G Model TTBDIS-277; No. of Pages 3
ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Short communication
Detection of Borrelia burgdorferi, Anaplasma phagocytophilum and Babesia microti, with two different multiplex PCR assays Andrias Hojgaard a,∗ , Gary Lukacik b , Joseph Piesman a a Division of Vector-Borne Diseases, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Fort Collins, CO, USA b New York State Department of Health, Bureau of Communicable Disease Control, Albany, NY, USA
a r t i c l e
i n f o
Article history: Received 3 June 2013 Received in revised form 20 December 2013 Accepted 31 December 2013 Available online xxx Keywords: Multiplex PCR Ticks Pathogens
a b s t r a c t We have developed 2 real-time multiplex PCR assays for detection of Borrelia burgdorferi, Anaplasma phagocytophilum, and Babesia microti. The efficiency and sensitivity of each multiplex PCR assay was evaluated using field-collected Ixodes scapularis ticks that were positive for each of the pathogens, cloned plasmids harboring each of the PCR targets, and laboratory I. scapularis infected with B. burgdorferi B31. There was no difference in efficiency or sensitivity when comparing the multiplex PCR with the individual PCR reactions. If the 2 multiplex PCR assays are used in the same analysis, field-collected ticks that only harbor B. miyamotoi can also be identified. The multiplex assays are fast and cost-effective methods for screening and detecting pathogens in ticks, when compared to single-target PCR. Published by Elsevier GmbH.
Introduction The blacklegged tick Ixodes scapularis is the principal vector of several pathogens of public health importance, including Borrelia burgdorferi (Lyme disease), Anaplasma phagocytophilum (human granulocytic anaplasmosis), and Babesia microti (human babesiosis) in eastern North America. These pathogens are maintained in nature through transmission cycles between ticks and vertebrate hosts. Risk of infection with these tick-borne agents varies widely across a north–south cline along the Atlantic seaboard (Diuk-Wasser et al., 2012). Therefore, knowledge of the local tick infection rates of these pathogens in different communities is of great importance for residents and physicians making prevention and treatment decisions (Piesman and Eisen, 2008). In addition to the 3 known I. scapularis pathogens listed above, Borrelia miyamotoi is a suspected human pathogen transmitted by this same tick species (Gugliotta et al., 2013). Accordingly, we developed a sensitive and specific TaqMan-based multiplex probe assay to detect B. burgdorferi, A. phagocytophilum, and Ba. microti in ticks, amplifying 2 targets from each pathogen. Two different multiplex assays were used, each multiplex targeting the 3 known pathogens in the same PCR reaction. Multiplex mix number 1 (M1) also targeted
∗ Corresponding author at: Centers for Disease Control and Prevention, Division of Vector Borne-Infectious Diseases, 3156 Rampart Road, Fort Collins, CO 80521, USA, Tel.: +1 970 221 6485. E-mail address: [email protected] (A. Hojgaard).
I. scapularis actin, which acts as a positive control for the DNA purification and PCR reaction. M1 had primers and probes for the following targets: flagellar filament cap (fliD) for B. burgdorferi, major surface protein 2 (msp2) for A. phagocytophilum, surface antigen 1 (sa1) for Ba. microti and actin for I. scapularis (Table 1). Multiplex mix number 2 (M2) had primers and probes for the following targets: genomic DNA (gB31) for B. burgdorferi, major surface protein 4 (msp4) for A. phagocytophilum, and 18S rDNA for Ba. microti (Table 1). The primers and probes for the fliD gene have been used in other studies (Zeidner et al., 2001; Dolan et al., 2011) as have primers and probes for msp2 (Courtney et al., 2004). Methods and materials Nucleic acids were isolated from ticks using DNeasy Blood and Tissue kit (Qiagen, USA) and a Mini-Beadbeater (Biospec, USA). The protocol was a modification of Crowder et al. (2010); one tick was added to a 0.5-ml free standing screw cap tube (Fisher Scientific, USA) with 450 l ATL buffer, 20 l proteinase K, 10 g Polyadenylic Acid (Amersham Bioscience, USA), 400 mg 2.0 mm zirconia beads (Biospec), 90 mg 0.1 mm zirconia/silica beads (Biospec), processed with the Mini-Beater (Biospec) for 4 min, and incubated for 15 min at 56 ◦ C. Following incubation, the sample was centrifuged at 6000 × g for 1 min, and 425 l of the sample was mixed with 425 l AL buffer and incubated at 70 ◦ C for 10 min. After incubation, the sample was centrifuged at 20,000 × g for 20 s and processed with a QIAcube (Qiagen) with the program QIAampMinEluteSpin LargeBodyFluidSamples ManualLysis V2 (Qiagen). At the final
1877-959X/$ – see front matter. Published by Elsevier GmbH. http://dx.doi.org/10.1016/j.ttbdis.2013.12.001
Please cite this article in press as: Hojgaard, A., et al., Detection of Borrelia burgdorferi, Anaplasma phagocytophilum and Babesia microti, with two different multiplex PCR assays. Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2013.12.001
G Model TTBDIS-277; No. of Pages 3
ARTICLE IN PRESS A. Hojgaard et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
2 Table 1 Primers and probes used in this study. Primers and probes
Sequence 5 –3 b
M1 mix fliD-Fa fliD-Ra fliD-probea msp2-Fb msp2-Rb msp2-probeb sa1-F sa1-R sa1-probe Actin-F Actin-R Actin-probe
TGGTGACAGAGTGTATGATAATGGAA ACTCCTCCGGAAGCCACAA FAM-TGCTAAAATGCTAGGAGATTGTCTGTCGCC-BHQ1 ATGGAAGGTAGTGTTGGTTATGGTATT TTGGTCTTGAAGCGCTCGTA HEX-TGGTGCCAGGGTTGAGCTTGAGATTG-BHQ1 ACAGAATGCAGTCGGTGAAG ATCAAGGAGAGTGGATAGGTTTG CalRd610-CCATTGACGCTGTTGTTGCTCACA-BHQ2 GCCCTGGACTCCGAGCAG CCGTCGGGAAGCTCGTAGG Quas705-CCACCGCCGCCTCCTCTTCTTCC-BHQ3
M2 mix gB31-F gB31-R gB31-probe msp4-F msp4-R msp4-probe 18S-F 18S-R 18S-probe
GTTGGTAGAGCGTCGGGTTG GGAGTCGAACCTGCAACCTTC FAM-TCCGAATGTCGCGGGTTCAAGCCC-BHQ1 TATATCCAACTTCAACTTCCACTC CATTCAAGTTCGCTAAGAGTTTAC HEX-CAGATCCTGCCAGCTTCACGCAACA-BHQ1 CGACTACGTCCCTGCCCTTTG ACGAAGGACGAATCCACGTTTC Quas705-ACACCGCCCGTCGCTCCTACCG-BHQ3
B. miyamotoi flaB-F flaB-R glpQ-F glpQ-R 16S-18S IGS IGS-F IGS-R
Location
GenBank accession no.
714–733 828–806 743–766 310–327 386–368 335–357
JX112361 JX112361 JX112361 AF426178 AF426178 AF426178
636158–636177 636303–636283 636182–636205 1310326–1310349 1310418–1310395 1310451–1310427 1581–1601 1679–1658 1605–1626
NC 001318 NC 001318 NC 001318 CP000235 CP000235 CP000235 AY693840 AY693840 AY693840
GCTTCATGGACATTGAGAGTGC CTGCTGGAGCTGGAACTGC GGTGCTAGTGGGTATCTTCC TGTGGTTGTGTCAATTTCTGG
805–826 973–955 109–128 255–235
D43777 D43777 AY368276 AY368276
CCTGAGGTCGGATGTTCAACTC GCAAGCCGAGGGTCAAGG
443663–443684 444374–444357
NC 001318 NC 001318
a
Zeidner et al. (2001), Dolan et al. (2011), and Courtney et al. (2004). HEX, hexachlorofluorescein phosphoramidite; FAM, 6-carboxyfluorescein; CalRd610, CalFluor Red 610; Quas705, Quasar 705; BHQ1, BHQ2 and BHQ3 is Black Hole Quencher 1, 2, and 3, respectively. b
step, 75 l of AE was used to elute the sample. The multiplex PCR reactions were performed in 15 l solutions with 7.5 l iQ Multiplex Powermix (BioRad, USA), 7.2 l tick extract (∼10% of total sample), forward and reverse primers in a final concentration of 300 nM each, and probes in a final concentration of 200 nM. The PCR cycling conditions for both M1 and M2 consisted of denature DNA at 95 ◦ C for 3 min followed by 40 cycles of 95 ◦ C for 10 s, and 60 ◦ C for 1 min on a C1000 Touch thermal cycler with a CFX96 real time system (BioRad). Gene-specific primers for flaB and glpQ (Table 1) in B. miyamotoi were targeted in a 15 l SYBR green assay using 7.5 l 2× SsoAdvanced SYBR green supermix (BioRad), 5 l tick extract, 2.5 l H2 O, and 200 nM primers. The PCR cycling conditions for both flaB and glpQ consisted of denature DNA at 98 ◦ C for 2 min, followed by 40 cycles of 98 ◦ C for 5 s, 62 ◦ C for 10 s, 72 ◦ C for 30 s, and finally a melting curve analysis step on a C1000 Touch thermal cycler with a CFX96 real-time system (BioRad). In order to PCR-amplify a fragment within the intergenic spacer (IGS) between 16S and 23S of Borrelia, primers that would recognize B. burgdorferi and B. miyamotoi (Table 1) were used. The IGS PCR reactions were performed in 25 l with 12.5 l 2× Sso Advanced SYBR Green (BioRad, USA), 5 l tick extract, a final concentration of 200 nM for each primer (Table 1) and 7.5 l H2 O. The PCR cycling conditions consisted of denature DNA at 98 ◦ C for 2 min, followed by 40 cycles of 98 ◦ C for 5 s, 60 ◦ C for 10 s, and 72 ◦ C for 45 s on a C1000 Touch thermal cycler (BioRad). The IGS PCR products were extracted from a 2% agarose gel using Freeze ‘N Squeeze DNA extraction columns (BioRad). The agarose gel extracted products were sequenced using BigDye terminator cycle sequencing kit (Applied Biosystems, USA). Plasmids were constructed for determining the sensitivity of each of the PCR targets in each of the 2 multiplex mixes, M1 and M2. DNA from cultured B. burgdorferi (B31), A. phagocytophilum (USG3), and
Ba. microti (DPD1737*) was used as template in PCR reactions for generating positive controls for each of the targets in M1 and M2. Each of the specific PCR products was extracted from a 2% agarose gel using Freeze ‘N Squeeze DNA extraction columns (BioRad). The agarose gel-extracted products were cloned into the pCR2.1-Topo vector with a TOPO TA cloning kit (Invitrogen, USA) and sequenced using BigDye terminator cycle sequencing kit (Applied Biosystems). Plasmids with the correct insert were then used as template for determining the sensitivity of all the PCR assays. Results The efficiency of the PCR reactions was determined by making serial dilutions of field-collected ticks that were infected with B. burgdorferi, A. phagocytophilum, Ba. microti, or dually infected by B. burgdorferi and Ba. microti. The efficiencies of all the targets were between 90 and 110% with slopes between −3.1 and −3.6. To investigate any possible PCR interference/inhibition caused by the multiple primers in the multiplex samples, we compared TaqMan PCR reactions that had primers for only one target (fliD, msp2, sa1, gB31, msp4 or 18S) with the 2 multiplexes M1 and M2. A total of 83 ng of genomic DNA from clean laboratory-colony I. scapularis nymphs was spiked with 40 pg of genomic DNA from cultured B. burgdorferi (B31), 60 pg of genomic DNA from cultured A. phagocytophilum (USG3), or 200 pg of genomic DNA from cultured Ba. microti (DPD1737*). Six samples were made for each of the pathogens and 2 samples with only I. scapularis DNA. The largest difference between the individual PCR reactions and the multiplex PCR reaction for the mean Ct value was 0.21 for the sa1 target, and the smallest was 0.02 for the 18S target (Table 2). The plasmids that were constructed to determine the sensitivity of the PCR
Please cite this article in press as: Hojgaard, A., et al., Detection of Borrelia burgdorferi, Anaplasma phagocytophilum and Babesia microti, with two different multiplex PCR assays. Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2013.12.001
ARTICLE IN PRESS
G Model TTBDIS-277; No. of Pages 3
A. Hojgaard et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx Table 2 Comparing Ct values for the individual PCR reactions and the multiplex PCR reactions. Target
Individual PCR *
fliD gB31 msp2 msp4 sa1 18S *
Mean Ct
28.67 27.12 24.66 28.08 25.48 24.75
Multiplex PCR Range 28.42–28.86 26.95–27.36 24.43–24.91 27.68–28.29 25.07–25.80 24.55–24.96
*
Mean Ct
28.47 27.28 24.7 28.16 25.27 24.73
Range 28.23–28.83 27.08–27.40 24.46–24.90 28.07–28.35 24.89–25.51 24.32–25.02
Data represent the mean from 6 replicates.
reactions (Materials and methods section) were serially diluted from 100 copies/PCR reaction down to 5 copies/PCR reaction, to determine the lower limit of detection (LOD) to be between 20 and 10 plasmid copies per PCR reaction. This was the same for all targets whether the PCR reaction was done with one primer set or in a multiplex reaction with several primers. The 2 multiplex mixes M1 and M2 were used to screen 185 nymphal I. scapularis that were collected in New York State. Out of the 185 ticks that were tested, 30 were infected with only B. burgdorferi, 7 with only A. phagocytophilum, 7 with only Ba. microti, and 8 were dually infected with B. burgdorferi and Ba. microti. Discussion The PCR reactions used for the 2 multiplexes, M1 and M2, were very efficient (between 90 and 110%) when detecting B. burgdorferi, A. phagocytophilum, and Ba. microti in multiplex PCR reactions, where a serial dilution of DNA from field-collected I. scapularis was used as template. No change in the LOD was observed when we compared PCR reactions using M1 or M2 with PCR reactions using only primers for the individual targets. We also did not observe any PCR interference/inhibition caused by the multiple primers in the multiplex PCR mixes, in the 20 samples tested containing I. scapularis DNA spiked with DNA from either B. burgdorferi, A. phagocytophilum, or Ba. microti. Not only were all 20 samples correctly identified in all the PCR reactions, but more importantly there was no interference in the multiplex samples when comparing the Ct values for the individual PCR reactions with the multiplex PCR reactions (Table 2). When testing 185 field-collected nymphal I. scapularis with M1 and M2, we found 100% concordance between the 2 multiplexes for detection of A. phagocytophilum and Ba. microti. There was one example where a sample was positive for gB31 (M2), but negative for fliD (M1). That sample was subsequently tested in a PCR reaction using B. miyamotoi-specific primers for flaB and glpQ (Table 1) and found positive for both targets, indicating the presence of B. miyamotoi. The sample was further analyzed by amplifying and sequencing a segment within the Borrelia IGS region between 23S rDNA and 16S rDNA. By using the IGS primers in Table 1, we identified a product (KF155898) that was 376 bp long and had 99% homology to B. miyamotoi (GQ856588). We had in our DNA collection I. scapularis DNA extracts that had previously tested positive for
3
glpQ in a PCR reaction using the same primers as mentioned above. When these same samples were analyzed using M1 and M2, they were all positive for gB31 (M2), whereas fliD (M1) was sometimes positive and sometimes negative. In ticks with B. miyamotoi alone, M1 will be fliD-negative and M2 will be gB31-positive. In samples dually infected, both fliD and gB31 will be positive; however in samples with B. burgdorferi alone both fliD and gB31 are also positive. An additional definitive assay with glpQ will have to be performed to discriminate dually-infected ticks from those infected with B. burgdorferi alone. We are working to develop primers and probes that are specific for B. miyamotoi that can be added to one of the 2 multiplex assays M1 or M2. In summary, we have developed a dual multiplex PCR assay for the detection of 3 tick-borne pathogens. By using the M1 multiplex alone, B. burgdorferi, A. phagocytophilum, and Ba. microti can be identified in one PCR reaction; this is both cost-effective for reagents and less labor-intensive, as compared to performing 4 individual PCR reactions. A second multiplex M2 can be used to confirm the results obtained in the first M1 multiplex. By comparing the Ct values for the Borrelia targets (fliD and gB31), it is possible to also identify B. miyamotoi when the tick is infected with only one Borrelia genospecies. Acknowledgments We thank Norman J. Pieniazek for providing Babesia microti DNA, and William Nicholson for providing Anaplasma phagocytophilum DNA for this study. We also thank Ashley Kay and Alison Hinckley for helpful discussion and Bryon Backenson, Jennifer White, Wilson Miranda, John Kokas, and Rich Falco for their assistance in collecting specimens used in developing the assay. *DNA was extracted from a patient blood sample diagnosed with Ba. microti by Norman Pieniazek and given ref # 1737 by CDC Div Parasitic Dis. References Courtney, J.W., Kostelnik, L.M., Zeidner, N.S., Massung, R.F., 2004. Multiplex realtime PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 42, 3164–3168. Crowder, C.D., Rounds, M.A., Phillipson, C.A., Picuri, J.M., Matthews, H.E., Halverson, J., Schutzer, S.E., Ecker, D.J., Eshoo, M.W., 2010. Extraction of total nucleic acids from ticks for the detection of bacterial and viral pathogens. J. Med. Entomol. 47, 89–94. Dolan, M.C., Schulze, T.L., Jordan, R.A., Dietrich, G., Schulze, C.J., Hojgaard, A., Ullmann, A.J., Sackal, C., Zeidner, N.S., Piesman, J., 2011. Elimination of Borrelia burgdorferi and Anaplasma phagocytophilum in rodent reservoirs and Ixodes scapularis ticks using a doxycycline hyclate-laden bait. Am. J. Trop. Med. Hyg. 85, 1114–1120. Diuk-Wasser, M.A., Hoen, A.G., Cislo, P., Brinkerhoff, R., Hamer, S.A., Rowland, M., Cortinas, R., Vourc’h, G., Melton, F., Hickling, G.J., Tsao, J.I., Bunikis, J., Barbour, A.G., Kitron, U., Piesman, J., Fish, D., 2012. Human risk of infection with Borrelia burgdorferi, the Lyme disease agent, in eastern United States. Am. J. Trop. Med. Hyg. 86, 320–327. Gugliotta, J.L., Goethert, H.K., Berardi, V.P., Telford III, S.R., 2013. Meningoencephaltis from Borrelia miyamotoi in an immunocompromised patient. N. Engl. J. Med. 368, 240–245. Piesman, J., Eisen, L., 2008. Prevention of tick-borne diseases. Annu. Rev. Entomol. 53, 323–343. Zeidner, N.S., Schneider, B.S., Dolan, M.C., Piesman, J., 2001. An analysis of spirochete load, strain, and pathology in a model of tick-transmitted Lyme borreliosis. Vector Borne Zoonotic Dis 1, 35–44.
Please cite this article in press as: Hojgaard, A., et al., Detection of Borrelia burgdorferi, Anaplasma phagocytophilum and Babesia microti, with two different multiplex PCR assays. Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2013.12.001
ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Short communication
Detection of Borrelia burgdorferi, Anaplasma phagocytophilum and Babesia microti, with two different multiplex PCR assays Andrias Hojgaard a,∗ , Gary Lukacik b , Joseph Piesman a a Division of Vector-Borne Diseases, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Fort Collins, CO, USA b New York State Department of Health, Bureau of Communicable Disease Control, Albany, NY, USA
a r t i c l e
i n f o
Article history: Received 3 June 2013 Received in revised form 20 December 2013 Accepted 31 December 2013 Available online xxx Keywords: Multiplex PCR Ticks Pathogens
a b s t r a c t We have developed 2 real-time multiplex PCR assays for detection of Borrelia burgdorferi, Anaplasma phagocytophilum, and Babesia microti. The efficiency and sensitivity of each multiplex PCR assay was evaluated using field-collected Ixodes scapularis ticks that were positive for each of the pathogens, cloned plasmids harboring each of the PCR targets, and laboratory I. scapularis infected with B. burgdorferi B31. There was no difference in efficiency or sensitivity when comparing the multiplex PCR with the individual PCR reactions. If the 2 multiplex PCR assays are used in the same analysis, field-collected ticks that only harbor B. miyamotoi can also be identified. The multiplex assays are fast and cost-effective methods for screening and detecting pathogens in ticks, when compared to single-target PCR. Published by Elsevier GmbH.
Introduction The blacklegged tick Ixodes scapularis is the principal vector of several pathogens of public health importance, including Borrelia burgdorferi (Lyme disease), Anaplasma phagocytophilum (human granulocytic anaplasmosis), and Babesia microti (human babesiosis) in eastern North America. These pathogens are maintained in nature through transmission cycles between ticks and vertebrate hosts. Risk of infection with these tick-borne agents varies widely across a north–south cline along the Atlantic seaboard (Diuk-Wasser et al., 2012). Therefore, knowledge of the local tick infection rates of these pathogens in different communities is of great importance for residents and physicians making prevention and treatment decisions (Piesman and Eisen, 2008). In addition to the 3 known I. scapularis pathogens listed above, Borrelia miyamotoi is a suspected human pathogen transmitted by this same tick species (Gugliotta et al., 2013). Accordingly, we developed a sensitive and specific TaqMan-based multiplex probe assay to detect B. burgdorferi, A. phagocytophilum, and Ba. microti in ticks, amplifying 2 targets from each pathogen. Two different multiplex assays were used, each multiplex targeting the 3 known pathogens in the same PCR reaction. Multiplex mix number 1 (M1) also targeted
∗ Corresponding author at: Centers for Disease Control and Prevention, Division of Vector Borne-Infectious Diseases, 3156 Rampart Road, Fort Collins, CO 80521, USA, Tel.: +1 970 221 6485. E-mail address: [email protected] (A. Hojgaard).
I. scapularis actin, which acts as a positive control for the DNA purification and PCR reaction. M1 had primers and probes for the following targets: flagellar filament cap (fliD) for B. burgdorferi, major surface protein 2 (msp2) for A. phagocytophilum, surface antigen 1 (sa1) for Ba. microti and actin for I. scapularis (Table 1). Multiplex mix number 2 (M2) had primers and probes for the following targets: genomic DNA (gB31) for B. burgdorferi, major surface protein 4 (msp4) for A. phagocytophilum, and 18S rDNA for Ba. microti (Table 1). The primers and probes for the fliD gene have been used in other studies (Zeidner et al., 2001; Dolan et al., 2011) as have primers and probes for msp2 (Courtney et al., 2004). Methods and materials Nucleic acids were isolated from ticks using DNeasy Blood and Tissue kit (Qiagen, USA) and a Mini-Beadbeater (Biospec, USA). The protocol was a modification of Crowder et al. (2010); one tick was added to a 0.5-ml free standing screw cap tube (Fisher Scientific, USA) with 450 l ATL buffer, 20 l proteinase K, 10 g Polyadenylic Acid (Amersham Bioscience, USA), 400 mg 2.0 mm zirconia beads (Biospec), 90 mg 0.1 mm zirconia/silica beads (Biospec), processed with the Mini-Beater (Biospec) for 4 min, and incubated for 15 min at 56 ◦ C. Following incubation, the sample was centrifuged at 6000 × g for 1 min, and 425 l of the sample was mixed with 425 l AL buffer and incubated at 70 ◦ C for 10 min. After incubation, the sample was centrifuged at 20,000 × g for 20 s and processed with a QIAcube (Qiagen) with the program QIAampMinEluteSpin LargeBodyFluidSamples ManualLysis V2 (Qiagen). At the final
1877-959X/$ – see front matter. Published by Elsevier GmbH. http://dx.doi.org/10.1016/j.ttbdis.2013.12.001
Please cite this article in press as: Hojgaard, A., et al., Detection of Borrelia burgdorferi, Anaplasma phagocytophilum and Babesia microti, with two different multiplex PCR assays. Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2013.12.001
G Model TTBDIS-277; No. of Pages 3
ARTICLE IN PRESS A. Hojgaard et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
2 Table 1 Primers and probes used in this study. Primers and probes
Sequence 5 –3 b
M1 mix fliD-Fa fliD-Ra fliD-probea msp2-Fb msp2-Rb msp2-probeb sa1-F sa1-R sa1-probe Actin-F Actin-R Actin-probe
TGGTGACAGAGTGTATGATAATGGAA ACTCCTCCGGAAGCCACAA FAM-TGCTAAAATGCTAGGAGATTGTCTGTCGCC-BHQ1 ATGGAAGGTAGTGTTGGTTATGGTATT TTGGTCTTGAAGCGCTCGTA HEX-TGGTGCCAGGGTTGAGCTTGAGATTG-BHQ1 ACAGAATGCAGTCGGTGAAG ATCAAGGAGAGTGGATAGGTTTG CalRd610-CCATTGACGCTGTTGTTGCTCACA-BHQ2 GCCCTGGACTCCGAGCAG CCGTCGGGAAGCTCGTAGG Quas705-CCACCGCCGCCTCCTCTTCTTCC-BHQ3
M2 mix gB31-F gB31-R gB31-probe msp4-F msp4-R msp4-probe 18S-F 18S-R 18S-probe
GTTGGTAGAGCGTCGGGTTG GGAGTCGAACCTGCAACCTTC FAM-TCCGAATGTCGCGGGTTCAAGCCC-BHQ1 TATATCCAACTTCAACTTCCACTC CATTCAAGTTCGCTAAGAGTTTAC HEX-CAGATCCTGCCAGCTTCACGCAACA-BHQ1 CGACTACGTCCCTGCCCTTTG ACGAAGGACGAATCCACGTTTC Quas705-ACACCGCCCGTCGCTCCTACCG-BHQ3
B. miyamotoi flaB-F flaB-R glpQ-F glpQ-R 16S-18S IGS IGS-F IGS-R
Location
GenBank accession no.
714–733 828–806 743–766 310–327 386–368 335–357
JX112361 JX112361 JX112361 AF426178 AF426178 AF426178
636158–636177 636303–636283 636182–636205 1310326–1310349 1310418–1310395 1310451–1310427 1581–1601 1679–1658 1605–1626
NC 001318 NC 001318 NC 001318 CP000235 CP000235 CP000235 AY693840 AY693840 AY693840
GCTTCATGGACATTGAGAGTGC CTGCTGGAGCTGGAACTGC GGTGCTAGTGGGTATCTTCC TGTGGTTGTGTCAATTTCTGG
805–826 973–955 109–128 255–235
D43777 D43777 AY368276 AY368276
CCTGAGGTCGGATGTTCAACTC GCAAGCCGAGGGTCAAGG
443663–443684 444374–444357
NC 001318 NC 001318
a
Zeidner et al. (2001), Dolan et al. (2011), and Courtney et al. (2004). HEX, hexachlorofluorescein phosphoramidite; FAM, 6-carboxyfluorescein; CalRd610, CalFluor Red 610; Quas705, Quasar 705; BHQ1, BHQ2 and BHQ3 is Black Hole Quencher 1, 2, and 3, respectively. b
step, 75 l of AE was used to elute the sample. The multiplex PCR reactions were performed in 15 l solutions with 7.5 l iQ Multiplex Powermix (BioRad, USA), 7.2 l tick extract (∼10% of total sample), forward and reverse primers in a final concentration of 300 nM each, and probes in a final concentration of 200 nM. The PCR cycling conditions for both M1 and M2 consisted of denature DNA at 95 ◦ C for 3 min followed by 40 cycles of 95 ◦ C for 10 s, and 60 ◦ C for 1 min on a C1000 Touch thermal cycler with a CFX96 real time system (BioRad). Gene-specific primers for flaB and glpQ (Table 1) in B. miyamotoi were targeted in a 15 l SYBR green assay using 7.5 l 2× SsoAdvanced SYBR green supermix (BioRad), 5 l tick extract, 2.5 l H2 O, and 200 nM primers. The PCR cycling conditions for both flaB and glpQ consisted of denature DNA at 98 ◦ C for 2 min, followed by 40 cycles of 98 ◦ C for 5 s, 62 ◦ C for 10 s, 72 ◦ C for 30 s, and finally a melting curve analysis step on a C1000 Touch thermal cycler with a CFX96 real-time system (BioRad). In order to PCR-amplify a fragment within the intergenic spacer (IGS) between 16S and 23S of Borrelia, primers that would recognize B. burgdorferi and B. miyamotoi (Table 1) were used. The IGS PCR reactions were performed in 25 l with 12.5 l 2× Sso Advanced SYBR Green (BioRad, USA), 5 l tick extract, a final concentration of 200 nM for each primer (Table 1) and 7.5 l H2 O. The PCR cycling conditions consisted of denature DNA at 98 ◦ C for 2 min, followed by 40 cycles of 98 ◦ C for 5 s, 60 ◦ C for 10 s, and 72 ◦ C for 45 s on a C1000 Touch thermal cycler (BioRad). The IGS PCR products were extracted from a 2% agarose gel using Freeze ‘N Squeeze DNA extraction columns (BioRad). The agarose gel extracted products were sequenced using BigDye terminator cycle sequencing kit (Applied Biosystems, USA). Plasmids were constructed for determining the sensitivity of each of the PCR targets in each of the 2 multiplex mixes, M1 and M2. DNA from cultured B. burgdorferi (B31), A. phagocytophilum (USG3), and
Ba. microti (DPD1737*) was used as template in PCR reactions for generating positive controls for each of the targets in M1 and M2. Each of the specific PCR products was extracted from a 2% agarose gel using Freeze ‘N Squeeze DNA extraction columns (BioRad). The agarose gel-extracted products were cloned into the pCR2.1-Topo vector with a TOPO TA cloning kit (Invitrogen, USA) and sequenced using BigDye terminator cycle sequencing kit (Applied Biosystems). Plasmids with the correct insert were then used as template for determining the sensitivity of all the PCR assays. Results The efficiency of the PCR reactions was determined by making serial dilutions of field-collected ticks that were infected with B. burgdorferi, A. phagocytophilum, Ba. microti, or dually infected by B. burgdorferi and Ba. microti. The efficiencies of all the targets were between 90 and 110% with slopes between −3.1 and −3.6. To investigate any possible PCR interference/inhibition caused by the multiple primers in the multiplex samples, we compared TaqMan PCR reactions that had primers for only one target (fliD, msp2, sa1, gB31, msp4 or 18S) with the 2 multiplexes M1 and M2. A total of 83 ng of genomic DNA from clean laboratory-colony I. scapularis nymphs was spiked with 40 pg of genomic DNA from cultured B. burgdorferi (B31), 60 pg of genomic DNA from cultured A. phagocytophilum (USG3), or 200 pg of genomic DNA from cultured Ba. microti (DPD1737*). Six samples were made for each of the pathogens and 2 samples with only I. scapularis DNA. The largest difference between the individual PCR reactions and the multiplex PCR reaction for the mean Ct value was 0.21 for the sa1 target, and the smallest was 0.02 for the 18S target (Table 2). The plasmids that were constructed to determine the sensitivity of the PCR
Please cite this article in press as: Hojgaard, A., et al., Detection of Borrelia burgdorferi, Anaplasma phagocytophilum and Babesia microti, with two different multiplex PCR assays. Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2013.12.001
ARTICLE IN PRESS
G Model TTBDIS-277; No. of Pages 3
A. Hojgaard et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx Table 2 Comparing Ct values for the individual PCR reactions and the multiplex PCR reactions. Target
Individual PCR *
fliD gB31 msp2 msp4 sa1 18S *
Mean Ct
28.67 27.12 24.66 28.08 25.48 24.75
Multiplex PCR Range 28.42–28.86 26.95–27.36 24.43–24.91 27.68–28.29 25.07–25.80 24.55–24.96
*
Mean Ct
28.47 27.28 24.7 28.16 25.27 24.73
Range 28.23–28.83 27.08–27.40 24.46–24.90 28.07–28.35 24.89–25.51 24.32–25.02
Data represent the mean from 6 replicates.
reactions (Materials and methods section) were serially diluted from 100 copies/PCR reaction down to 5 copies/PCR reaction, to determine the lower limit of detection (LOD) to be between 20 and 10 plasmid copies per PCR reaction. This was the same for all targets whether the PCR reaction was done with one primer set or in a multiplex reaction with several primers. The 2 multiplex mixes M1 and M2 were used to screen 185 nymphal I. scapularis that were collected in New York State. Out of the 185 ticks that were tested, 30 were infected with only B. burgdorferi, 7 with only A. phagocytophilum, 7 with only Ba. microti, and 8 were dually infected with B. burgdorferi and Ba. microti. Discussion The PCR reactions used for the 2 multiplexes, M1 and M2, were very efficient (between 90 and 110%) when detecting B. burgdorferi, A. phagocytophilum, and Ba. microti in multiplex PCR reactions, where a serial dilution of DNA from field-collected I. scapularis was used as template. No change in the LOD was observed when we compared PCR reactions using M1 or M2 with PCR reactions using only primers for the individual targets. We also did not observe any PCR interference/inhibition caused by the multiple primers in the multiplex PCR mixes, in the 20 samples tested containing I. scapularis DNA spiked with DNA from either B. burgdorferi, A. phagocytophilum, or Ba. microti. Not only were all 20 samples correctly identified in all the PCR reactions, but more importantly there was no interference in the multiplex samples when comparing the Ct values for the individual PCR reactions with the multiplex PCR reactions (Table 2). When testing 185 field-collected nymphal I. scapularis with M1 and M2, we found 100% concordance between the 2 multiplexes for detection of A. phagocytophilum and Ba. microti. There was one example where a sample was positive for gB31 (M2), but negative for fliD (M1). That sample was subsequently tested in a PCR reaction using B. miyamotoi-specific primers for flaB and glpQ (Table 1) and found positive for both targets, indicating the presence of B. miyamotoi. The sample was further analyzed by amplifying and sequencing a segment within the Borrelia IGS region between 23S rDNA and 16S rDNA. By using the IGS primers in Table 1, we identified a product (KF155898) that was 376 bp long and had 99% homology to B. miyamotoi (GQ856588). We had in our DNA collection I. scapularis DNA extracts that had previously tested positive for
3
glpQ in a PCR reaction using the same primers as mentioned above. When these same samples were analyzed using M1 and M2, they were all positive for gB31 (M2), whereas fliD (M1) was sometimes positive and sometimes negative. In ticks with B. miyamotoi alone, M1 will be fliD-negative and M2 will be gB31-positive. In samples dually infected, both fliD and gB31 will be positive; however in samples with B. burgdorferi alone both fliD and gB31 are also positive. An additional definitive assay with glpQ will have to be performed to discriminate dually-infected ticks from those infected with B. burgdorferi alone. We are working to develop primers and probes that are specific for B. miyamotoi that can be added to one of the 2 multiplex assays M1 or M2. In summary, we have developed a dual multiplex PCR assay for the detection of 3 tick-borne pathogens. By using the M1 multiplex alone, B. burgdorferi, A. phagocytophilum, and Ba. microti can be identified in one PCR reaction; this is both cost-effective for reagents and less labor-intensive, as compared to performing 4 individual PCR reactions. A second multiplex M2 can be used to confirm the results obtained in the first M1 multiplex. By comparing the Ct values for the Borrelia targets (fliD and gB31), it is possible to also identify B. miyamotoi when the tick is infected with only one Borrelia genospecies. Acknowledgments We thank Norman J. Pieniazek for providing Babesia microti DNA, and William Nicholson for providing Anaplasma phagocytophilum DNA for this study. We also thank Ashley Kay and Alison Hinckley for helpful discussion and Bryon Backenson, Jennifer White, Wilson Miranda, John Kokas, and Rich Falco for their assistance in collecting specimens used in developing the assay. *DNA was extracted from a patient blood sample diagnosed with Ba. microti by Norman Pieniazek and given ref # 1737 by CDC Div Parasitic Dis. References Courtney, J.W., Kostelnik, L.M., Zeidner, N.S., Massung, R.F., 2004. Multiplex realtime PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 42, 3164–3168. Crowder, C.D., Rounds, M.A., Phillipson, C.A., Picuri, J.M., Matthews, H.E., Halverson, J., Schutzer, S.E., Ecker, D.J., Eshoo, M.W., 2010. Extraction of total nucleic acids from ticks for the detection of bacterial and viral pathogens. J. Med. Entomol. 47, 89–94. Dolan, M.C., Schulze, T.L., Jordan, R.A., Dietrich, G., Schulze, C.J., Hojgaard, A., Ullmann, A.J., Sackal, C., Zeidner, N.S., Piesman, J., 2011. Elimination of Borrelia burgdorferi and Anaplasma phagocytophilum in rodent reservoirs and Ixodes scapularis ticks using a doxycycline hyclate-laden bait. Am. J. Trop. Med. Hyg. 85, 1114–1120. Diuk-Wasser, M.A., Hoen, A.G., Cislo, P., Brinkerhoff, R., Hamer, S.A., Rowland, M., Cortinas, R., Vourc’h, G., Melton, F., Hickling, G.J., Tsao, J.I., Bunikis, J., Barbour, A.G., Kitron, U., Piesman, J., Fish, D., 2012. Human risk of infection with Borrelia burgdorferi, the Lyme disease agent, in eastern United States. Am. J. Trop. Med. Hyg. 86, 320–327. Gugliotta, J.L., Goethert, H.K., Berardi, V.P., Telford III, S.R., 2013. Meningoencephaltis from Borrelia miyamotoi in an immunocompromised patient. N. Engl. J. Med. 368, 240–245. Piesman, J., Eisen, L., 2008. Prevention of tick-borne diseases. Annu. Rev. Entomol. 53, 323–343. Zeidner, N.S., Schneider, B.S., Dolan, M.C., Piesman, J., 2001. An analysis of spirochete load, strain, and pathology in a model of tick-transmitted Lyme borreliosis. Vector Borne Zoonotic Dis 1, 35–44.
Please cite this article in press as: Hojgaard, A., et al., Detection of Borrelia burgdorferi, Anaplasma phagocytophilum and Babesia microti, with two different multiplex PCR assays. Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2013.12.001
