding light on venoms from a neglected group, Toxicon 49 (2007) 810–826. [15] X. Zuo, S. Li, J. Hall, M.R. Mattern, H. Tran, J. Shoo, R. Tan, S.R. Weiss, T.R. Butt, Enhanced expression and purification of membrane proteins by SUMO fusion in Escherichia coli, J. Struct. Funct. Genomics 6 (2005) 103–111. [16] J.G. Marblestone, S.C. Edavettal, Y. Lim, P. Lim, X. Zuo, T.R. Butt, Comparison of SUMO fusion technology with traditional gene fusion systems: enhanced expression and solubility with SUMO, Protein Sci. 15 (2006) 182–189.
