Journal of Vector Ecology
180
June 2015
Detection of Borrelia burgdorferi and Anaplasma phagocytophilum in the black-legged tick, Ixodes scapularis, within southwestern Pennsylvania Scott M. Brown1, Preston M. Lehman, Ryan A. Kern, and Jill D. Henning University of Pittsburgh at Johnstown, Johnstown, PA 15904, U.S.A., [email protected] 1 Present address: Windber Research Institute, Windber, Pennsylvania Received 16 October 2014; Accepted 18 February 2015 ABSTRACT: Prevalence studies of Borrelia burgdorferi and Anaplasma phagocytophilum have been rare for ticks from southwestern Pennsylvania. We collected 325 Ixodes scapularis ticks between 2011 and 2012 from four counties in southwestern Pennsylvania. We tested for the presence of Borrelia burgdorferi and Anaplasma phagocytophilum using PCR. Of the ticks collected from Pennsylvania, B. burgdorferi (causative agent of Lyme disease) was present in 114/325 (35%) and Anaplasma phagocytophilum (causative agent of Human Granulocytic Anaplasmosis) was present in 48/325 (15%) as determined by PCR analysis. Journal of Vector Ecology 40 (1): 180-183. 2015. Keyword Index: Borrelia burgdorferi, Anaplasma phagocytophilum, PCR. INTRODUCTION The black-legged tick, Ixodes scapularis, is a vector of several diseases including Lyme disease and human granulocytic anaplasmosis (HGA) in the northeastern United States (Swanson et al. 2006). Borrelia burgdorferi and Anaplasma phagocytophilum are the bacteria responsible for Lyme disease and HGA, respectively. Ideal conditions for the transmission of Lyme disease and HGA to humans exist in the region, owing to the woodlands, rivers, growing white-tailed deer population (Odocoileus virginianus), plentiful populations of the white-footed mouse (Peromyscus leucopusor), and expansion of human populations into the habitat of the black-legged tick (Guerra et al. 2002). B. burgdorferi is a spirochete, an extremely motile, spiralshaped bacterium (Steere et al. 2004), while A. phagocytophilum is a small, gram-negative bacterium (Walker and Dumler 1996). Black-legged ticks can become infected with and transmit either, or both, of these bacteria during their life cycle of two years (Steere et al. 2004, Dumler et al. 2001). I. scapularis may acquire these bacteria during their larval or nymphal stage while feeding on a bacterial reservoir, such as P. leucopusor. During the next stage of the life cycle, the tick may feed on an O. virginianus, its definitive host, or an accidental host, such as a human or domesticated animal where transmission can occur. Most infections occur between early spring and late summer through nymphs, because they are much smaller and harder to detect than adults. Detecting and removing a tick within the first day of attachment can greatly reduce the risk of infection because ticks must be attached 36 to 72 h for transmission of the pathogens responsible for Lyme disease and HGA to occur (Katavolos et al. 1998). Lyme disease symptoms begin with a skin rash called erythema migrans (EM) at the bite site in 70-80% of cases, which is sufficient for diagnosis and treatment (Smith et al. 2002, Steere and Sikand 2003). As for HGA, rash is unlikely, but a non-specific rash can occur, so laboratory testing is required for disease confirmation (Dumler et al. 2007). Common symptoms for both Lyme disease and HGA include fatigue, headache, fever, and myalgia (Steere
et al. 1983). Lyme disease can be treated with doxycycline or amoxicillin, while HGA is resistant to amoxicillin, but can be treated with doxycycline. Because of the risk of a co-infection, both diseases should be treated with a doxycycline regimen in both children and adults (Chapman et al. 2006). Lyme disease is the most common vector-borne illness in the United States, and in 2012 was the seventh most common Nationally Notifiable Disease (Centers for Disease Control and Prevention 2013b). Pennsylvania had the highest number of confirmed Lyme disease cases in 2012, the majority occurring in counties surrounding Philadelphia. As for HGA, in 2010 the CDC reported no incidence of HGA in Pennsylvania (Centers for Disease Control and Prevention 2013a). Our study aimed to determine the prevalence of B. burgdorferi and A. phagocytophilum in the black-legged ticks collected in southwestern Pennsylvania, where we believe the bacteria are overlooked, to better assess the risk to humans and domesticated animals. To accomplish this, 325 I. scapularis from four southwestern Pennsylvania counties were collected and tested for the presence of B. burgdorferi and A. phagocytophilum by PCR. MATERIALS AND METHODS During 2011 and 2012, 325 I. scapularis ticks were collected from the Pennsylvania counties of Bedford, Blair, Cambria, and Indiana. I. scapularis ticks were field collected using the standard flag and drag methods (Sonenshine 1993), which consist of waving a white cloth attached, like a flag, to a wooden pole through vegetation and leaf litter and dragging a white cloth attached to a wooden pole over the forest floor, shrubbery, and deer beds, respectively. Ticks were also removed from freshly harvested O. virginianus (31 total ticks). For each tick specimen, we gathered associated information: host species, if applicable, time and date, county, and state game land it came from, to allow for crossreferencing our findings with the reported human cases of Lyme disease and human granuloytic anaplasmosis in Pennsylvania. Tick identification was completed using dichotomous keys (Keirans
Vol. 40, no. 1
Journal of Vector Ecology
and Clifford 1978, Keirans and Durden 1998). Ticks collected in the aforementioned counties were collected on Pennsylvania State Game Lands 026, 048, 073, 079, 097, 147, 153, 166, 198, 248, 261, 262, and 273. The ticks were stored in 100% ethanol until DNA extraction could be performed. Total DNA extraction from I. scapularis was conducted using the Qiagen DNeasy protocol according to the manufacturer’s purification of total DNA from animal tissues protocol. The DNA was stored at -20˚ C until PCR analysis and quantification could be performed. The following reagent was obtained through BEI Resources, NIAID, NIH: B. burgdorferi, Strain B31 (Clone 5A1), NR-13251. A. phagocytophilum strain, USG3, was grown in HL-60 cells as previously described (Dolan et al. 1998, Yeh et al. 1997). Ixodes scapularis adult ticks were obtained from BEI Resources: NIAID, NIH: Ixodes scapularis NR-42510, to act as our absolute negative control. PCR amplifications were performed in an Eppendorf Mastercycler thermal cycler, using AmpliTaq Gold 360 Master Mix (Life Technologies). Primary reactions used 10 μl of purified DNA as the template and 0.5 μM each primer in a total volume of 50 μl. Primary primers for the 16s rRNA gene of A. phagocytophilum were ge3a (5′ CACATGCAAGTCGAACGGATTATTC) and ge10r (5′ TTCCGTTAAGAAGGATCTAATCTCC) (Massung et al. 1998) The nested primers for A. phagocytophilum were ge9f (5′ AACGGATTATTCTTTATAGCTTGCT) and ge2 (5′ GGCAGTATTAAAAGCAGCTCCAGG) which gave a 546-bp amplicon (Figure 1) (Massung et al. 1998). Primers for the fla gene of B. burgdorferi were LD1 (5′-ATGCACACTTGGTGTTAACTA) and LD2 (5′-GACTTATCACCGGCAGTCTTA) (Johnson et al. 1992). The nested PCR primers were TEC1 (5′-CTGGGGAGTATGCTCGCAAGA) and LD2 which gave a 390-bp amplicon (Johnson et al. 1992) (Figure 1). PCRs for both organisms used AmpliTaq Gold 360 Master Mix (Life Technologies). PCR conditions were as follows for both organisms: the initial denaturing was conducted at 95° C for a period of 2 min, followed by 40 cycles of 30 s at 95° C, 30 s at 55° C, and 1 min at 72° C. The Nested PCR used the same conditions as above but for 30 cycles (Courtney et al. 2003). Distilled water
181
was added to the reaction mix for both the primary and nested PCR reactions for both organisms in place of extracted DNA to control for contamination in the laboratory. RESULTS Three hundred twenty-five Ixodes scapularis ticks were collected from southwestern Pennsylvania. There were 114 ticks (35%) positive for Borrelia burgdorferi and 48 ticks (15%) positive for Anaplasma phagocytophilum. Out of the 325 ticks, 16 (5%) were co-infected with the etiological agents for Lyme disease and human granulocytic anaplasmosis (Table 1). DISCUSSION Pennsylvania had no reported incidence of HGA in 2010, although New Jersey and New York, which border Pennsylvania, had two of the highest incidence rates (Centers for Disease Control and Prevention 2013a). Despite the fact that HGA has gained recognition in the U.S. since becoming a reportable disease in 1999 and nationwide reported cases have tripled from 350 in 2000 to 1,163 in 2010, we believe HGA is still greatly under-diagnosed and under-reported, especially in Pennsylvania. As for Lyme disease, the majority of the reported cases in Pennsylvania for 2012 occurred in the counties surrounding Philadelphia (Centers for Disease Control and Prevention 2013b). For this reason, we believe that southwestern Pennsylvania has been overlooked in the presence of tick-borne pathogens that can lead to human infection. The results of this study speak to the importance of Lyme disease and HGA awareness in southwestern Pennsylvania. Of the 325 I. scapularis ticks collected, 35% were positive for the pathogen responsible for Lyme disease, 14% were positive for the pathogen responsible for HGA, and 5% were positive for co-infection. Cambria County had the highest infection rate for B. burgdorferi out of those with a statistically relevant sample size, while Bedford County was the highest for A. phagocytophilum positivity. With 15% of ticks in our region positive for A. phagocytophilum presence and 5% positive for a co-positivity, the results suggest that there may be a higher incidence for HGA in Pennsylvania
Figure 1. Nested PCR gel electrophoresis of A. phagocytophilum. 16srRNA gene (546bp) Lane 1, control I. scapularis DNA Lane 2, negative control (water added) nested PCR Lane 3, positive control A. phagocytophilum nested PCR Lane 4, positive sample and B. burgdorferi fla gene (390bp) Lane 1 negative control, (water added) nested PCR Lane 2, positive control B. burgdorferi nested PCR Lanes 3-5 positive samples.
Journal of Vector Ecology
182
June 2015
Table 1. Spatial distributions of B. burgdorferi and A. phagocytophilum in I. scapularis ticks collected in southwestern Pennsylvania. I. scapularis stage
Collection site
n
No. (%) PCR positive for B. burgdorferi
No. (%) PCR positive for A. phagocytophilum
No. (%) of coinfected samples
Total
Bedford
52
13 (25%)
12 (23.08%)
4 (7.69%)
Nymph
Bedford
32
10
11
4
Adult
Bedford
20
3
1
0
Total
Blair
30
9 (30%)
8 (26.67%)
1 (3.33%)
Nymph
Blair
23
8
6
1
Adult
Blair
7
1
2
0
Total
Cambria
114
30 (26.32%)
9 (7.89%)
5 (4.39%)
Nymph
Cambria
68
26
5
5
Engorged Adult
Cambria
20
3
1
0
Adult
Cambria
26
1
3
0
Total
Indiana
129
62 (48.06%)
19 (14.73)
6 (4.65%)
Nymph
Indiana
72
39
12
5
Engorged Adult
Indiana
11
4
5
1
Adult
Indiana
46
19
2
0
Total
325
114 (35.08%)
48 (14.77%)
16 (4.88%)
than reported by the CDC. Some possible explanations include misdiagnosis, masking, or under-reporting of the disease. This is possible if considering HGA is easily mistaken for other infectious and non-infectious diseases because of similar symptoms and cross-reactivity of some diagnostic methods (Chapman et al. 2006). In addition, those with Lyme disease and an EM typically do not receive serologic analysis, which can overlook the presence of a co-infection, masking HGA. There is also the possibility of environmental factors and precautions taken by humans that could add to the lower than expected incidence. These could include a shorter tick season due to a cold spring or early winter and people taking proper precautions when in the habitat of ticks, including the application of a repellant containing DEET, wearing protective clothing, applying lawn pesticides, and carefully inspecting for ticks when re-entering the home. Tick detection may sound simple, but one study concerning Lyme disease showed as low as 14% of people with EMs recalled a tick bite (Berger 1989). For those with Lyme disease from a tick bite in a well-hidden area such as the scalp, buttocks, or groin with no EM or for those with HGA, which typically has no rash, recalling a tick bite would be even less common. Similar studies to ours have been performed on I. scapularis from Pennsylvania. In 1995, a study was published that investigated the presence of rickettsia-like organisms in ticks from Bryn Athyn, Pennsylvania and several other states in New England using serology to I. scapularis hemolymph (Magnarelli et al. 1995).
This study found 20% positivity for A. phagocytophilum in Bryn Athyn. These results are similar to the 15% positive rate we saw for infection with A. phagocytophilum in southwestern Pennsylvania. The presence of both B. burgdorferi and A. phagocytophilum in I. scapularis, detected via PCR, was reported previously (Courtney et al. 2003). Ticks were collected from northwestern Erie County and southeastern Delaware and Chester Counties, PA. This study found 62% were positive for B. burgdorferi and 2% for A. phagocytophilum in Erie County. In Delaware and Chester Counties 13% were positive for B. burgdorferi, while 40% were positive for A. phagocytophilum. In this study, differing trends were seen for opposite corners of Pennsylvania. Considering that our study’s results are between the low and high extremes found in this prior study and the ticks were collected geographically between the two locations, it suggests that the presence of each bacterium may vary across the state. Our study determined, via PCR, that the pathogens responsible for causing Lyme disease and HGA are present in the black-legged ticks of southwestern Pennsylvania. The forested and grassy terrain supplies abundant bacterial reservoirs and definitive hosts to allow the black-legged tick to thrive in the region. Although a prevalence of the bacteria responsible for each disease does not necessarily equal high incidence numbers, because a large proportion of our region’s population lives, works, or spends recreational time in the preferred environment of the tick, there is substantial risk of attachment to humans or pets as accidental hosts. To prevent and properly treat Lyme disease and HGA, both
Journal of Vector Ecology
Vol. 40, no. 1
healthcare workers and residents of southwestern Pennsylvania must become more familiar with common prevention methods used to deter ticks and the symptoms of Lyme disease and HGA. Acknowledgments The authors thank the President’s Mentorship Fund and the Alice Waters Thomas Fund at the University of Pittsburgh at Johnstown for supporting this study. Sample collection would not have been possible without D. McNitt, M. Dovey, S. Bart, D. Degol, and Z. Weyndant. The following reagents were obtained through BEI Resources, NIAID, NIH: Ixodes scapularis, NR-42510 and NIAID, NIH: Borrelia burgdorferi, Strain B31 (Clone 5A1), NR-13251. REFERENCES CITED Berger, B.W. 1989. Dermatologic manifestations of Lyme disease. Rev. Infect. Dis. Supp. l6: S1475-1481. Centers for Disease Control and Prevention. 2013a. Anaplasmosis Statistics and Epidemiology. Retrieved from: http://www.cdc. gov/anaplasmosis/stats/ Centers for Disease Control and Prevention. 2013b. Lyme Disease Data. Retrieved from: http://www.cdc.gov/lyme/stats/index. html Chapman, A.S., J.S. Bakken, S.M. Folk, C.D. Paddock, K.C. Bloch, A. Krussel, D.J. Sexton, S.C. Buckingham, G.S. Marshall, G.A. Storch, G.A. Dasch, J.H. McQuiston, D.L. Swerdlow, J.S. Dumler, W.L. Nicholson, D.H. Walker, M.E. Eremeeva, and C.A. Ohl. 2006. Diagnosis and management of tickborne rickettsial diseases: Rocky Mountain spotted fever, ehrlichiosis, and anaplasmosis – USA: a practical guide for physicians and other health-care and public health professionals. MMWR Recomm. Rep. 55: 1-27. Courtney, J.W., R.L. Dryden, J. Montgomery, B.S. Schneider, G. Smith, and R.F. Massung. 2003. Molecular Characterization of Anaplasma phagocytophilum and Borrelia burgdorferi in Ixodes scapularis Ticks from Pennsylvania. J. Clin. Microbiol. 41: 1569-1573. Dolan, M.C., J. Piesman, M.L. Mbow, G.O. Maupin, O. Peter, M. Brossard, and W.T. Golde. 1998. Vector competence of Ixodes scapularis and Ixodes ricinus (Acari: Ixodidae) for three genospecies of Borrelia burgdorferi. J. Med. Entomol. 35: 465470. Dumler, J.S., N.C. Barat, C.E. Barat, and J.S. Bakken. 2007. Human Granulocytic Anaplasmosis and macrophage activation. Clin. Infect. Dis. 45: 199-204. Dumler, J.S., K.S. Choi, J.C. Garcia-Garcia, N.S. Barat, D.S. Scorpio, J.W. Garyu, D.J. Grab, and J.S. Bakken. 2005. Human Granulocytic Anaplasmosis and Anaplasma phagocytophilum. Emerg. Infect. Dis. 11: 1828-1834. Dumler, J.S., A.F. Barbet, C.P. Bekker, G.A. Dasch, G.H. Palmer, S.C. Ray, Y. Rikihisa, and F.R. Rurangirwa. 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with
183
Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51: 2145-2165. Guerra, M., E. Walker, C. Jones, S. Paskewitz, M.R. Cortinas, A. Stancil, L. Beck, M. Bobo, and U. Kitron. 2002. Predicting the risk of Lyme disease: habitat suitability for Ixodes scapularis in the north central United States. Emerg. Infect. Dis. 8: 289297. Johnson, B.J., C.M. Happ, L.W. Mayer, and J. Piesman. 1992. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47: 730–741. Katavolos, P., P.M. Armstrong, J.E. Dawson, and S.E. Telford III. 1998. Duration of tick attachment required for transmission of granulocytic ehrlichiosis. J. Infect. Dis. 177: 1422-1425. Keirans, J.E. and C.M. Clifford. 1978. The genus Ixodes in the United States: a scanning electron microscope study and key to the adults. J. Med. Entomol. Suppl. 2: 1-149. Keirans, J.E. and L.A. Durden. 1998. Illustrated key to nymphs of the tick genus Amblyomma (Acari: Ixodidae) found in the United States. J. Med. Entomol. 35: 489-495. Magnarelli, L.A., K.C. Stafford III, T.N. Mather, M. Yeh, K.D. Horn, and J.S. Dumler. 1995. Hemocytic Rickettsia-like organisms in ticks: Serologic reactivity with antisera to Ehrlichiae and detection of DNA agent of Human Granulocytic Erlichiosis by PCR. J. Clin. Microbiol. 33: 2710-2714. Massung, R.F., K. Slater, J.H. Owens, W.L. Nicholson, T.N. Mather, V.B. Solberg, and J.G. Olson. 1998. Nested PCR assay for detection of granulocytic Ehrlichiae. J. Clin. Microbiol. 36: 1090-1095. Smith, R.P., R.T. Schoen, D.W. Rahn, V.K. Sikand, J. Nowakowski, D.L. Parenti, M.S. Holman, D.H. Persing, and A.C. Steere. 2002. Clinical characteristics and treatment outcome of early Lyme disease in patients with microbiologically confirmed erythema migrans. Ann. Intern. Med. 136: 421-428. Sonenshine, D.E. 1993. Biology of Ticks, Vol. 2. Oxford University Press, NY. Steere, A.C., J. Coburn, and L. Glickstein. 2004. The emergence of Lyme disease. J. Clin. Invest. 113: 1093-1101. Steere, A.C. and V.K. Sikand. 2003. The presenting manifestations of Lyme disease and the outcomes of treatment. N. Engl. J. Med. 348: 2472-2474. Steere, A.C., N.H. Bartenhagen, G.J. Hutchinson, J.H. Newman, D.W. Rahn, L.H. Sigal, P.N. Spieler, K.S. Stenn, and S.E. Malawista. 1983. The early clinical manifestations of Lyme disease. Ann. Intern. Med. 99: 76-82. Swanson, S.J., D. Neitzel, K.D. Reed, and E.A. Belongia. 2006. Coinfections acquired from Ixodes ticks. Clin. Microbiol. Rev. 19: 708-727. Walker, D.H. and J.S. Dumler. 1996. Emergence of the ehrlicioses as human health problems. Emerg. Infect. Dis. 2: 18-29. Yeh, M.T., T.N. Mather, R.T. Coughlin, C. Gingrich-Baker, J.W. Sumner, and R.F. Massung. 1997. Serologic and molecular detection of granulocytic ehrlichiosis in Rhode Island. J. Clin. Microbiol. 35: 944-947.
180
June 2015
Detection of Borrelia burgdorferi and Anaplasma phagocytophilum in the black-legged tick, Ixodes scapularis, within southwestern Pennsylvania Scott M. Brown1, Preston M. Lehman, Ryan A. Kern, and Jill D. Henning University of Pittsburgh at Johnstown, Johnstown, PA 15904, U.S.A., [email protected] 1 Present address: Windber Research Institute, Windber, Pennsylvania Received 16 October 2014; Accepted 18 February 2015 ABSTRACT: Prevalence studies of Borrelia burgdorferi and Anaplasma phagocytophilum have been rare for ticks from southwestern Pennsylvania. We collected 325 Ixodes scapularis ticks between 2011 and 2012 from four counties in southwestern Pennsylvania. We tested for the presence of Borrelia burgdorferi and Anaplasma phagocytophilum using PCR. Of the ticks collected from Pennsylvania, B. burgdorferi (causative agent of Lyme disease) was present in 114/325 (35%) and Anaplasma phagocytophilum (causative agent of Human Granulocytic Anaplasmosis) was present in 48/325 (15%) as determined by PCR analysis. Journal of Vector Ecology 40 (1): 180-183. 2015. Keyword Index: Borrelia burgdorferi, Anaplasma phagocytophilum, PCR. INTRODUCTION The black-legged tick, Ixodes scapularis, is a vector of several diseases including Lyme disease and human granulocytic anaplasmosis (HGA) in the northeastern United States (Swanson et al. 2006). Borrelia burgdorferi and Anaplasma phagocytophilum are the bacteria responsible for Lyme disease and HGA, respectively. Ideal conditions for the transmission of Lyme disease and HGA to humans exist in the region, owing to the woodlands, rivers, growing white-tailed deer population (Odocoileus virginianus), plentiful populations of the white-footed mouse (Peromyscus leucopusor), and expansion of human populations into the habitat of the black-legged tick (Guerra et al. 2002). B. burgdorferi is a spirochete, an extremely motile, spiralshaped bacterium (Steere et al. 2004), while A. phagocytophilum is a small, gram-negative bacterium (Walker and Dumler 1996). Black-legged ticks can become infected with and transmit either, or both, of these bacteria during their life cycle of two years (Steere et al. 2004, Dumler et al. 2001). I. scapularis may acquire these bacteria during their larval or nymphal stage while feeding on a bacterial reservoir, such as P. leucopusor. During the next stage of the life cycle, the tick may feed on an O. virginianus, its definitive host, or an accidental host, such as a human or domesticated animal where transmission can occur. Most infections occur between early spring and late summer through nymphs, because they are much smaller and harder to detect than adults. Detecting and removing a tick within the first day of attachment can greatly reduce the risk of infection because ticks must be attached 36 to 72 h for transmission of the pathogens responsible for Lyme disease and HGA to occur (Katavolos et al. 1998). Lyme disease symptoms begin with a skin rash called erythema migrans (EM) at the bite site in 70-80% of cases, which is sufficient for diagnosis and treatment (Smith et al. 2002, Steere and Sikand 2003). As for HGA, rash is unlikely, but a non-specific rash can occur, so laboratory testing is required for disease confirmation (Dumler et al. 2007). Common symptoms for both Lyme disease and HGA include fatigue, headache, fever, and myalgia (Steere
et al. 1983). Lyme disease can be treated with doxycycline or amoxicillin, while HGA is resistant to amoxicillin, but can be treated with doxycycline. Because of the risk of a co-infection, both diseases should be treated with a doxycycline regimen in both children and adults (Chapman et al. 2006). Lyme disease is the most common vector-borne illness in the United States, and in 2012 was the seventh most common Nationally Notifiable Disease (Centers for Disease Control and Prevention 2013b). Pennsylvania had the highest number of confirmed Lyme disease cases in 2012, the majority occurring in counties surrounding Philadelphia. As for HGA, in 2010 the CDC reported no incidence of HGA in Pennsylvania (Centers for Disease Control and Prevention 2013a). Our study aimed to determine the prevalence of B. burgdorferi and A. phagocytophilum in the black-legged ticks collected in southwestern Pennsylvania, where we believe the bacteria are overlooked, to better assess the risk to humans and domesticated animals. To accomplish this, 325 I. scapularis from four southwestern Pennsylvania counties were collected and tested for the presence of B. burgdorferi and A. phagocytophilum by PCR. MATERIALS AND METHODS During 2011 and 2012, 325 I. scapularis ticks were collected from the Pennsylvania counties of Bedford, Blair, Cambria, and Indiana. I. scapularis ticks were field collected using the standard flag and drag methods (Sonenshine 1993), which consist of waving a white cloth attached, like a flag, to a wooden pole through vegetation and leaf litter and dragging a white cloth attached to a wooden pole over the forest floor, shrubbery, and deer beds, respectively. Ticks were also removed from freshly harvested O. virginianus (31 total ticks). For each tick specimen, we gathered associated information: host species, if applicable, time and date, county, and state game land it came from, to allow for crossreferencing our findings with the reported human cases of Lyme disease and human granuloytic anaplasmosis in Pennsylvania. Tick identification was completed using dichotomous keys (Keirans
Vol. 40, no. 1
Journal of Vector Ecology
and Clifford 1978, Keirans and Durden 1998). Ticks collected in the aforementioned counties were collected on Pennsylvania State Game Lands 026, 048, 073, 079, 097, 147, 153, 166, 198, 248, 261, 262, and 273. The ticks were stored in 100% ethanol until DNA extraction could be performed. Total DNA extraction from I. scapularis was conducted using the Qiagen DNeasy protocol according to the manufacturer’s purification of total DNA from animal tissues protocol. The DNA was stored at -20˚ C until PCR analysis and quantification could be performed. The following reagent was obtained through BEI Resources, NIAID, NIH: B. burgdorferi, Strain B31 (Clone 5A1), NR-13251. A. phagocytophilum strain, USG3, was grown in HL-60 cells as previously described (Dolan et al. 1998, Yeh et al. 1997). Ixodes scapularis adult ticks were obtained from BEI Resources: NIAID, NIH: Ixodes scapularis NR-42510, to act as our absolute negative control. PCR amplifications were performed in an Eppendorf Mastercycler thermal cycler, using AmpliTaq Gold 360 Master Mix (Life Technologies). Primary reactions used 10 μl of purified DNA as the template and 0.5 μM each primer in a total volume of 50 μl. Primary primers for the 16s rRNA gene of A. phagocytophilum were ge3a (5′ CACATGCAAGTCGAACGGATTATTC) and ge10r (5′ TTCCGTTAAGAAGGATCTAATCTCC) (Massung et al. 1998) The nested primers for A. phagocytophilum were ge9f (5′ AACGGATTATTCTTTATAGCTTGCT) and ge2 (5′ GGCAGTATTAAAAGCAGCTCCAGG) which gave a 546-bp amplicon (Figure 1) (Massung et al. 1998). Primers for the fla gene of B. burgdorferi were LD1 (5′-ATGCACACTTGGTGTTAACTA) and LD2 (5′-GACTTATCACCGGCAGTCTTA) (Johnson et al. 1992). The nested PCR primers were TEC1 (5′-CTGGGGAGTATGCTCGCAAGA) and LD2 which gave a 390-bp amplicon (Johnson et al. 1992) (Figure 1). PCRs for both organisms used AmpliTaq Gold 360 Master Mix (Life Technologies). PCR conditions were as follows for both organisms: the initial denaturing was conducted at 95° C for a period of 2 min, followed by 40 cycles of 30 s at 95° C, 30 s at 55° C, and 1 min at 72° C. The Nested PCR used the same conditions as above but for 30 cycles (Courtney et al. 2003). Distilled water
181
was added to the reaction mix for both the primary and nested PCR reactions for both organisms in place of extracted DNA to control for contamination in the laboratory. RESULTS Three hundred twenty-five Ixodes scapularis ticks were collected from southwestern Pennsylvania. There were 114 ticks (35%) positive for Borrelia burgdorferi and 48 ticks (15%) positive for Anaplasma phagocytophilum. Out of the 325 ticks, 16 (5%) were co-infected with the etiological agents for Lyme disease and human granulocytic anaplasmosis (Table 1). DISCUSSION Pennsylvania had no reported incidence of HGA in 2010, although New Jersey and New York, which border Pennsylvania, had two of the highest incidence rates (Centers for Disease Control and Prevention 2013a). Despite the fact that HGA has gained recognition in the U.S. since becoming a reportable disease in 1999 and nationwide reported cases have tripled from 350 in 2000 to 1,163 in 2010, we believe HGA is still greatly under-diagnosed and under-reported, especially in Pennsylvania. As for Lyme disease, the majority of the reported cases in Pennsylvania for 2012 occurred in the counties surrounding Philadelphia (Centers for Disease Control and Prevention 2013b). For this reason, we believe that southwestern Pennsylvania has been overlooked in the presence of tick-borne pathogens that can lead to human infection. The results of this study speak to the importance of Lyme disease and HGA awareness in southwestern Pennsylvania. Of the 325 I. scapularis ticks collected, 35% were positive for the pathogen responsible for Lyme disease, 14% were positive for the pathogen responsible for HGA, and 5% were positive for co-infection. Cambria County had the highest infection rate for B. burgdorferi out of those with a statistically relevant sample size, while Bedford County was the highest for A. phagocytophilum positivity. With 15% of ticks in our region positive for A. phagocytophilum presence and 5% positive for a co-positivity, the results suggest that there may be a higher incidence for HGA in Pennsylvania
Figure 1. Nested PCR gel electrophoresis of A. phagocytophilum. 16srRNA gene (546bp) Lane 1, control I. scapularis DNA Lane 2, negative control (water added) nested PCR Lane 3, positive control A. phagocytophilum nested PCR Lane 4, positive sample and B. burgdorferi fla gene (390bp) Lane 1 negative control, (water added) nested PCR Lane 2, positive control B. burgdorferi nested PCR Lanes 3-5 positive samples.
Journal of Vector Ecology
182
June 2015
Table 1. Spatial distributions of B. burgdorferi and A. phagocytophilum in I. scapularis ticks collected in southwestern Pennsylvania. I. scapularis stage
Collection site
n
No. (%) PCR positive for B. burgdorferi
No. (%) PCR positive for A. phagocytophilum
No. (%) of coinfected samples
Total
Bedford
52
13 (25%)
12 (23.08%)
4 (7.69%)
Nymph
Bedford
32
10
11
4
Adult
Bedford
20
3
1
0
Total
Blair
30
9 (30%)
8 (26.67%)
1 (3.33%)
Nymph
Blair
23
8
6
1
Adult
Blair
7
1
2
0
Total
Cambria
114
30 (26.32%)
9 (7.89%)
5 (4.39%)
Nymph
Cambria
68
26
5
5
Engorged Adult
Cambria
20
3
1
0
Adult
Cambria
26
1
3
0
Total
Indiana
129
62 (48.06%)
19 (14.73)
6 (4.65%)
Nymph
Indiana
72
39
12
5
Engorged Adult
Indiana
11
4
5
1
Adult
Indiana
46
19
2
0
Total
325
114 (35.08%)
48 (14.77%)
16 (4.88%)
than reported by the CDC. Some possible explanations include misdiagnosis, masking, or under-reporting of the disease. This is possible if considering HGA is easily mistaken for other infectious and non-infectious diseases because of similar symptoms and cross-reactivity of some diagnostic methods (Chapman et al. 2006). In addition, those with Lyme disease and an EM typically do not receive serologic analysis, which can overlook the presence of a co-infection, masking HGA. There is also the possibility of environmental factors and precautions taken by humans that could add to the lower than expected incidence. These could include a shorter tick season due to a cold spring or early winter and people taking proper precautions when in the habitat of ticks, including the application of a repellant containing DEET, wearing protective clothing, applying lawn pesticides, and carefully inspecting for ticks when re-entering the home. Tick detection may sound simple, but one study concerning Lyme disease showed as low as 14% of people with EMs recalled a tick bite (Berger 1989). For those with Lyme disease from a tick bite in a well-hidden area such as the scalp, buttocks, or groin with no EM or for those with HGA, which typically has no rash, recalling a tick bite would be even less common. Similar studies to ours have been performed on I. scapularis from Pennsylvania. In 1995, a study was published that investigated the presence of rickettsia-like organisms in ticks from Bryn Athyn, Pennsylvania and several other states in New England using serology to I. scapularis hemolymph (Magnarelli et al. 1995).
This study found 20% positivity for A. phagocytophilum in Bryn Athyn. These results are similar to the 15% positive rate we saw for infection with A. phagocytophilum in southwestern Pennsylvania. The presence of both B. burgdorferi and A. phagocytophilum in I. scapularis, detected via PCR, was reported previously (Courtney et al. 2003). Ticks were collected from northwestern Erie County and southeastern Delaware and Chester Counties, PA. This study found 62% were positive for B. burgdorferi and 2% for A. phagocytophilum in Erie County. In Delaware and Chester Counties 13% were positive for B. burgdorferi, while 40% were positive for A. phagocytophilum. In this study, differing trends were seen for opposite corners of Pennsylvania. Considering that our study’s results are between the low and high extremes found in this prior study and the ticks were collected geographically between the two locations, it suggests that the presence of each bacterium may vary across the state. Our study determined, via PCR, that the pathogens responsible for causing Lyme disease and HGA are present in the black-legged ticks of southwestern Pennsylvania. The forested and grassy terrain supplies abundant bacterial reservoirs and definitive hosts to allow the black-legged tick to thrive in the region. Although a prevalence of the bacteria responsible for each disease does not necessarily equal high incidence numbers, because a large proportion of our region’s population lives, works, or spends recreational time in the preferred environment of the tick, there is substantial risk of attachment to humans or pets as accidental hosts. To prevent and properly treat Lyme disease and HGA, both
Journal of Vector Ecology
Vol. 40, no. 1
healthcare workers and residents of southwestern Pennsylvania must become more familiar with common prevention methods used to deter ticks and the symptoms of Lyme disease and HGA. Acknowledgments The authors thank the President’s Mentorship Fund and the Alice Waters Thomas Fund at the University of Pittsburgh at Johnstown for supporting this study. Sample collection would not have been possible without D. McNitt, M. Dovey, S. Bart, D. Degol, and Z. Weyndant. The following reagents were obtained through BEI Resources, NIAID, NIH: Ixodes scapularis, NR-42510 and NIAID, NIH: Borrelia burgdorferi, Strain B31 (Clone 5A1), NR-13251. REFERENCES CITED Berger, B.W. 1989. Dermatologic manifestations of Lyme disease. Rev. Infect. Dis. Supp. l6: S1475-1481. Centers for Disease Control and Prevention. 2013a. Anaplasmosis Statistics and Epidemiology. Retrieved from: http://www.cdc. gov/anaplasmosis/stats/ Centers for Disease Control and Prevention. 2013b. Lyme Disease Data. Retrieved from: http://www.cdc.gov/lyme/stats/index. html Chapman, A.S., J.S. Bakken, S.M. Folk, C.D. Paddock, K.C. Bloch, A. Krussel, D.J. Sexton, S.C. Buckingham, G.S. Marshall, G.A. Storch, G.A. Dasch, J.H. McQuiston, D.L. Swerdlow, J.S. Dumler, W.L. Nicholson, D.H. Walker, M.E. Eremeeva, and C.A. Ohl. 2006. Diagnosis and management of tickborne rickettsial diseases: Rocky Mountain spotted fever, ehrlichiosis, and anaplasmosis – USA: a practical guide for physicians and other health-care and public health professionals. MMWR Recomm. Rep. 55: 1-27. Courtney, J.W., R.L. Dryden, J. Montgomery, B.S. Schneider, G. Smith, and R.F. Massung. 2003. Molecular Characterization of Anaplasma phagocytophilum and Borrelia burgdorferi in Ixodes scapularis Ticks from Pennsylvania. J. Clin. Microbiol. 41: 1569-1573. Dolan, M.C., J. Piesman, M.L. Mbow, G.O. Maupin, O. Peter, M. Brossard, and W.T. Golde. 1998. Vector competence of Ixodes scapularis and Ixodes ricinus (Acari: Ixodidae) for three genospecies of Borrelia burgdorferi. J. Med. Entomol. 35: 465470. Dumler, J.S., N.C. Barat, C.E. Barat, and J.S. Bakken. 2007. Human Granulocytic Anaplasmosis and macrophage activation. Clin. Infect. Dis. 45: 199-204. Dumler, J.S., K.S. Choi, J.C. Garcia-Garcia, N.S. Barat, D.S. Scorpio, J.W. Garyu, D.J. Grab, and J.S. Bakken. 2005. Human Granulocytic Anaplasmosis and Anaplasma phagocytophilum. Emerg. Infect. Dis. 11: 1828-1834. Dumler, J.S., A.F. Barbet, C.P. Bekker, G.A. Dasch, G.H. Palmer, S.C. Ray, Y. Rikihisa, and F.R. Rurangirwa. 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with
183
Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51: 2145-2165. Guerra, M., E. Walker, C. Jones, S. Paskewitz, M.R. Cortinas, A. Stancil, L. Beck, M. Bobo, and U. Kitron. 2002. Predicting the risk of Lyme disease: habitat suitability for Ixodes scapularis in the north central United States. Emerg. Infect. Dis. 8: 289297. Johnson, B.J., C.M. Happ, L.W. Mayer, and J. Piesman. 1992. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47: 730–741. Katavolos, P., P.M. Armstrong, J.E. Dawson, and S.E. Telford III. 1998. Duration of tick attachment required for transmission of granulocytic ehrlichiosis. J. Infect. Dis. 177: 1422-1425. Keirans, J.E. and C.M. Clifford. 1978. The genus Ixodes in the United States: a scanning electron microscope study and key to the adults. J. Med. Entomol. Suppl. 2: 1-149. Keirans, J.E. and L.A. Durden. 1998. Illustrated key to nymphs of the tick genus Amblyomma (Acari: Ixodidae) found in the United States. J. Med. Entomol. 35: 489-495. Magnarelli, L.A., K.C. Stafford III, T.N. Mather, M. Yeh, K.D. Horn, and J.S. Dumler. 1995. Hemocytic Rickettsia-like organisms in ticks: Serologic reactivity with antisera to Ehrlichiae and detection of DNA agent of Human Granulocytic Erlichiosis by PCR. J. Clin. Microbiol. 33: 2710-2714. Massung, R.F., K. Slater, J.H. Owens, W.L. Nicholson, T.N. Mather, V.B. Solberg, and J.G. Olson. 1998. Nested PCR assay for detection of granulocytic Ehrlichiae. J. Clin. Microbiol. 36: 1090-1095. Smith, R.P., R.T. Schoen, D.W. Rahn, V.K. Sikand, J. Nowakowski, D.L. Parenti, M.S. Holman, D.H. Persing, and A.C. Steere. 2002. Clinical characteristics and treatment outcome of early Lyme disease in patients with microbiologically confirmed erythema migrans. Ann. Intern. Med. 136: 421-428. Sonenshine, D.E. 1993. Biology of Ticks, Vol. 2. Oxford University Press, NY. Steere, A.C., J. Coburn, and L. Glickstein. 2004. The emergence of Lyme disease. J. Clin. Invest. 113: 1093-1101. Steere, A.C. and V.K. Sikand. 2003. The presenting manifestations of Lyme disease and the outcomes of treatment. N. Engl. J. Med. 348: 2472-2474. Steere, A.C., N.H. Bartenhagen, G.J. Hutchinson, J.H. Newman, D.W. Rahn, L.H. Sigal, P.N. Spieler, K.S. Stenn, and S.E. Malawista. 1983. The early clinical manifestations of Lyme disease. Ann. Intern. Med. 99: 76-82. Swanson, S.J., D. Neitzel, K.D. Reed, and E.A. Belongia. 2006. Coinfections acquired from Ixodes ticks. Clin. Microbiol. Rev. 19: 708-727. Walker, D.H. and J.S. Dumler. 1996. Emergence of the ehrlicioses as human health problems. Emerg. Infect. Dis. 2: 18-29. Yeh, M.T., T.N. Mather, R.T. Coughlin, C. Gingrich-Baker, J.W. Sumner, and R.F. Massung. 1997. Serologic and molecular detection of granulocytic ehrlichiosis in Rhode Island. J. Clin. Microbiol. 35: 944-947.
