.I. Mol.
Bid.
(1!391) 218, 99-105
Detection of Escherichia coli Ribosome Binding at Translation Initiation Sites in the Absence of tRNA Dieter Hartz, David S. McPheeterst, Louis Green and Larry Goldj: Department
of Molecular, Cellular and Developmental University of Colorado, Campus Box 347 Boulder, CO 8030.9-0347. TT.S.A.
(Received
7 May
Biology
1990: accepted 22 October 19.90)
Binary complexes between messenger RNA and E. coli ribosomes were examined. A ribosome-mRNA binary complex on T4 gene 32 mRNA withstood inhibition by antibodies against ribosomal protein Sl. Anti-S1 blocks ternary complex formation, as measured by analysis, only when preincubated with ribosomes “extension inhibition” or “toeprinting” prior to mRNA addition and not when anti-S1 was added after preincubation of ribosomes and mRNA. The ribosome was directly localized in a binary complex on two translation initiation sites by toeprinting analysis. In the absence of tRNA the ribosome halted cl)NA synthesis by reverse transcriptase close to the Shine and Dalgarno sequence. Binary complex formation was inhibited by an oligodeoxynucleotide competitor of the Shine and Dalgartio sequence.
1. Introduction While init,iat.ion complex formation has been extensively studied, the literature on functional ribosome-mRSA binary complexes has been comscarce. Evidence of functional paratively 30 S-messenger RNA binary complexes has been presented by Van Dieijen et al. (1978). MS2 RNA that had been preincubated with 30 S ribosomal subunits could be successfully translated in the presence of antibodies against ribosomal protein Sl. The same ant,ibodies inhibited translation when they were administered to 30 S subunits before MS2 RNA addition. Likewise, other inhibitors of binary complex formation (such as edeine and tricarboxylic acid) inhibited translation only when preincubated with 30 S subunitIs (Van Duin et al., 1980). Similarly, an octadeoxynucleotide, complementary to the 3’ end of the 16 S rRNA, inhibited MS2 translation when added to 30 S subunits before MS2 RNA addition. This experiment stressed the importance of the Shine and Dalgarno sequence for the binding of ribosomes to the mRNA (Backendorf rt al., 1980). Ribosomes not only bind to Shine and Dalgarno sequences in translation initiation domains but also t Present’ address: COORS Biotech, 6204 S. College Ave, Ft (lollins, CO 80525, U.S.A. $ Author to whom all correspondence should be addressed
to Shine and Dalgarno-like sequences at non-initiation sites (Taniguchi & Weissmann, 1979). The binding at the non-initiation sites probably does not contribute to initiation complex formation (Gold et al.. 1981). It is crucial, however, to monitor ribosomal binding at, specific initiation sit,es when stud?ing functional 30 S-mRNA binary complexes rn also called extension inhibition, z&o. lising toeprinting (Hartz et al., 1988) to monitor ternary complex formation we confirmed the results of Van Dieijen et al. (1978). By changing toeprint,ing conditions we were then able to localize ribosome binding at two different initiation domains in the absence of tRNA or initiation factors. That is. t,he 30 S parti&, by itsdf, finds proper init’iation regions on mR?;As.
2. Materials and Methods (a) Reagents Purified. uncharged Eschcrichia coli t RN$‘” WBS purchased from Roehringer-Mannheim. AMV$ reverse t’ranscriptase and MMLV-reverse transcriptase were obtained from Life Sciences Inc. and Betheseda Research Laboratories. respectively. T7 RNA polymerasr wiss provided by 0. IJhlenbeck. T4 polynucleotide kinasr was purchased from New England Biolabs Inc. Ribonuclease inhibit,or RNasin was obtained from Promega. $ Abbreviations used: AMV, avian mpeloblastosis virus: MMTV, mouse mammary tumor virus.
100
1).
tlrrrk
The 30 S ribosomal subunits. prepared according t,o Kenney rl ~1. (1979). were a gift, from R. Traut. 70 S rikmsomes and 70 S ribosomes 93c/o depleted of protein Sk by passage over a poly(U) column k70 S (-Sk)], as well as c*rudr Sl antiserum prepared against highly purified St. were a gift from ,J. Rabinowitz. In &o RNAs from the PwII cut plasmids pRS170. pTS26, pT7SkXAkTC and pT7CIJ were synthesized with phage T7 polymerase according to Lowary el al. (1986). The RNAs were purified on a 6% (w/v) polyacrylamide gel. The plasmid pRS170 contains the sequence from -92 tjo 107 of gene 32 (Krisch & Allet, 19%). Plasmid pTS26 contains the hairpin shown in Fig. 2. Plasmids prk’7S1>8AI:(: and pT7GU contain the synthetic translation initiation sites depicted in Figs 3 and 4, respectively. All sequences are downstream from a T7 promotIer. The construction of plasmid pRSl70 and pTS26 are described k)y Hartz ut al. (1989) and McPheeters rt nl. (1988). respectively. and the construction of plasmids pT7S1)8AIJ(: and pT7QU will be described elsewhere (Hartz et al., 1991). Oligodeox?nucleotides were synthesized on an lIk’plietl Riosystems Model 380A I)NA Synthesizer and purified by preparative gel electrophoresis. “32loopD” which was used as primer on the pR8170 transcript and “LP134” which was used as primer on pT7SD8Ak’C and pTiC1‘ transcripts have been described kry Hartz et crl. (1989). Oligotleoxynucleotitlr I6 SPI has the sequence 5’ T:Ir\(:(:A(:CT(:AT(‘. (k)) Methods Extension inhibition under standard conditions (rxperiment,s of Fig. 1 and sequencing) was performed essentially as described by Hartz et al. (1988). The standard kmffer (10 mM-Tris-acetate (pH 7.4), 60 mM-N&Cl. 6 mM-/-mercaptoethanok, 10 mM-Mg acetate) contained in addition 5 units RNasin per ~1 and 1 mM-dithiothreitol in incubations containing crude antisera. Reactions with all ingredients were prepared on ice and preincubated, as specified in the Figure legends. before primer extension was performed for 15 min at 37°C using 200 units of MMLV-reverse transcriptase per reaction. (AMV-reverse transcriptase was used for sequencing.) Extension inhibit’ion was modified to detect reverse transcriptase stops at a hairpin and at ribosome-mR?GA binary complexes. To detect the hairpin MMLV-reverse t,ranscript*ase was diluted in 20 miv-Tris. HCI (pH 7.5). 1 rnbl-dithiothreitol. 91 mM-EDTA, 100 mM-NaCI, 50°b glycerol to the concentrations shown in Fig. 2. One ~1 was then added to 5 ~1 react,ions and primer extension performed for 1.5 min at 37°C. To detect binary complexes t*tre primer extension reaction with MMLV-reverse transcriptase was performed at 7°C: for 4 h instead of 37 “(’ (experiments of Fig. 4), or MMLV-reverse transcriptasr was diluted IO-fold in standard buffer to a final conrentrat’ion of 2 units/PI in toeprinting reactions and primer, extension was performed for 15 min at 37 ‘C (exprrimentjs of Fig. 3).
3. Results (a) From binary
to ternary
complexes
during
initiatiorb
Ribosomal protein 81 is necessary for translat’ion of the MS2 coat cistron in vitro (Van Dieijen et al., 1975). Protein Sl appears to be involved in the translation initiation step and might help to bind
et,
ul.
(a)
(b)
Figure 1. kmportance of rik)osomal protein SI for ternary complex formation on the pRSl70 i?l Gtm transcript (a) In addition to 0075 PM-70 S ribosomes or 0675 ~~-70 S rikrosomes depleted to Sk (70 S (-SI )k. the right lanes contained 615 ,uivr-tRRiAF”. Rractious were preincubated for IO min at 37”(1 followed by primer extension for 15 min at 37’C. (k)) Reactions contained 0675 PM-70 S ribosomes. pRSl70 in citro transcript (mRh‘A). crude antisera against protein Sl (Ab), and. with the exception of the left lane, 0.15 FM-tRNA,M”. The standard buffer contained in addition 5 units RISasin/pl and 1 mm-dithiothreitol. Components in brackets were added together and incubated for 5 min at 37°C before the next components were added at intervals of’ 6 min. Preincubation was continued for 5 min after t,he last and followed by primer extension addition with MMLV-reverse transcriptase for 15 min at, 37 “(1. Toeprint positions (arrow) are at + 15 from the A of the initiation codon.
ribosomes to the mRNA (Van Dieijen et al., 1978). We tested the Sl requirement for ternary complex formation on the bacteriophage T4 gene 32 initiation domain using toeprinting (Hartz et al., 1988). A mixture of normal or protein Sl-depleted 70 S ribosomes and initiator tRNA were assayed for ternary complex formation on the pRSI70 i7~ vitro transcript (which contains the T4 gene 32 initiation and tRNAr” domain). While 70 S ribosomes yielded a toeprint at + 15 from the first base of the mitiation codon, the ribosomes lacking protein Sl yielded a drastically diminished toeprint (Fig. 1(a)). Neither 70 S nor 70 S depleted of Sl yielded a toeprint without tRNAye’ under these conditions. It, is clear from this experiment that Sl is somehow involved in ternary complex formation.
Ribosome Complexes
with mRNA
101
reverse transcriptase more easily reads t,hrough the hairpin when present at a high concentration (Fig. 2). Probably high enzyme levels allow reinitiation of cI>NA synt,hesis, which lowers the signal observed at t,he base of the hairpin. WP reasoned that
v-u A 5’ C”C”G*-%AGGA”CC
Figure 2. Reverse transcriptase stops at a hairpin in the pTS26 transcript are dependent on the MMLV-reverse transcriptase concentration (indicated in units (U) per 5 ~1 reaction above the lanes). The locations of the reverse transcriptase stops are marked by arrowheads. Note that with lowered reverse transcriptase concentration they increase in intensity (as compared to the signal from the full length rnKA) and are found closer to the hairpin base. On the right a sequencing lane including (C-lane) is shown.
LVe next tested the effect of antibodies protein
Sl
on ternary
complex
formation
ddGTP
against on the
same mRNS. Anti-S1 antibodies strongly inhibited terrmry complex formation when added to 70 S ribosomes prior to the mRNA, regardless of when the tR,NAp’ was added (Fig. 1(b)). However, antiSl antibodies did not inhibit ternary complex formation after 70 S and mRNA had been preincubated (Fig. l(b)). This result confirms the conclusion of Van Dieijen et al. (1978) that ribosome and mRNA from anti-S1 resistant binary complex that) can be chased into a ternary complex. (b) Dirwt
d&&on
Reverse transcriptasc minate
cT)NA
synthesis
of binary
complexes
has been observed to terwhen it encounters
certain
stable hairpins, while it reads through others (Tuerk et CZZ..1988). By lowering the reverse transcriptase concentration we were able to detect reverse t)ranscriptase
stops
at’ a hairpin
in a test
transcript,;
by lowering
the reverse
transcriptasr
concen-
tration we might also be able t.o detect the 30 S--mRNA binary complexes which probabl) include R,NA duplexes. WC were able t’o detect binary complexes under conditions of low MMLV-reverse transcriptase conccnt,ration. The SDSAUG mRXA has a long Shine and Dalgarrio sequence that might facilitate bindary complex formation. When 1 ~~30 S subunits were incubated with SD8A~~G mR?r’A a,t 37 ‘(1. followed by primer extension tenfold diluted (in standard buffer) MMl,V-reverse t,ranscriptasr. cl)NA synthesis was terminated three to five bases 3’ to the Shine and Dalgarno sequence (Fig. 3) and five bases 3’ to the Shine and Dalgarno-like sequence AG(:A. underlined in Figure 3. Tocxprint signals from binary complexes were also obtained when. instead of lowering the reverse transcriptase concent)ration, primer extension was performed at 7°C: on the pT7GI’ t,ranscript,. The pT7G1’ t,ranscript harbors the I~AAGGAW Shim and 1)algarno sequence and the AU(:,4 Shine and l)algarno-like sequence of SD8AUC: mRNA but is of herwise very different from SD8Al’(: mR#NA (compare sequences in Figs 3 and 4). At low ((PO1 PM) 30 S or 70 S concentration. reverse t,ranscriptase st)ops appear two to four bases 3’ to the Shine and ljalgarno sequence, but not 3’ to the Shin? and Dalgarno-like sequencr :-\(:(:A (Fig. 4, lanes 2. 1). At I p~-3O S concentration, reverse t~ransc~riptase stops appear three to tivfb bases 3’ to the, Shinr and Dalgarno sc~~uen~eand in addition a r(‘verse transcriptase stop appears four bases 3’ to the Shine and Datgarno-like sequenct’ A(XA (data not shown). Since the toeprint positions are practically identical for reverse transcription at 7°C and at iii Y”) t,he binary complexes in Fipurc 1 are not artifacts of low temperature extension. ‘I’hc proximity of the reverse t*ranscriptase st,ops to the Shine and Dalgarno sequence in hoth mRNAs suggests that the Shine and Dalgarno sequence is directly base-paired with the 3’ end of 16 S rRNA in the binary complex. To test, this hypot)hesis we preincubated 30 8 subunitIs or 70 S ribosomes with the oligodeoxynucleotide 16 WI, which is complementary to bases 1530 to 1542 of bhe 3’ end of 16 S rRNA. At) 100.fold excess of 16 SF’1 binding of 30 S subunits or 70 S ribosomes t,o the initiat’ion domain of t)hc$ pT7CI transcript was inhibited (Fig. 4. lanes 3. 5). The absence of ribosomal prot,ein S1 on 70 S ribosomes prevented efficient ternary complex formation (Fig. l(a)). We investigat,ed whet’her 70 R ribosomes lacking protein Sl are defective in the ahilitJ7 to bind to mRNA in a binary complex: 70 S
rihosomes depleted of protein Sl. when incubated with i he pT7GC transcript, did not yield boeprint bands at the same position as Sl-containing 70 S
3os/7os
f Me+
12345 SD
6
7
8
9 IO fM.’
3os/7os 44 444 UAAGGAGGAUUGUGUGUGUGUGUGUGUGCAGGAUCCC
of ribosomt:+mRKA binary Figure 3. Drt~ectior~ complexes with the pT7SlNAUG in vitro transcript. Tn addition to the in vitro t’ranscript (extension lanes) rea(‘tions csontained 1 PM-30 S subunits. Reactions were preinc,ubated for 10 min at 37°C followed by primer ext,rnsion with MMLV-reverse transcript,ase at the concent.ration (in units/lo p1 reaction) indicated in brackets above the lanes. Arrows indic&e main reverse transcriptase stops (*aused by binary complexes (30 S). Positions of’ thrsti toeprints wit.hin t.hta sequence of t.he pT7SD8AUG transc,ril)t, are tnarked with arrows below. Shine and I)algarno (Sl)) seyuenc~e and t#he Shine and Ualgarno-like sequence A(:(:A are underlined. The left lane caont,ainsa sequencing rrac*tion incaluding dd(‘TP (G-lane).
Figure 4. Detection of ri hosome m RNA binaty complexes with the pT7G1’ in c?it~ transcript. Reactions contained the components indicat,ed above the lanes at, the concentrations (in +I) indicat,ed in bracket,s. The oligodeox~nu~lroti(ie 16 SI’1 (c.otnF)lrtnrrtt,ar:v to 3’ end of I6 S rRNA) was incubated for 10 min at 37’(’ together with 30 S subunit,s or 70 S ribosotttes before both were added to the reactions. Reactions with all components were preinc.ubated for IO rniti at : caornplexes (f ,Ilel)) indic&etl 1)~ arrowh. .4 srquerrring lane incaluding ddATP ( II-Iane) is shown in lane 6).
ribosom~s but instead resulted in reverse transcript: asr st,ops immediately upstream (compare Fig. 4. lanes 7 and 8). The toeprint bands are locat*ed within the 3’ part of the Shine and Dalgarno sequencsc. Thus. in the a.bsence of ribosomal protein St_ ribosomes probably bind to Shine and Dalgarno sequence. Tf so, some contacts between mRKA and ribosome are missing such t,hat reverse transcriptase
advances right t,o t.he annealing site between thr Shine and Dalgarno sequence and the 3’ ttnd ot 16 S rRNA. More explicitly, Sl itself may block cl)NA synthesis because of its locxation near the Shine and Dalgarno sequent. Van Ijieijen et nl. (1978) reported that complexes between 30 S subunits and MS% mRNA were resistant, to anti-S1 antibodies when they were formed at
SD
30s
4 UAAGGAGGAAAAAAAAAUGC~UCCCG
30s 4
Ribosome Complexes with rn,RN.3 37 “C” but not when they were formed at OY’, suggesting that no functional 30 S-MS2 RNA complexes can form 0°C. We found that 30 S subunits were able to bind to the pT7GI: initiation domain when preincubation was performed at 37°C or in an ice/water bath (Fig. 4, lane 9. and dat’a not shown). The formation of ternary complexes, however. does not take place during preincubation at 0°C‘ or during primer extension at 7°C. Under these conditions only the toeprinting signals of the binary complcces can be detected (Fig. 4, lane 9). Preincubation of pT7GlT mRNA, tRNAye’, and 30 S subunits at 37 “C, followed by primer extension at 7°C’. leads to two toeprints at + 14 and + 15 from a GIJG codon which is located five nucleotides 3’ t)o the Shine and Dalgarno sequence. The same toeprint positions have been obtained when preincuba,tion and primer extension were performed at 37°C: (Hartz et al., 1991). A minor discrepancy is that the main + 15 toeprint stop, reported here is the minor stop when preincubated at, 37°C’. 4. Discussion LVr demonst,rat#e that ribosomal protein Sl is required for terna.ry complex formation of the T4 gene 32 translation initiation site. Furthermore. antibodies against ribosomal protein RI blocked ternary complex formation only when administered before the mRNA was added t’o 70 S ribosomes. This implies the existence of a ribosome-mRNA binary complex that is resistant to anti-Sl. These results are in agreement with those of Van Dieijen rt ab. (1978), whicah were obtained using an in vitro translation system and MS2 RNA as template. Toeprinting under alt)ered conditions allowed us to detect the binding sites of ribosomes in binary complexes on the two synthetic messenger RNAs pT7GI’ and SDOAUG. Both mRNAs contain the Shine and Dalgarno sequence UAAGGAGG and the Shine and Dalgarno-like sequence AGGA, but are otherwise highly divergent. Reverse transcriptase stops (at, 1 PM-30 S subunit concentration) occurred three to five nucleotides 3’ to the Shine and Dalgarno sequence of both init,iation domains. The toeprint positions of the binary complexes differ from those of ternary complexes, which generally yield toeprint,s I5 nucleotides 3’ to the cognate codon of the bound tRNA (Hartz et al.. 1988. 1989). We have argutad previously that’ reverse transcript)ase synthesizes cDNA right up to the edge of ternary complexes (Hart)z et al., 198X). Tt is likely that’ t.he sa,me is true for binary complexes. The fact that t)oeprint’s from both 30 S and 70 S binary complexes were obtained at the same position (Fig. 4) indicates that’ 70 S ribosomal materia.1 encountered b,v reverse transcriptase is part of the 30 S subunit. These data agree with a ribosome model in which the 50 S subunit binds to the 30 S subunit away from thr mRXA binding groovt’ (Gold. 1988). The proximity of the toeprints to the Shine and Dalgarno sequence and the inhibition of the
103
16 SPl i toeprint~s by the oligodeoxynucleotide complementary to the 3’ end of the 16 S rRNA. are in agreement) with a vast number of reports that the Shine and Dalgarno sequence is involved in the binding of the 30 S subunit (Backendorf et al., 1980. 1981; Van Duin et aZ., 1984; Hui & de Boer. 1987; (‘alogero et al.. 1988). At elevated ribosome conyentration we detected a toeprint band four or five bases 3’ to the sequence AGGA. This agrees with the notion that ribosomes can bind Shine and I)algarno-like sequences outsidtl of initiation domains (Taniguchi & Weissmann, 1979). I)o other contacts besides the Shine and Dalgarno interacation exist, that stabilize a binary complex between mRSA and ribosome? The finding that 70 S ribosomes depleted of protein Sl fail to toeprint at, the same positions as normal 70 S ribosomes, but instead yield toeprints in the 3’ part of t,htb Shim and Dalgarno scquencxe itself, suggests that protein Sl. either directly or indirectly, provides other contacts. The extra caontac*t.smight explain why 30 S binary complexes with mRNA are more stable than 30 S binary compleses wit,h an oligotleoxynuclec,tide complementary t’o the 3’ end of 16 S rRNA (Kackendorf et crl., 1980). Those cont,acts might also be essential for efficient t’ernary complex formation. The toeprint bands obt’ained with 70 S depleted of Sl , which are located in the 3’ part of the Shine and Dalgarno sequence. show that, in the absence of Sl the Shine and Dalgarno sequence can still base-pair with the 3’ end of the I6 S rRNA. This base-pairing leads to rt’versc transcript&se pausing just like secondary st*ruc+turrs do (Fig. 1)). The samr conclusion has been reac.hed by llackendorf rf nl. (1981) and by 1,aughrea & Tam (1989). who demonstrated t,hat 30 S binding t’o olig(~nucleot,ides wit’h Shine and Dalgarno-like sequences was independent of protein Sl 1)o the binary complexes serve as int)rrmediates for t’hta formation of ternary complexes! A wealth of arguments favors that possibi1it.v. The binary complexes form at the Shine and Dalgarno st’c~uencY% of initiation domains that support ! ernar! complex formation. Thr Shine and Dalgarno sequences in t,hose initiation domains a,re clearl\- involved in ternary c~omplcs format ion (Hartz et al., 1991). Under the conditions used to detect binary complexes we were also able to det,ect ternary complexes if initiator tRNA was included in the reactions. Those ternary complexes toeprint at the same positions as ternary complexes formed under standard conditions, at + 14 and + I3 from a (iI TG codon. However. they also yield thtt toeprint signal from the 30 S-mRNA binar)- complexes. This is expected if ribosome binding to the initiation domain serves as an intermediate step in ternary cotnpl~xx formai,ion. However, it does not exclude thth possibilit.?; t,bat the c,odon~ant,i~ocion basepairing can occur before the other part8s of the init,iation domain interact with t)he 30 S subunit. On the>other hand. cit,her the tRNA binding to the 30 S subunit or the c~odon-ant,i~odon basch-pairing step rrquirt,s high ac.tivation energy. sincar incalrbation in
I04
Binary Complex
TernaryComplex
PreternaryComplex
Figure 5. Proposed pathway for t,ernary complex formation on the pT7GI’ transcript. hy brackets for the binary complex and bg an arrow for the t,ernary romplrx. an ice/water bath yields only a toeprint from the binary complex and not from the ternary complex, As shown in Figure 5, binarT complexes arc’ a. on reasonable first st’age in the imtlation pathway most1 mR?\iAs. The initiator tRNA might, then hind t’o the 30 S-mRNA binary complex to form ;I prrt’ernary complex in which the t,KNA is hound IO the rihosome hut, is notz base-paired with the initi;rt ion c*odon ((:ualerei & T’on. 1981 ). The preternar) complex is experimrntally indistinguishable (I)! toeprinting) from the binary complex. ‘l’he preternary complex rearranges to form a t~rnar>~ complex in which tht, initiator tR,NA is base-pair~~d wit.h the initiation c*odon. \l’e thank R. Traut for providing 30 S ribosomal sub units and +I. Van I)uin for his suggest,ion t*o perform primer extension reac%ions at i’(‘. We also thank I). Isarrick for his help with t)hr c+ming of’ plasmid pT7SD841TC: and the C1’. M. Keck Foundation for their generous support of RX:\ s&ncr on the Boulder campus. This work was supported by IVIH rrsrarch grant GM28685. We also thank the W. M. Keck Foundation for their generous support of RNA science on the Boulder (‘ampus.
References Hackendorf. C‘., Overbeek, G. P., Van Boom, J. H.. Van der Marel, (:., Veeneman, G. & \:an Duin. ,J. (1980). Role of 16-S R?u’A in ribosome messenger recognition. Eur. J. Biochem. 110. 599-604. ISac*krndorf. C‘., Ravensbergen. (‘. *J. r.. Van der Plas. .J.. van bk~orn, J. H., Veeneman, G. &, Van Duin. J. (1981). Basepairing potential of the 3’ terminus ot I6 S RXA: dependence on the functional stat,r of thr 30 S subunit and the presence of’ protein S21. Nuc/. Acids
Rrs. 9. 1425- 1444.
Toeprint
posit ions are indic~atetl
1%‘. & Yonath. A.. eds). pp. X05-X26, Balaban. M. TSS. Rehovot. Haltz. I).. McPhreters. I). S.. Traut, It. $ (:old. I,. (1988). Kxtensiorr inhibition analysis of translation initiat,ion complexes. Methods Enqmol. 164, 419-425. Hartz, D.. McPheeters, D. S. & Gold, L. (I!%!)). St‘lection of the initiator tRNA by &cherichia coli initiation factors. Genes Deoel. 3, 1899-1912. Hartz, I)., McPheeters. I>. S. & Cold, 1,. (1991). InHuencr of mRru’A determinants on translation initiation in lkherichia
coli.
J.
Mol.
Riol.
218. 8R-!)7.
Hui. A. & de Boer. H. A. (1987). Specializrd rihosomr systern: preferential translation of a singlr rnK#XA species bv a subpopulation of mutated ribosomes in Esch,erichk
coli.
f’roc.
Nut.
Acnd.
Sci..
IT.S.,g.
84.
4762-4766. Krnney, $1.W.. Fanning, 1’. (i.. I,ambert. .J. M. & Traut.. It. Ft. (1!)79). The subunit int,erphase of thr Esrherichiu di riboson~~~. (‘rosslinking of’ 30 S protein S9 to proteins of the 50 R subunit, .1. :Jlo/.
Hid. 135, 15lLI70. Krisch. H. & Allet’. 13. (I!%%?). Pl’ucleotidr sequt~n~es involved in bacteriophagt, T4 gene Z t,ranslational self-regulation. Z’roc. Xuf. ilcad. Sri., I ‘.S.,-I 79. 493i 4!)41. Laughrcaa, M. & Tam. ,J. (1989). Ribosomal prot,ein SI and initiation fact,or IF3 do not. promote the ribosomal binding of y I9-nucleotidr long mI)XA and mRNA models. Biochem. (‘ell Biol. 67. 812-817. Lowary. I’., Sampson, tJ.. Milligan, .J.. (:rorbtA. I). & Uhlenbeck, 0. (1. (1986). A better way to make IiSA aad Dynumir.s oj for physical studies. In Structurr ld,l’d (van Knippenberg. I’. H. & Hilbrrs. (‘. W’.. rds). pp. 69.-76, Plenum Press, New York. McPheeters. I). S., Stormo. C. & ($old, I,. (I9HX). Autogenous regulatorv site on the backeriophagr T4 gene .?2 messenger R%A. .I. Mol. Biol. 201, 517-535. Taniguchi. T. Br Weissmann. (‘. (1979). Ksch~rrichin co/i ribosomes bind to non-initiator sites of Q,fl RiVA in the absence of formvlmt!thion~l-tRSA. ./. ;l!o/. Kiol.
128, 481-500.
Tuerk, C’.. Gauss. I’.. Therrnes, C’.. Croehr. I). It.. (iaylr, 11.. Guild. N.. St’orrno. (i., I)‘Aubrntorl(‘arafa. Y., Uhlenbeck. 0. (1.. Tinoco, 1.. Jr. I%rody. E. Xi. 8 Gold. I,. (1988). (‘lTlT(:(X: hairJ)ins: Sat. Acad. Sri.. I’.S.A. 85. 6421-6431. structures extraordinarily stable secondary I’ost-transc,riptiolial regulator~~ (:old. I,. (1988). associated wit,h various biochemical processes. I’roc. mechanisms in E. ~~jli. Annw. Rw. Hiochw. 57. Nat. Acad. Sci., U.S.A. 85, 1364&1368. 199~-23’1. tI Van IhfGjni. (i.. Vand drr Larken. (‘. *J.. \-au (:oltl. l,., l’ribno\v. D.. Schneider. T.. Shinedling. S.. Knipprnberg. 1’. H. & Van I)uin. ,I. (1975).Furlcbtion Singer. K. S. Nr Stormo. G. (1981). Translational of ~schrricl~irr roli ribosomal protfbin S I in translation init,iation in procaryotes. il TLTLII. Ret,. M%crobiol. 35. of nat,ural and synthetic nrrbssengcr KS:2. .1. :Mo!. 365-40‘3.t Hiol. 93. 351 366. (:ualrrzi. (‘. B Pon. (‘. 1,. (1981). Protein biosynthesis in Van I)ieijrll. C:.. Zipori. I’.. \‘an l’rooijrn, \I’. B \‘an I)uin, procar?;otic crlls: mechanism of 30 S initiation ,I. (1978). lnvolorment of ribosomal prot,rin S I in thr complex formation in Escherichifl coli. In NtT2Lf:t,uUTfLI assembly of the initiation (aomplrx. Eur. .I. Hiochrm daprcts of Recognition and Assembly in Biological 90. 571 -5X0. Macromolrcul~s (Ralaban. I,., Sussman. ,I. L.. Tranb.
(‘alogero, R. A., Pon. (‘. L.. Canonaco, M. A. B Gualerzi. (‘. 0. (1988). Selection of the mRh’A translational initiation region by Escherichia coli ribosomrs. I’m.
Ribosome Complexes
Van Duin, qJ.. Overbeek, (:. P. & Rackendorf, C. (1980). Functional recognition of phage RNA by 30-S ribosomal subunits in the absence of initiator tRljA. !T’l/r. J. Biorlwttl. 110. 593-597.
with mRNA
105
\‘an Duin. ,J., Ravensbergen, C”. J. (‘. &, Doornbos. ,J. (1984). Rasepairing of oligonucleotides to the 3’ end of 16 S ribosomal RNA is not stabilized by ribosornal proteins. Swl. Arida RP~s.12. 5079-5086.
Edited by P. rott Flipp~l
Bid.
(1!391) 218, 99-105
Detection of Escherichia coli Ribosome Binding at Translation Initiation Sites in the Absence of tRNA Dieter Hartz, David S. McPheeterst, Louis Green and Larry Goldj: Department
of Molecular, Cellular and Developmental University of Colorado, Campus Box 347 Boulder, CO 8030.9-0347. TT.S.A.
(Received
7 May
Biology
1990: accepted 22 October 19.90)
Binary complexes between messenger RNA and E. coli ribosomes were examined. A ribosome-mRNA binary complex on T4 gene 32 mRNA withstood inhibition by antibodies against ribosomal protein Sl. Anti-S1 blocks ternary complex formation, as measured by analysis, only when preincubated with ribosomes “extension inhibition” or “toeprinting” prior to mRNA addition and not when anti-S1 was added after preincubation of ribosomes and mRNA. The ribosome was directly localized in a binary complex on two translation initiation sites by toeprinting analysis. In the absence of tRNA the ribosome halted cl)NA synthesis by reverse transcriptase close to the Shine and Dalgarno sequence. Binary complex formation was inhibited by an oligodeoxynucleotide competitor of the Shine and Dalgartio sequence.
1. Introduction While init,iat.ion complex formation has been extensively studied, the literature on functional ribosome-mRSA binary complexes has been comscarce. Evidence of functional paratively 30 S-messenger RNA binary complexes has been presented by Van Dieijen et al. (1978). MS2 RNA that had been preincubated with 30 S ribosomal subunits could be successfully translated in the presence of antibodies against ribosomal protein Sl. The same ant,ibodies inhibited translation when they were administered to 30 S subunits before MS2 RNA addition. Likewise, other inhibitors of binary complex formation (such as edeine and tricarboxylic acid) inhibited translation only when preincubated with 30 S subunitIs (Van Duin et al., 1980). Similarly, an octadeoxynucleotide, complementary to the 3’ end of the 16 S rRNA, inhibited MS2 translation when added to 30 S subunits before MS2 RNA addition. This experiment stressed the importance of the Shine and Dalgarno sequence for the binding of ribosomes to the mRNA (Backendorf rt al., 1980). Ribosomes not only bind to Shine and Dalgarno sequences in translation initiation domains but also t Present’ address: COORS Biotech, 6204 S. College Ave, Ft (lollins, CO 80525, U.S.A. $ Author to whom all correspondence should be addressed
to Shine and Dalgarno-like sequences at non-initiation sites (Taniguchi & Weissmann, 1979). The binding at the non-initiation sites probably does not contribute to initiation complex formation (Gold et al.. 1981). It is crucial, however, to monitor ribosomal binding at, specific initiation sit,es when stud?ing functional 30 S-mRNA binary complexes rn also called extension inhibition, z&o. lising toeprinting (Hartz et al., 1988) to monitor ternary complex formation we confirmed the results of Van Dieijen et al. (1978). By changing toeprint,ing conditions we were then able to localize ribosome binding at two different initiation domains in the absence of tRNA or initiation factors. That is. t,he 30 S parti&, by itsdf, finds proper init’iation regions on mR?;As.
2. Materials and Methods (a) Reagents Purified. uncharged Eschcrichia coli t RN$‘” WBS purchased from Roehringer-Mannheim. AMV$ reverse t’ranscriptase and MMLV-reverse transcriptase were obtained from Life Sciences Inc. and Betheseda Research Laboratories. respectively. T7 RNA polymerasr wiss provided by 0. IJhlenbeck. T4 polynucleotide kinasr was purchased from New England Biolabs Inc. Ribonuclease inhibit,or RNasin was obtained from Promega. $ Abbreviations used: AMV, avian mpeloblastosis virus: MMTV, mouse mammary tumor virus.
100
1).
tlrrrk
The 30 S ribosomal subunits. prepared according t,o Kenney rl ~1. (1979). were a gift, from R. Traut. 70 S rikmsomes and 70 S ribosomes 93c/o depleted of protein Sk by passage over a poly(U) column k70 S (-Sk)], as well as c*rudr Sl antiserum prepared against highly purified St. were a gift from ,J. Rabinowitz. In &o RNAs from the PwII cut plasmids pRS170. pTS26, pT7SkXAkTC and pT7CIJ were synthesized with phage T7 polymerase according to Lowary el al. (1986). The RNAs were purified on a 6% (w/v) polyacrylamide gel. The plasmid pRS170 contains the sequence from -92 tjo 107 of gene 32 (Krisch & Allet, 19%). Plasmid pTS26 contains the hairpin shown in Fig. 2. Plasmids prk’7S1>8AI:(: and pT7GU contain the synthetic translation initiation sites depicted in Figs 3 and 4, respectively. All sequences are downstream from a T7 promotIer. The construction of plasmid pRSl70 and pTS26 are described k)y Hartz ut al. (1989) and McPheeters rt nl. (1988). respectively. and the construction of plasmids pT7S1)8AIJ(: and pT7QU will be described elsewhere (Hartz et al., 1991). Oligodeox?nucleotides were synthesized on an lIk’plietl Riosystems Model 380A I)NA Synthesizer and purified by preparative gel electrophoresis. “32loopD” which was used as primer on the pR8170 transcript and “LP134” which was used as primer on pT7SD8Ak’C and pTiC1‘ transcripts have been described kry Hartz et crl. (1989). Oligotleoxynucleotitlr I6 SPI has the sequence 5’ T:Ir\(:(:A(:CT(:AT(‘. (k)) Methods Extension inhibition under standard conditions (rxperiment,s of Fig. 1 and sequencing) was performed essentially as described by Hartz et al. (1988). The standard kmffer (10 mM-Tris-acetate (pH 7.4), 60 mM-N&Cl. 6 mM-/-mercaptoethanok, 10 mM-Mg acetate) contained in addition 5 units RNasin per ~1 and 1 mM-dithiothreitol in incubations containing crude antisera. Reactions with all ingredients were prepared on ice and preincubated, as specified in the Figure legends. before primer extension was performed for 15 min at 37°C using 200 units of MMLV-reverse transcriptase per reaction. (AMV-reverse transcriptase was used for sequencing.) Extension inhibit’ion was modified to detect reverse transcriptase stops at a hairpin and at ribosome-mR?GA binary complexes. To detect the hairpin MMLV-reverse t,ranscript*ase was diluted in 20 miv-Tris. HCI (pH 7.5). 1 rnbl-dithiothreitol. 91 mM-EDTA, 100 mM-NaCI, 50°b glycerol to the concentrations shown in Fig. 2. One ~1 was then added to 5 ~1 react,ions and primer extension performed for 1.5 min at 37°C. To detect binary complexes t*tre primer extension reaction with MMLV-reverse transcriptase was performed at 7°C: for 4 h instead of 37 “(’ (experiments of Fig. 4), or MMLV-reverse transcriptasr was diluted IO-fold in standard buffer to a final conrentrat’ion of 2 units/PI in toeprinting reactions and primer, extension was performed for 15 min at 37 ‘C (exprrimentjs of Fig. 3).
3. Results (a) From binary
to ternary
complexes
during
initiatiorb
Ribosomal protein 81 is necessary for translat’ion of the MS2 coat cistron in vitro (Van Dieijen et al., 1975). Protein Sl appears to be involved in the translation initiation step and might help to bind
et,
ul.
(a)
(b)
Figure 1. kmportance of rik)osomal protein SI for ternary complex formation on the pRSl70 i?l Gtm transcript (a) In addition to 0075 PM-70 S ribosomes or 0675 ~~-70 S rikrosomes depleted to Sk (70 S (-SI )k. the right lanes contained 615 ,uivr-tRRiAF”. Rractious were preincubated for IO min at 37”(1 followed by primer extension for 15 min at 37’C. (k)) Reactions contained 0675 PM-70 S ribosomes. pRSl70 in citro transcript (mRh‘A). crude antisera against protein Sl (Ab), and. with the exception of the left lane, 0.15 FM-tRNA,M”. The standard buffer contained in addition 5 units RISasin/pl and 1 mm-dithiothreitol. Components in brackets were added together and incubated for 5 min at 37°C before the next components were added at intervals of’ 6 min. Preincubation was continued for 5 min after t,he last and followed by primer extension addition with MMLV-reverse transcriptase for 15 min at, 37 “(1. Toeprint positions (arrow) are at + 15 from the A of the initiation codon.
ribosomes to the mRNA (Van Dieijen et al., 1978). We tested the Sl requirement for ternary complex formation on the bacteriophage T4 gene 32 initiation domain using toeprinting (Hartz et al., 1988). A mixture of normal or protein Sl-depleted 70 S ribosomes and initiator tRNA were assayed for ternary complex formation on the pRSI70 i7~ vitro transcript (which contains the T4 gene 32 initiation and tRNAr” domain). While 70 S ribosomes yielded a toeprint at + 15 from the first base of the mitiation codon, the ribosomes lacking protein Sl yielded a drastically diminished toeprint (Fig. 1(a)). Neither 70 S nor 70 S depleted of Sl yielded a toeprint without tRNAye’ under these conditions. It, is clear from this experiment that Sl is somehow involved in ternary complex formation.
Ribosome Complexes
with mRNA
101
reverse transcriptase more easily reads t,hrough the hairpin when present at a high concentration (Fig. 2). Probably high enzyme levels allow reinitiation of cI>NA synt,hesis, which lowers the signal observed at t,he base of the hairpin. WP reasoned that
v-u A 5’ C”C”G*-%AGGA”CC
Figure 2. Reverse transcriptase stops at a hairpin in the pTS26 transcript are dependent on the MMLV-reverse transcriptase concentration (indicated in units (U) per 5 ~1 reaction above the lanes). The locations of the reverse transcriptase stops are marked by arrowheads. Note that with lowered reverse transcriptase concentration they increase in intensity (as compared to the signal from the full length rnKA) and are found closer to the hairpin base. On the right a sequencing lane including (C-lane) is shown.
LVe next tested the effect of antibodies protein
Sl
on ternary
complex
formation
ddGTP
against on the
same mRNS. Anti-S1 antibodies strongly inhibited terrmry complex formation when added to 70 S ribosomes prior to the mRNA, regardless of when the tR,NAp’ was added (Fig. 1(b)). However, antiSl antibodies did not inhibit ternary complex formation after 70 S and mRNA had been preincubated (Fig. l(b)). This result confirms the conclusion of Van Dieijen et al. (1978) that ribosome and mRNA from anti-S1 resistant binary complex that) can be chased into a ternary complex. (b) Dirwt
d&&on
Reverse transcriptasc minate
cT)NA
synthesis
of binary
complexes
has been observed to terwhen it encounters
certain
stable hairpins, while it reads through others (Tuerk et CZZ..1988). By lowering the reverse transcriptase concentration we were able to detect reverse t)ranscriptase
stops
at’ a hairpin
in a test
transcript,;
by lowering
the reverse
transcriptasr
concen-
tration we might also be able t.o detect the 30 S--mRNA binary complexes which probabl) include R,NA duplexes. WC were able t’o detect binary complexes under conditions of low MMLV-reverse transcriptase conccnt,ration. The SDSAUG mRXA has a long Shine and Dalgarrio sequence that might facilitate bindary complex formation. When 1 ~~30 S subunits were incubated with SD8A~~G mR?r’A a,t 37 ‘(1. followed by primer extension tenfold diluted (in standard buffer) MMl,V-reverse t,ranscriptasr. cl)NA synthesis was terminated three to five bases 3’ to the Shine and Dalgarno sequence (Fig. 3) and five bases 3’ to the Shine and Dalgarno-like sequence AG(:A. underlined in Figure 3. Tocxprint signals from binary complexes were also obtained when. instead of lowering the reverse transcriptase concent)ration, primer extension was performed at 7°C: on the pT7GI’ t,ranscript,. The pT7G1’ t,ranscript harbors the I~AAGGAW Shim and 1)algarno sequence and the AU(:,4 Shine and l)algarno-like sequence of SD8AUC: mRNA but is of herwise very different from SD8Al’(: mR#NA (compare sequences in Figs 3 and 4). At low ((PO1 PM) 30 S or 70 S concentration. reverse t,ranscriptase st)ops appear two to four bases 3’ to the Shine and ljalgarno sequence, but not 3’ to the Shin? and Dalgarno-like sequencr :-\(:(:A (Fig. 4, lanes 2. 1). At I p~-3O S concentration, reverse t~ransc~riptase stops appear three to tivfb bases 3’ to the, Shinr and Dalgarno sc~~uen~eand in addition a r(‘verse transcriptase stop appears four bases 3’ to the Shine and Datgarno-like sequenct’ A(XA (data not shown). Since the toeprint positions are practically identical for reverse transcription at 7°C and at iii Y”) t,he binary complexes in Fipurc 1 are not artifacts of low temperature extension. ‘I’hc proximity of the reverse t*ranscriptase st,ops to the Shine and Dalgarno sequence in hoth mRNAs suggests that the Shine and Dalgarno sequence is directly base-paired with the 3’ end of 16 S rRNA in the binary complex. To test, this hypot)hesis we preincubated 30 8 subunitIs or 70 S ribosomes with the oligodeoxynucleotide 16 WI, which is complementary to bases 1530 to 1542 of bhe 3’ end of 16 S rRNA. At) 100.fold excess of 16 SF’1 binding of 30 S subunits or 70 S ribosomes t,o the initiat’ion domain of t)hc$ pT7CI transcript was inhibited (Fig. 4. lanes 3. 5). The absence of ribosomal prot,ein S1 on 70 S ribosomes prevented efficient ternary complex formation (Fig. l(a)). We investigat,ed whet’her 70 R ribosomes lacking protein Sl are defective in the ahilitJ7 to bind to mRNA in a binary complex: 70 S
rihosomes depleted of protein Sl. when incubated with i he pT7GC transcript, did not yield boeprint bands at the same position as Sl-containing 70 S
3os/7os
f Me+
12345 SD
6
7
8
9 IO fM.’
3os/7os 44 444 UAAGGAGGAUUGUGUGUGUGUGUGUGUGCAGGAUCCC
of ribosomt:+mRKA binary Figure 3. Drt~ectior~ complexes with the pT7SlNAUG in vitro transcript. Tn addition to the in vitro t’ranscript (extension lanes) rea(‘tions csontained 1 PM-30 S subunits. Reactions were preinc,ubated for 10 min at 37°C followed by primer ext,rnsion with MMLV-reverse transcript,ase at the concent.ration (in units/lo p1 reaction) indicated in brackets above the lanes. Arrows indic&e main reverse transcriptase stops (*aused by binary complexes (30 S). Positions of’ thrsti toeprints wit.hin t.hta sequence of t.he pT7SD8AUG transc,ril)t, are tnarked with arrows below. Shine and I)algarno (Sl)) seyuenc~e and t#he Shine and Ualgarno-like sequence A(:(:A are underlined. The left lane caont,ainsa sequencing rrac*tion incaluding dd(‘TP (G-lane).
Figure 4. Detection of ri hosome m RNA binaty complexes with the pT7G1’ in c?it~ transcript. Reactions contained the components indicat,ed above the lanes at, the concentrations (in +I) indicat,ed in bracket,s. The oligodeox~nu~lroti(ie 16 SI’1 (c.otnF)lrtnrrtt,ar:v to 3’ end of I6 S rRNA) was incubated for 10 min at 37’(’ together with 30 S subunit,s or 70 S ribosotttes before both were added to the reactions. Reactions with all components were preinc.ubated for IO rniti at : caornplexes (f ,Ilel)) indic&etl 1)~ arrowh. .4 srquerrring lane incaluding ddATP ( II-Iane) is shown in lane 6).
ribosom~s but instead resulted in reverse transcript: asr st,ops immediately upstream (compare Fig. 4. lanes 7 and 8). The toeprint bands are locat*ed within the 3’ part of the Shine and Dalgarno sequencsc. Thus. in the a.bsence of ribosomal protein St_ ribosomes probably bind to Shine and Dalgarno sequence. Tf so, some contacts between mRKA and ribosome are missing such t,hat reverse transcriptase
advances right t,o t.he annealing site between thr Shine and Dalgarno sequence and the 3’ ttnd ot 16 S rRNA. More explicitly, Sl itself may block cl)NA synthesis because of its locxation near the Shine and Dalgarno sequent. Van Ijieijen et nl. (1978) reported that complexes between 30 S subunits and MS% mRNA were resistant, to anti-S1 antibodies when they were formed at
SD
30s
4 UAAGGAGGAAAAAAAAAUGC~UCCCG
30s 4
Ribosome Complexes with rn,RN.3 37 “C” but not when they were formed at OY’, suggesting that no functional 30 S-MS2 RNA complexes can form 0°C. We found that 30 S subunits were able to bind to the pT7GI: initiation domain when preincubation was performed at 37°C or in an ice/water bath (Fig. 4, lane 9. and dat’a not shown). The formation of ternary complexes, however. does not take place during preincubation at 0°C‘ or during primer extension at 7°C. Under these conditions only the toeprinting signals of the binary complcces can be detected (Fig. 4, lane 9). Preincubation of pT7GlT mRNA, tRNAye’, and 30 S subunits at 37 “C, followed by primer extension at 7°C’. leads to two toeprints at + 14 and + 15 from a GIJG codon which is located five nucleotides 3’ t)o the Shine and Dalgarno sequence. The same toeprint positions have been obtained when preincuba,tion and primer extension were performed at 37°C: (Hartz et al., 1991). A minor discrepancy is that the main + 15 toeprint stop, reported here is the minor stop when preincubated at, 37°C’. 4. Discussion LVr demonst,rat#e that ribosomal protein Sl is required for terna.ry complex formation of the T4 gene 32 translation initiation site. Furthermore. antibodies against ribosomal protein RI blocked ternary complex formation only when administered before the mRNA was added t’o 70 S ribosomes. This implies the existence of a ribosome-mRNA binary complex that is resistant to anti-Sl. These results are in agreement with those of Van Dieijen rt ab. (1978), whicah were obtained using an in vitro translation system and MS2 RNA as template. Toeprinting under alt)ered conditions allowed us to detect the binding sites of ribosomes in binary complexes on the two synthetic messenger RNAs pT7GI’ and SDOAUG. Both mRNAs contain the Shine and Dalgarno sequence UAAGGAGG and the Shine and Dalgarno-like sequence AGGA, but are otherwise highly divergent. Reverse transcriptase stops (at, 1 PM-30 S subunit concentration) occurred three to five nucleotides 3’ to the Shine and Dalgarno sequence of both init,iation domains. The toeprint positions of the binary complexes differ from those of ternary complexes, which generally yield toeprint,s I5 nucleotides 3’ to the cognate codon of the bound tRNA (Hartz et al.. 1988. 1989). We have argutad previously that’ reverse transcript)ase synthesizes cDNA right up to the edge of ternary complexes (Hart)z et al., 198X). Tt is likely that’ t.he sa,me is true for binary complexes. The fact that t)oeprint’s from both 30 S and 70 S binary complexes were obtained at the same position (Fig. 4) indicates that’ 70 S ribosomal materia.1 encountered b,v reverse transcriptase is part of the 30 S subunit. These data agree with a ribosome model in which the 50 S subunit binds to the 30 S subunit away from thr mRXA binding groovt’ (Gold. 1988). The proximity of the toeprints to the Shine and Dalgarno sequence and the inhibition of the
103
16 SPl i toeprint~s by the oligodeoxynucleotide complementary to the 3’ end of the 16 S rRNA. are in agreement) with a vast number of reports that the Shine and Dalgarno sequence is involved in the binding of the 30 S subunit (Backendorf et al., 1980. 1981; Van Duin et aZ., 1984; Hui & de Boer. 1987; (‘alogero et al.. 1988). At elevated ribosome conyentration we detected a toeprint band four or five bases 3’ to the sequence AGGA. This agrees with the notion that ribosomes can bind Shine and I)algarno-like sequences outsidtl of initiation domains (Taniguchi & Weissmann, 1979). I)o other contacts besides the Shine and Dalgarno interacation exist, that stabilize a binary complex between mRSA and ribosome? The finding that 70 S ribosomes depleted of protein Sl fail to toeprint at, the same positions as normal 70 S ribosomes, but instead yield toeprints in the 3’ part of t,htb Shim and Dalgarno scquencxe itself, suggests that protein Sl. either directly or indirectly, provides other contacts. The extra caontac*t.smight explain why 30 S binary complexes with mRNA are more stable than 30 S binary compleses wit,h an oligotleoxynuclec,tide complementary t’o the 3’ end of 16 S rRNA (Kackendorf et crl., 1980). Those cont,acts might also be essential for efficient t’ernary complex formation. The toeprint bands obt’ained with 70 S depleted of Sl , which are located in the 3’ part of the Shine and Dalgarno sequence. show that, in the absence of Sl the Shine and Dalgarno sequence can still base-pair with the 3’ end of the I6 S rRNA. This base-pairing leads to rt’versc transcript&se pausing just like secondary st*ruc+turrs do (Fig. 1)). The samr conclusion has been reac.hed by llackendorf rf nl. (1981) and by 1,aughrea & Tam (1989). who demonstrated t,hat 30 S binding t’o olig(~nucleot,ides wit’h Shine and Dalgarno-like sequences was independent of protein Sl 1)o the binary complexes serve as int)rrmediates for t’hta formation of ternary complexes! A wealth of arguments favors that possibi1it.v. The binary complexes form at the Shine and Dalgarno st’c~uencY% of initiation domains that support ! ernar! complex formation. Thr Shine and Dalgarno sequences in t,hose initiation domains a,re clearl\- involved in ternary c~omplcs format ion (Hartz et al., 1991). Under the conditions used to detect binary complexes we were also able to det,ect ternary complexes if initiator tRNA was included in the reactions. Those ternary complexes toeprint at the same positions as ternary complexes formed under standard conditions, at + 14 and + I3 from a (iI TG codon. However. they also yield thtt toeprint signal from the 30 S-mRNA binar)- complexes. This is expected if ribosome binding to the initiation domain serves as an intermediate step in ternary cotnpl~xx formai,ion. However, it does not exclude thth possibilit.?; t,bat the c,odon~ant,i~ocion basepairing can occur before the other part8s of the init,iation domain interact with t)he 30 S subunit. On the>other hand. cit,her the tRNA binding to the 30 S subunit or the c~odon-ant,i~odon basch-pairing step rrquirt,s high ac.tivation energy. sincar incalrbation in
I04
Binary Complex
TernaryComplex
PreternaryComplex
Figure 5. Proposed pathway for t,ernary complex formation on the pT7GI’ transcript. hy brackets for the binary complex and bg an arrow for the t,ernary romplrx. an ice/water bath yields only a toeprint from the binary complex and not from the ternary complex, As shown in Figure 5, binarT complexes arc’ a. on reasonable first st’age in the imtlation pathway most1 mR?\iAs. The initiator tRNA might, then hind t’o the 30 S-mRNA binary complex to form ;I prrt’ernary complex in which the t,KNA is hound IO the rihosome hut, is notz base-paired with the initi;rt ion c*odon ((:ualerei & T’on. 1981 ). The preternar) complex is experimrntally indistinguishable (I)! toeprinting) from the binary complex. ‘l’he preternary complex rearranges to form a t~rnar>~ complex in which tht, initiator tR,NA is base-pair~~d wit.h the initiation c*odon. \l’e thank R. Traut for providing 30 S ribosomal sub units and +I. Van I)uin for his suggest,ion t*o perform primer extension reac%ions at i’(‘. We also thank I). Isarrick for his help with t)hr c+ming of’ plasmid pT7SD841TC: and the C1’. M. Keck Foundation for their generous support of RX:\ s&ncr on the Boulder campus. This work was supported by IVIH rrsrarch grant GM28685. We also thank the W. M. Keck Foundation for their generous support of RNA science on the Boulder (‘ampus.
References Hackendorf. C‘., Overbeek, G. P., Van Boom, J. H.. Van der Marel, (:., Veeneman, G. & \:an Duin. ,J. (1980). Role of 16-S R?u’A in ribosome messenger recognition. Eur. J. Biochem. 110. 599-604. ISac*krndorf. C‘., Ravensbergen. (‘. *J. r.. Van der Plas. .J.. van bk~orn, J. H., Veeneman, G. &, Van Duin. J. (1981). Basepairing potential of the 3’ terminus ot I6 S RXA: dependence on the functional stat,r of thr 30 S subunit and the presence of’ protein S21. Nuc/. Acids
Rrs. 9. 1425- 1444.
Toeprint
posit ions are indic~atetl
1%‘. & Yonath. A.. eds). pp. X05-X26, Balaban. M. TSS. Rehovot. Haltz. I).. McPhreters. I). S.. Traut, It. $ (:old. I,. (1988). Kxtensiorr inhibition analysis of translation initiat,ion complexes. Methods Enqmol. 164, 419-425. Hartz, D.. McPheeters, D. S. & Gold, L. (I!%!)). St‘lection of the initiator tRNA by &cherichia coli initiation factors. Genes Deoel. 3, 1899-1912. Hartz, I)., McPheeters. I>. S. & Cold, 1,. (1991). InHuencr of mRru’A determinants on translation initiation in lkherichia
coli.
J.
Mol.
Riol.
218. 8R-!)7.
Hui. A. & de Boer. H. A. (1987). Specializrd rihosomr systern: preferential translation of a singlr rnK#XA species bv a subpopulation of mutated ribosomes in Esch,erichk
coli.
f’roc.
Nut.
Acnd.
Sci..
IT.S.,g.
84.
4762-4766. Krnney, $1.W.. Fanning, 1’. (i.. I,ambert. .J. M. & Traut.. It. Ft. (1!)79). The subunit int,erphase of thr Esrherichiu di riboson~~~. (‘rosslinking of’ 30 S protein S9 to proteins of the 50 R subunit, .1. :Jlo/.
Hid. 135, 15lLI70. Krisch. H. & Allet’. 13. (I!%%?). Pl’ucleotidr sequt~n~es involved in bacteriophagt, T4 gene Z t,ranslational self-regulation. Z’roc. Xuf. ilcad. Sri., I ‘.S.,-I 79. 493i 4!)41. Laughrcaa, M. & Tam. ,J. (1989). Ribosomal prot,ein SI and initiation fact,or IF3 do not. promote the ribosomal binding of y I9-nucleotidr long mI)XA and mRNA models. Biochem. (‘ell Biol. 67. 812-817. Lowary. I’., Sampson, tJ.. Milligan, .J.. (:rorbtA. I). & Uhlenbeck, 0. (1. (1986). A better way to make IiSA aad Dynumir.s oj for physical studies. In Structurr ld,l’d (van Knippenberg. I’. H. & Hilbrrs. (‘. W’.. rds). pp. 69.-76, Plenum Press, New York. McPheeters. I). S., Stormo. C. & ($old, I,. (I9HX). Autogenous regulatorv site on the backeriophagr T4 gene .?2 messenger R%A. .I. Mol. Biol. 201, 517-535. Taniguchi. T. Br Weissmann. (‘. (1979). Ksch~rrichin co/i ribosomes bind to non-initiator sites of Q,fl RiVA in the absence of formvlmt!thion~l-tRSA. ./. ;l!o/. Kiol.
128, 481-500.
Tuerk, C’.. Gauss. I’.. Therrnes, C’.. Croehr. I). It.. (iaylr, 11.. Guild. N.. St’orrno. (i., I)‘Aubrntorl(‘arafa. Y., Uhlenbeck. 0. (1.. Tinoco, 1.. Jr. I%rody. E. Xi. 8 Gold. I,. (1988). (‘lTlT(:(X: hairJ)ins: Sat. Acad. Sri.. I’.S.A. 85. 6421-6431. structures extraordinarily stable secondary I’ost-transc,riptiolial regulator~~ (:old. I,. (1988). associated wit,h various biochemical processes. I’roc. mechanisms in E. ~~jli. Annw. Rw. Hiochw. 57. Nat. Acad. Sci., U.S.A. 85, 1364&1368. 199~-23’1. tI Van IhfGjni. (i.. Vand drr Larken. (‘. *J.. \-au (:oltl. l,., l’ribno\v. D.. Schneider. T.. Shinedling. S.. Knipprnberg. 1’. H. & Van I)uin. ,I. (1975).Furlcbtion Singer. K. S. Nr Stormo. G. (1981). Translational of ~schrricl~irr roli ribosomal protfbin S I in translation init,iation in procaryotes. il TLTLII. Ret,. M%crobiol. 35. of nat,ural and synthetic nrrbssengcr KS:2. .1. :Mo!. 365-40‘3.t Hiol. 93. 351 366. (:ualrrzi. (‘. B Pon. (‘. 1,. (1981). Protein biosynthesis in Van I)ieijrll. C:.. Zipori. I’.. \‘an l’rooijrn, \I’. B \‘an I)uin, procar?;otic crlls: mechanism of 30 S initiation ,I. (1978). lnvolorment of ribosomal prot,rin S I in thr complex formation in Escherichifl coli. In NtT2Lf:t,uUTfLI assembly of the initiation (aomplrx. Eur. .I. Hiochrm daprcts of Recognition and Assembly in Biological 90. 571 -5X0. Macromolrcul~s (Ralaban. I,., Sussman. ,I. L.. Tranb.
(‘alogero, R. A., Pon. (‘. L.. Canonaco, M. A. B Gualerzi. (‘. 0. (1988). Selection of the mRh’A translational initiation region by Escherichia coli ribosomrs. I’m.
Ribosome Complexes
Van Duin, qJ.. Overbeek, (:. P. & Rackendorf, C. (1980). Functional recognition of phage RNA by 30-S ribosomal subunits in the absence of initiator tRljA. !T’l/r. J. Biorlwttl. 110. 593-597.
with mRNA
105
\‘an Duin. ,J., Ravensbergen, C”. J. (‘. &, Doornbos. ,J. (1984). Rasepairing of oligonucleotides to the 3’ end of 16 S ribosomal RNA is not stabilized by ribosornal proteins. Swl. Arida RP~s.12. 5079-5086.
Edited by P. rott Flipp~l
