The EMBO Journal vol.9 no.4 pp. 1 267 - 1274, 1990

The IS 10 antisense RNA blocks ribosome binding at the transposase translation initiation site

Charles Mal and Robert W.Simons' 2 'The Molecular Biology Institute and the 2Department of Microbiology, University of California, Los Angeles, CA 90024, USA Communicated by J.H.Miller

Transposase (tnp) expression from insertion sequence ISIO is controlled, in part, by an antisense RNA, RNAOUT, which pairs to the translation initiation region of the tnp mRNA, RNA-IN. Genetic experiments suggest that control occurs post-transcriptionally. Here, we present evidence that bears on the control mechanism. Specific ribosome binding at the tnp translation initiation site is demonstrated in vitro. Two mutations that alter tnp translation in vivo are shown to have corresponding effects in vitro. Most importantly, RNA-OUT/RNA-IN pairing is shown to block ribosome binding. In conjunction with the work described in the accompanying paper, we propose that inhibition of ribosome binding also occurs in vivo, and that it is suffi'cient to account for control. Implications for translational control in analogous systems are discussed. Key words: antisense RNA/ISJO/ribosome toe-print/translation/transposon

Introduction Antisense RNAs control the expression of a number of different genes (Simons, 1988; Simons and Kleckner, 1988). Several of these antisense RNAs are complementary to the probable ribosome binding sites on their target mRNAs, suggesting that inhibition occurs at the level of translation initiation. There is experimental evidence to support this notion in several cases (Simons and Kleckner, 1983; Mizuno et al., 1984; Kim and Meyer, 1986; Liao et al., 1987; Wu et al., 1987; Gerdes et al., 1988). One example of such control has been documented for insertion sequence IS1O, where an antisense RNA inhibits transposase (tnp) expression (Simons and Kleckner, 1983). ISIO expresses two principal transcripts from its outside end (Figure 1): the tnp mRNA, RNA-IN, which is specified by the relatively weak pIN promoter, and the antisense RNA, RNA-OUT, which is specified by the stronger, opposing pOUT promoter. These transcripts and their promoters have been characterized extensively in vivo and in vitro (Simons et al., 1983; Lee and Schmidt, 1985; Case et al., 1988). The 5' ends of RNA-IN and RNA-OUT are complementary for 35 bp, including the proposed ribosome binding site for the tnp gene (Halling et al., 1982). Transposase translation most likely initiates at the AUG codon indicated in Figure 1, which overlaps with a GUG codon. Genetic studies suggest that RNA-OUT blocks translation of the IS1O tnp gene: tnp'-lacZ' translational fusions are inhibited to a much greater extent by RNA-OUT supplied Oxford University Press

in trans than are isogenic pIN -lacZ+ transcriptional fusions (Simons and Kleckner, 1983; Case et al., 1990). RNA-OUT/RNA-IN pairing has been examined in vitro (Kittle et al., 1989) and a number of mutations that affect the expression, stability or function of RNA-OUT or RNAIN have been isolated and characterized in detail (Case et al., 1988, 1989; Kittle et al., 1989). In the accompanying paper (Case et al., 1990) we show the RNA-OUT/RNA-IN paired species is cleaved at specific sites in vivo by ribonuclease III (RNasellI), leading to further destabilization in RNAIN. However such destabilization is not required for antisense control, nor does pairing have any other obvious effects on the synthesis or stability of RNA-IN that could account for control. Here, we present evidence that bears on the mechanism of ISIO antisense RNA control. We demonstrate specific ribosome binding at the tnp translation initiation site, and show that two IS10 mutations which alter tnp translation in vivo have corresponding effects on ribosome binding in vitro. Most importanfly, we show that RNA-OUT/RNA-IN pairing prevents ribosome binding, and propose that this effect is sufficient to account for IS10 antisense control in vivo. We discuss these observations as they relate to other antisense RNA systems and to the general effects of RNA secondary structure on translation initiation.

Results Translation initiation complexes form on the transposase mRNA We used a gel-mobility assay to identify 30S ternary and 70S pre-initiation complexes formed on the first 265 nucleotides of RNA-IN (Figure 2). When RNA-IN is incubated with appropriate translation initiation components, its mobility in a composite agarose/polyacrylamide gel is shifted: incubation with 30S subunits and tRNA et shifts RNA-IN to a position close to that of purified 16S ribosomal RNA (Figure 2, lane 5; marker not shown); incubation with fMet-tRNAf et, all three translation initiation factors (IF1, IF2 and IF3), and both the 30S and 50S ribosomal subunits shifts RNA-IN to a position just ahead of purified 23S ribosomal RNA (lane 6; marker not shown). These positions approximate those expected for a short transcript bound by, respectively, a single 30S subunit or a 70S ribosome (Dahlberg et al., 1969). Formation of 30S complexes requires both tRNAfmet and the 30S ribosomal subunit but none of the translation initiation factors (Figure 2, lanes 2, 4 and 5, and data not shown). Such 'factorless' 30S complex formation has been documented (Van Duin et al., 1980). 70S complex formation requires both the 30S and 50S ribosomal subunits and, to a lesser extent, fMet-tRNAf et and the three translation initiation factors (Figure 2, lanes 6-9 and data not shown), consistent with other observations (Hartz et al., 1989). Both 30S and 70S complex for-

1267

C.Ma and R.W.Simons

PIN

DdeI

TaqI (291)

(-6)

AccI

(340)

I -

-

_

_

-

_

-

POUT Ml C

RNA-IN

97G G

CJ109 AUG C +7

AUG +15

5' - GCGAAAAAUCAAUAAUCAGACAACAAGAUGUGCGAACUCGAUAUUUUACACGACUCUCU - [AGGAGGI 44 444 III 1II IIII Toe-Print

OUT-Pri nt A 1

I It ,

- - UAGUUUACCAAAGCGCUUUUUAGUUAUUAGUCUGUUGUUCUACACGCU(U) - 5'

RNA-OUT

Fig. 1. The outer end of insertion sequence IS1O. The outer -350 bp of IS1O-Right (as present in the wild type hisG9424::TnlO insertion; Foster et al., 1981) are depicted. pIN initiates RNA-IN transcription at bp 81 of ISJO (outside end = 1); pOUT initiates RNA-OUT transcription in the opposite direction at bp 115, with a minor start at 116 (Case et al., 1988). The tnp gene begins with an AUG at bp 108. A partial restriction map is also shown. The expanded portion shows the first -50 nucleotides of RNA-IN and RNA-OUT and other important features. Three mutations (Ml, 97G and CJ109) are indicated as changes in the RNA-IN sequence. The AUG start codon (which overlaps with a GUG codon) is underlined; it is preceded by a Shine and Dalgarno like sequence (the consensus sequence is bracketed). The clustered arrows indicate the toe-print and OUT-print signals (see text); filled arrowheads indicate strong signals. In the text, these signals are numbered relative to the AUG codon, where U = 1. The AUG+7 and + 15 positions are indicated.

trans 1 at ion

:30S 50S

n t i at i on

tRNA

components

lts

t

t

4

+

-+

+

-

+

t+

+

-

I~~~~~~~~~~~~~~~~~~~~ +

4

-

+

It

h

/

F

RNA IN t /OS RNA-IN + 30S RNA IN

I

?

3

4

8

9

Fig. 2. 30S ternary and 70S pre-initiation complexes on RNA-IN. Labeled RNA-IN was synthesized in vitro, incubated in the presence (+) or absence (-) of various translation initiation components, electrophoresed on a 2.5% polyacrylamide/0.5% agarose composite gel, and visualized by autoradiography (see Materials and methods). 30S and 70S refer to the respective ribosomal subunits; tRNA refers to tRNA et in lanes 1-5 and fMet-tRNA et in lanes 6-9; IFs refer to the three translation initiation factors (IFI, 2 and 3); RNA-IN+30S and RNA-IN+70S refer, respectively, to the 30S ternary and 70S preinitiation complexes on RNA-IN.

mation is inhibited by aurintricarboxylic acid (not shown), a drug known to prevent 30S subunit binding in vitro (Tai

et al., 1973). Together, these results show that bona fide ternary (30S) and pre-initiation (70S) complexes form on the tnp mRNA under appropriate conditions, and that there

1268

is probably only a single ribosome binding site present in the first 265 nt of this message. 30S ribosomal subunits bind specifically at the tnp ibosome binding site To specifically identify ribosome binding at the tnp translation initiation site, we analyzed the 30S and 70S complexes described above in the primer extension inhibition assay developed by Gold and colleagues (Hartz et al., 1988; McPheeters et al., 1988; Winter et al., 1987; Gold, 1988). They have shown that 30S subunits bound at the translation initiation sites of a variety of mRNAs inhibit reverse transcription, producing a characteristic product corresponding to a position 15 nucleotides downstream of the start codon (where the U of AUG = 1; we term this signal AUG + 15). They suggest that this product arises as reverse transcriptase encounters the 3' margin of the 30S subunit and term it the 30S 'toe-print'. Figure 3A shows that under conditions where 30S ternary complexes form on RNA-IN (RNA-IN + 30S subunits + tRNAfIet), primer extension of RNA-IN is inhibited at AUG+ 15 of the tnp gene. Weaker AUG+7, + 16 and + 17 products are also seen. These toe-print signals require 30S subunits and tRNAf et and their intensity increases with increasing tRNAfMet concentration (Figure 3A). Like the 30S complexes detected in the gel-mobility assay, the 30S toe-print signal is inhibited by aurintricarboxylic acid (not shown). Moreover, if 30S complexes are first extracted with

Antisense RNA blocks ribosome binding 70S toe-print

30S toe-print

A

wi

o

U

5S end

G

A

C

0

-=

-

4o,

0

z

z

0

+

4.

CD

CD

.

.....

ri

C CJ109

B 97G

d-type

ri

z

_

m

0

0 m

c

c0

m

I

0

D wi 1 d-type -

t

4. +

U

c0

0

0

ri

rm

_I

..

..

_

-

-

5' end

SD[ AUG

F - AUG+7

AUG+7

AUG+t15

-.

S .4

*

- AUJG+ 15 -+17

.e q 04

Fig. 3. Specific ribosome binding to the tnp translation initiation site. RNA-IN transcripts were synthesized in vitro, pre-annealed to an end-labeled oligonucleotide primer and incubated with various translation initiation components. The primer was then extended with reverse transcriptase and the products resolved by electrophoresis (see Materials and methods). (A) Wild-type RNA-IN incubated alone ('none') or with 30S subunits (30S), 5 mM tRNAf et (tRNA [5]) or 30S subunits+tRNAlMet (0.5 or 5 mM). (B) and (C) RNA-IN transcripts bearing the 97G or CJ109 mutations, incubated with factors as indicated. (D) Wild type RNA-IN incubated with the complete 70S ensemble [30S + 50S +fMet-tRNAfIel (5 mM) + IF1, 2 and 3], or with one of those components (30S, 50S or fMet-tRNAfMet) excluded, as indicated. The 5' end of RNA-IN, the Shine and Dalgamo (SD), AUG start codon and AUG+7, +15 and +17 toe-print signals are indicated. The sequence shown is that of an SP6-generated transcript spanning the 5' terminus of RNA-IN.

phenol and then primer extended, the toe-print signal is not detected, showing that it does not result from RNA-IN cleavage (not shown). Analogous results were obtained in a separate toe-print analysis of the lacZ mRNA (C.Ma and R.W.Simons, unpublished observations). Mutations affecting transposase translation also affect the 30S toe-print

The authenticity of the tnp 30S toe-print was further substantiated by an analysis of RNA-IN transcripts containing either of two point mutations, 97G or CJ109, which alter tnp translation in vivo. The 97G mutation changes a nonconsensus base in the tnp Shine and Dalgarno sequence to a consensus base (Figure 1) and increases tnp translation 7-fold in vivo (C.Jain and N.Kleckner, unpublished data). In vitro, 97G increases the intensity of the AUG+ 15 toeprint signal 3- to 5-fold but has little or no effect on the +7, +16 or +17 signals, and shows less response to changes in tRNA concentration (Figure 3B). The CJ109 mutation changes the tnp start codon from AUG to ACG (Figure 1) and decreases tnp translation -30-fold in vivo (Case et al., 1990). In vitro, CJ109 decreases the intensity of the AUG+ 15 toe-print signal -10-fold, leaving the + 17 signal unchanged or enhanced slightly (Figure 3C and C.Ma, unpublished data). The AUG+ 17 signal may represent 30S binding at the overlapping GUG codon (Figure 1), analogous to the observation by Hartz et al. (1988) that 30S subunits will decode the second codon of an open reading frame if supplied with the corresponding tRNA. -

-

The 70S toe-prnt When 70S complexes were examined in the toe-print assay (Figure 3D), the AUG+ 15 signal is observed, and its intensity is comparable to that observed with the 30S toeprint. However, there is significant enhancement at AUG +7 and slight enhancement at +6, + 16 and + 17. Because very little 30S complex is observed in these preparations (see Figure 2, lane 6), we believe that these primer extension signals represent the bona fide 70S toe-print, even though they are not readily distinguished from those of the 30S toe-print. Figure 3D also shows that whereas none of the toe-print signals are detected in the absence of 30S subunits or fMettRNAf et, exclusion of 50S subunits has only minor effects. In particular, enhancement of AUG+ 16 and +17 diminishes, while enhancement as AUG+6 and +7 persists. The AUG +6 and +7 enhancement probably does not result from factor dependent 30S binding at the site upstream of the tnp start codon; the C1109 mutation abolishes all toeprint signals, including AUG+6 and +7 (not shown). Rather, these effects probably reflect slightly different binding of the 30S ternary complex at the tnp start codon.

RNA-OUT/RNA-IN pairing is also detected by primer extension RNA-OUT/RNA-IN pairing was previously characterized with an in vitro assay in which unpurified transcripts were used and the paired and unpaired species distinguished by mobility in a non-denaturing polyacrylamide gel (Kittle

1269

C.Ma and R.W.Simons

GEL.

A

RNA

MOBILITY ._w

N

iTNA (IlT

m

ji.i

[lme rTi I"-ii i, 1-)

WNA-

RNA f(U

I

B

PRIMER

rr

--

,

Ii, s(

:.

EXTENSION

_

S,:s

IN pairing (Figure 4B). When RNA-IN is primer extended, a set of characteristic bands is observed with the RNAOUT/RNA-IN paired species (Figure 4, lanes 3-5) that are not seen with RNA-IN alone (lanes 1 and 6). These signals, termed the 'OUT-print', reflect RNA-OUT/RNA-IN pairing: they arise with approximately the same kinetics as pairing occurs in the gel mobility pairing assay (cf. A and B in Figure 4); their appearance is inhibited by the Ml mutation (Figure 4B, lane 8); their positions (+25 to +36 relative to the 5' end of RNA-IN; see Figure 1) correspond closely to the S'-end of an RNA-OUT transcript paired to RNAIN; and RNA-OUT+4, which contains four additional complementary nucleotides at its 5' end, extends the OUTprint accordingly (Figure 4B, lane 10). When essentially all of the RNA-IN transcripts are paired to RNA-OUT (as assessed by the gel mobility pairing assay), not all primer extension is inhibited. Nevertheless, the OUT-print signals are always directly proportional to the actual amount of pairing. More importantly, the OUT-print is distinct from the toe-print, and the ability to detect both RNA-OUT/RNAIN pairing and ribosome binding in the same assay proves particularly useful, as seen below.

OUT

P,r;n !,

rc

p

Fig. 4. RNA-OUT/RNA-IN pairing in vitro. (A) Various RNA-IN and RNA-OUT transcripts synthesized in vitro were incubated in various combinations for the times indicated (min) and then resolved on a nondenaturing 8% polyacrylamide gel (see Materials and methods). Transcripts were wild type (wt) or contained the Ml mutation (Ml); RO+4 refers to the specifically engineered SP6 generated RNA-OUT transcript containing four additional IS1O nucleotides at its 5' end (RNA-OUT+4; see Materials and methods). Pairing occurred with an apparent second order rate constant of 4.2 x 105 M-ls- and is calculated as described (Kittle, 1988; Kittle et al., 1989). RNAOUT+4 and the RNA-OUT+4/RNA-IN paired species run slightly faster than might be expected. This is due to secondary structure in RNA-OUT+4 and the relative contributions of single and double stranded RNA in the paired species (not shown and Kittle, 1988). (B) RNA-IN transcripts were pre-annealed to an end labeled primer and incubated with or without RNA-OUT as indicated (the lane numbers correspond to those in part A). The primer was then extended with reverse transcriptase and the products resolved by gel electrophoresis. The annealed oligonucleotide does not affect pairing in the gel-mobility pairing assay. The 5' end of RNA-IN and the OUT-prints are indicated (see text) duplex, the RNA-OUT/RNA-IN paired species.

et al., 1989). Pairing between the gel purified transcripts used in the experiments described here was assayed in the same way and gave similar results (Figure 4A): the RNAOUT/RNA-IN duplex forms with an apparent second order rate constant of 4.2 x 105 M-ls-1 and is comprised of equal parts of RNA-OUT and RNA-IN. Mutations that prevent efficient pairing between unpurified transcripts also prevent pairing between purified transcripts. Figure 4A shows the effect of one such mutation, MI (Kittle et al., 1989), which alters the specificity of pairing such that heterologous transcripts (lane 8) pair much less efficiently than homologous transcripts (lanes S and 9). Lane 10 in Figure 4A shows that an artificially engineered RNA-OUT transcript containing four additional ISlO nucleotides at its 5' end (RNA-OUT+4) pairs normally to RNA-IN. We also used primer extension to assay RNA-OUT/RNA-

1270

RNA-OUT inhibits 30S and 70S toe-printing The effects of RNA-OUT/RNA-IN pairing on ribosome binding at the tnp translation initiation site were examined with the toe-print/OUT-print assay. As expected, the OUTprint signal increases in proportion to the extent of pairing (Figure 5A). On the other hand, the 30S toe-print signal decreases as the extent of RNA-OUT/RNA-IN pairing increases (Figure SB). This inverse relationship between the OUT-print and 30S toe-print signals is quantitated in Figure SD. Analogous results were obtained when paired and unpaired RNA-IN transcripts were incubated with 70S complex components (Figure SC); RNA-OUT inhibits the 70S toe-print signal, including the strongly enhanced, factordependent signal at AUG + 7. These results show that RNAOUT prevents ribosome binding at the tnp translation initiation site in such a way that the toe-print signal is not generated. Pairing is required for inhibition of toe-print Inhibition of the toe-print depends upon RNA-OUT/RNAIN pairing, per se, and not merely upon the presence of RNA-OUT, as shown by an analysis of the effects of the Ml pairing specificity mutation (Figure 6). Wild type and MI RNA-IN transcripts generate comparable 30S toe-prints (Figure 6, lanes 1 and 4). When wild type or Ml RNA-OUT transcripts are paired to their homologous RNA-IN transcripts (Figure 6, lanes 2 and 6), the OUT-print is generated and the 30S toe-print inhibited. However, when heterologous combinations of these same transcripts (Figure 6, lanes 3 and 5) are examined under identical conditions, efficient RNA-OUT/RNA-IN pairing (OUTprinting) does not occur and the toe-print signal is not inhibited. The extent to which heterologous transcripts eventually pair (after extended incubation) is reflected by inhibition of the toe-print signal (not shown). Altogether similar effects were seen with the 70S toe-print (not shown). These results show that 30S and 70S toe-printing will occur in the presence of high levels of active RNA-OUT transcripts so long as thiose transcripts are not bound to RNA-IN, ruling out non-specific effects of RNA-OUT and establishing that

Antisense RNA blocks ribosome binding

B

C

RNA IN

RNA I N

+

+

30S

iS

A RNA I N

% pai red to RNA-OU

S ena

I0

39

13

|

72 _

M_

0

L-I~ 80 39 13

721

_ MD M

4

|

r end

D :

i,

:

rI

MI1-- wt Ml p -

NW

OUTr

/s0 Toe Pt

Toe F Print L 1

39 .1'?

I..)

ml

wt

wt

Pri nt

Pr,

(I

-

MI Ml

wt

--5 end

I

I

wt

RNA-OUT:

OUT Pri nt _ --- AUG+/

Print L

3Bs Prcr

| °

..

OUTr

Pr inTt

RNA-IN:

I -1

Fig. 5. Effect of RNA-OUT on the 30S and 70S toe-prints. Constant amounts of RNA-IN (pre-annealed to the downstream primer) were paired with various limiting amounts of RNA-OUT (% pairing was determined in the gel-mobility pairing assay). These preparations were incubated for 15 min with and without various translation initiation components. The primer was then extended with reverse transcriptase and the products resolved by gel electrophoresis. (A) Incubation without translation initiation components. (B) Incubation with 30S subunits + tRNAYMe,. (C) Incubation of paired and unpaired RNA-IN with the complete 70S ensemble (30S + 50S + fMet-tRNAfet + IF1, 2 and 3). The 5' end of RNA-IN is indicated, along with the OUT-print, 30S and 70S toe-prints and the AUG +7 signal. (D) Bands in part B were quantitated as follows: '% paired' is the per cent of RNA-IN bound by RNA-OUT, as above; '% OUT-print' is the intensity of the OUT-print bands as a per cent of the sum of the intensities of all bands in a given lane (estimated by a densitometry); '% 30S Toe-print' is a similar quantitation for the 30S toe-print bands.

RNA-OUT/RNA-IN pairing, per se, is required for inhibition of the toe-print.

3

2

5

4

6

Fig. 6. Inhibition of the toe-print requires RNA-OUT/RNA-IN pairing. Wild type (wt) or mutant (Ml) RNA-IN transcripts (pre-annealed to the downstream primer) were combined with wild type or mutant RNA-OUT transcripts, as indicated, allowed to pair for 60 min and incubated with 30S subunits + tRNA et for 15 min. The primer was then extended with reverse transcriptase and the products resolved by gel electrophoresis. The 5' end of RNA-IN and the OUT-print and Toe-print signals are indicated.

A

B

RNA-IN

RNA-IN + RNA-OUT

-:

C

C c2 h). Third, the 35 bp remnant presumably contains the entire tnp ribosome binding site, yet it is probably not invaded by ribosomes; such invasion would be expected to separate the RNA strands, thereby rendering one or both unstable -

-

Implications for other translational control systems In addition to IS1O, there are several other documented cases where antisense RNAs are complementary to the probable ribosome binding sites of their target mRNA (Simons, 1988; Simons and Kleckner, 1988), and for some of those genes control has also been shown to occur at a post-translational level. We believe it likely that in these and similar cases antisense control is largely, if not solely, due to inhibition of ribosome binding. Any pairing dependent destabilization of the target mRNA will probably be secondary, as in the IS1O case. However, pairing alone may not be sufficient for control when an antisense RNA is complementary to an internal region of its target mRNA; translation elongation, per se, is probably relatively insensitive to RNA secondary structure (Nomura et al., 1984). In such instances, destabilization may be essential, as suggested for the bacteriophage X oopRNAIcII mRNA case (Krinke and Wulff, 1987). It has long been argued that sequestration of ribosome binding sites within regions of RNA secondary structure inhibits translation initiation (Stormo, 1986; Gold and Stormo, 1987; Gold, 1988). While there is considerable genetic and some biochemical evidence for this view (Lodish, 1971; Borisova et al., 1979; Merril et al., 1981; Hall et al., 1982; Kroger and Hobom, 1982; McDonald et al., 1984; Munson et al., 1984; Davis et al., 1985; Timmerman and Tu, 1985), direct correlation between established RNA secondary structure and specific ribosome binding has not been demonstrated. The RNA-OUT/RNA-IN paired species is known to be fully base paired in vitro (Kittle, 1988; Kittle et al., 1989) and probably in vivo as well (Case et al., 1990). We believe that sequestration of the tnp ribosome binding site within the RNA-OUT/RNA-IN duplex is mechanistically identical to sequestration within RNA secondary structure. Therefore, the results described here establish a direct correlation between RNA secondary structure and inhibition of ribosome binding. In the design of efficient artificial antisense RNA control of gene expression, it may be sufficient to engineer the antisense RNA so that it is complementary to the translation initiation site of the target gene, thereby avoiding the need to design specific sites for cleavage by a double stranded RNA endonuclease. Other considerations for the design of efficient artificial antisense control have been discussed elsewhere (Simons, 1988; Simons and Kleckner, 1988; Case et al., 1989; Kittle et al., 1989; Case et al., 1990). 1272

The transposase translation initiation site The tnp ribosome binding site was characterized by a combination of gel-mobility and toe-print binding assays with wild type and mutant RNA-IN transcripts. Only a single 30S or 70S complex appears to form on the first 265 nt of RNAIN. Binding occurs at the initiation site for the tnp gene, primarily at the AUG start codon. Some initiation may also occur at the overlapping GUG codon. Two mutations that alter tnp translation in vivo (Case et al., 1990; C.Jain and N.Kleckner, unpublished data) have corresponding effects in vitro. The CJ109 mutation changes the AUG start codon to ACG and essentially abolishes the 30S toe-print at that position. This effect would be expected if the intensity of the toe-print signal is a reflection of the stability of the 30S ternary complex. According to the model for translation initiation proposed by Gualerzi and coworkers (Gualerzi et al., 1988), the 30S subunit and tRNAmet bind to the ribosome binding site in second order reactions, followed by at least one rate limiting first order isomerization in which the tRNAmt binds specifically to the start codon, resulting in the stable 30S ternary complex. Any weakening of the tRNAmet/start codon interaction would be expected to destabilize the ternary complex. Interestingly, C.109 appears to enhance (slightly) binding at the overlapping GUG codon (Figure 3 and C.Ma, unpublished observations), suggesting that the AUG and GUG codons interfere with one another to some extent. Such an effect might contribute to the low level of tnp translation normally observed (< 10% of the lacZ gene; Raleigh and Kleckner, 1986; R.W.Simons, unpublished data). Interference between overlapping start codons has been demonstrated for the bacteriophage X cH gene (Wulff et al., 1984) and proposed for the Escherichia coli lacI gene (Farabaugh, 1978; Stormo, 1986). We have genetic evidence that the short GUG open reading frame (33 codons) in IS1O is weakly translated in vivo, and that this expression is influenced by translation initiation factor 3 (J.Sussman and R.W.Simons, unpublished

data).

The other mutation analyzed, 97G, changes a nonconsensus base in the tnp Shine and Dalgarno sequence to a consensus base and increases the intensity of the 30S toe-

print signal in vitro. This effect can also be reconciled with the Gualerzi model if one assumes that the Shine and Dalgarno sequence functions to stabilize 30S/mRNA interactions until the rate limiting first order isomerization to the more stable ternary complex occurs. Consistent with this view is the observation that increased tRNA et concentration in the toe-print binding reaction has a greater effect with wild type RNA-IN than with 97G RNA-IN (Figure 3 and C.Ma, unpublished). Details of the toe-prnt assay The toe-print assay is thought to reflect the specificity and efficiency of 30S ternary complex formation, even in the absence of translation initiation factors (Gold, 1988; Hartz et al., 1988, 1989). The 'factorless' 30S toe-print for the tnp gene is essentially identical to that reported for several other genes (Winter et al., 1987; Hartz et al., 1988, 1989; McPheeters et al., 1988): a primary signal at AUG+ 15, along with several minor signals (AUG+6, +7, +16 and + 17, in the RNA-IN case). However, when we include all three translation initiation factors in the 30S toe-print

Antisense RNA blocks ribosome binding

reaction, significant enhancement at AUG +6 and +7 is observed. This effect is not due to factor dependent initiation at an upstream site: no obvious Shine and Dalgarno sequence or initiation codon is found at the appropriate position, and the CIJ09 mutation, which abolishes the AUG+ 15 signal, also abolishes the AUG+6 and +7 signals and their enhancement. Rather, enhancement probably reflects some conformational change in the 30S complex that results in altered binding to RNA-IN. Hartz et al. (1989) observe similar factor dependent enhancement of toe-print signals. We observe no difference in the 30S and 70S toe-prints on RNA-IN, other than the enhancement of certain bands (see above). Hartz et al. (1989) also find similarities between the 30S and 70S toe-prints. Finally, reverse transcription is inhibited by RNA-OUT transcripts bound to RNA-IN (the 'OUT-print'). Interestingly, primer extension does not detect binding of the bacteriophage T4 regA translational repressor protein to the operator on its own mRNA (Winter et al., 1987). It may be that inhibition of reverse transcription occurs efficiently only with RNA/RNA pairing is involved, as in the cases of the 30S toe-print, the IS10 OUT-print and, probably, RNA secondary structure.

Materials and methods Media, enzymes and chemicals Media, growth conditions and transformation procedures were as described (Simons et al., 1987). Escherichia coli RNA polymerase and uncharged tRNAf et were purchased from Boehringer Mannheim. Charged fMet was prepared as described (Kaempfer and Jay, 1979). fMet-tRNAf Avian reverse transcriptase was purchased from Promega. T4 polynucleotide kinase, restriction endonucleases and other DNA modifying enzymes were purchased from New England Biolabs. Oligonucleotides were obtained from New England Biolabs or the UCLA DNA Synthesis Facility. [a-32P]CTP and [-y-3 P]ATP were purchased from Amersham and ICN respectively. Kodak XAR-5 film was used for all autoradiography. Purified 30S and 50S ribosomal subunits and translation initiation factors 1, 2 and 3 were generous gifts from Drs R.R.Traut and J.Hershey, at the University of California, Davis. Other chemicals were obtained from IBI, Sigma or Calbiochem. Bacterial strains and plasmids Escherichia coli strains were as follows: MM294 has been described (Backman et al., 1976) and was used to prepare most plasmid DNA. DR458 is AlacX74 galOP308 rpsL A(tonB-trpA)905 trpR dam3, and was constructed by D.Roberts. Plasmids were as follows: pRS999 is pGEM-3Z (obtained from Promega) with a - 300 bp A12 -AccI ISIO fragment inserted into the polylinker such that the SP6 promoter (of pGEM-3Z) transcribes IS1O in the same direction as pIN. pCJ289 is a multicopy ISIO plasmid containing the CJ109, mci30 and HH104 mutations, and was kindly provided by C.Jain. pRS1334 is, essentially, pUC18 (Yanisch-Perron et al., 1985) with a -515 bp Bglll (-225)-TaqI (+291) ISIO fragment cloned into the polylinker; pRS1335 is an isogenic plasmid containing the 97G mutation. pRS1467 is pCKSP6 (Kang and Wu, 1987) with a - 340 BgBll (-225)-TaqI (+ 118) ISIO fragment inserted such that the SP6 promoter (of pCKSP6) directs the synthesis of an RNA-OUT transcript with four additional ISJO nucleotides at its 5' end (RNA-OUT+4). This fusion was accomplished by ligating the TaqI site in ISJO (+ 118) with the BamHI site in pCKSP6, after removing their respective 5' overhanging ends. Other plasmids were derived from pNK214 (Way and Kleckner, 1984; Case et al., 1989) and can be most easily described as such: pRS945 is pNK214 HH104, mci3 and deiC; pRS286 is pNK214 G8, delAC, AIOE; pRS971 is pNK214 Ml, delRB; pRS1336 is pNK214 Ml, delC. The CJli9, mci3O, mci3, HH104, G8 and Ml point mutations AJ2, AlOE, deiC, delAC and delRB deletion mutations have been described (Simons and Kleckner, 1983; Case et al., 1988, 1989). The 97G mutation was introduced into ISIO by oligonucleotide mutagenesis, and will be described elsewhere (C.Jain and N.Kleckner, in preparation). All DNA manipulations were essentially as described (Maniatis et al., 1982).

Transcript synthesis and purification In vitro transcription with E.coli RNA polymerase was as follows. Our standard transcription reaction (50 11 final volume) contained 40 mM Trisacetate buffer (pH 8.0), 1 mM dithiothreitol, 0.1 mM EDTA, 120 mM potassium acetate, 10 mM magnesium acetate, 0.4 mM potassium phosphate, 4 mM spermidine, 5 % glycerol, 0.1 mg/ml BSA, - 15 nM template DNA, GTP, ATP, UTP and CTP at 160 1M each ([as-32P]CTP at 2.5 Ci/mmol), and 0.04 U/Id E coli RNA polymerase. Transcription was allowed to proceed for 2 h at 37°C and then terminated with 200 14 of stop buffer (10 mM Tris-HCI pH 8.0, 0.1 mM EDTA). Transcripts were then phenol/ chloroform extracted, ethanol precipitated, electrophoresed in an 8% polyacrylamide, 8 M urea gel, eluted by soaking the crushed gel slice in 100 mM Tris-HC1 pH 8.0, 0.2% SDS, 0.2 mM EDTA, extracted twice with phenol/chloroform and once with chloroform, ethanol precipitated, and desalted in a Sephadex G25 mini-column equilibrated with stop buffer. Transcript concentrations were estimated by liquid scintillation. Where possible, all procedures involved DEPC treated and autoclaved reagents. DNA template (purified by electroelution) were as follow: 265 nucleotide wild type, Ml and CJi09 RNA-IN transcripts were expressed from - 350 bp DdeI-AccI DNA fragments obtained from pRS945, pRS1336 and pCJ289 respectively (the mci3 mutation present in transcripts expressed from the pRS945 fragment does not affect ribosome binding or RNA-OUT/RNAIN pairing; C.Ma, unpublished data); 210 nucleotide wild type and 97G RNA-IN transcripts were expressed from -295 bp DdeI- TaqI fragments obtained from pRS1334 and pRS1335 respectively; 120 nucleotide wild type and MI RNA-OUT transcripts were expressed from -350 bp DdeI-AccI fragments obtained from pRS286 and pRS971 respectively. In some cases DNA fragments were obtained from plasmids grown in the DNA-adenine methylation deficient strain DR458, to increase expression from the pIN promoter (Roberts et al., 1985; Case et al., 1988). In vitro transcription with SP6 RNA polymerase was according to the supplier (Promega). The 124 nucleotide RNA-OUT+4 transcript was expressed from pRS1467 cut at the DdeI site in ISJO and then gel-purified as described above. The - 320 nucleotide RNA-IN like transcript (spanning bp 44 to 343 of IS10) was expressed from pRS999 cut just after pGEM -3Z/A12 junction.

Toe-print assays for ribosome binding The reverse transcriptase primer extension inhibition assay for 30S subunit binding (30S toe-print assay) was carried out essentially as described by Hartz et al., (1988), with the following modifications. Our standard binding reaction (15 min in a 10 1.1 final volume) contained 20 mM Tris-acetate buffer (pH 7.4), 75 mM ammonium chloride, 15 mM magnesium acetate, 0.5 mM spermidine, 7 mM 13-mercaptoethanol, 0.4 AM 30S ribosomal subunit, and 0.2 nM RNA-IN. Hartz et al. (1988) and Winter et al., (1987) used tRNA et at 1-5 AM; thus, we examined tRNAf et at both 0.5 or 5 jiM in many of our experiments. RNA-IN was pre-annealed to an end labeled, complementary, downstream oligonucleotide primer (corresponding to bp 191-207 of ISJO) as described by Hartz et al. (1988). 30S subunits were pre-incubated for 20 min at 40°C, in 20 mM Tris-acetate (pH 7.2), 200 mM ammonium chloride, 20 mM magnesium acetate, 14 mM (3mercaptoethanol just before use. Binding was allowed to proceed for 15 min at 37°C, at which time the primer was extended with reverse transcriptase as described by Hartz et al. (1988). We pre-incubated reverse transcriptase (0.5 U/141) for 15 min on ice in 10 mM potassium phosphate (pH 8.0), 2 mM dithiothreitol, 10% glycerol, 0.02% Triton X-l00 just before use. The primer extension reaction was stopped with 40 1l 0.3 M sodium acetate, 0.2% SDS, 1 mM EDTA, 0.1 mg/ml total E. coli tRNA (carrier). Samples were then precipitated with ethanol, resuspended in 10 1i1 50% formamide, 8 M urea, 90 mM Trisborate (pH 8.3), 2 mM EDTA, heated at 65°C for 5 min, and 3 A1 electrophoresed on a 6 % polyacrylamide, 8 M urea sequencing gel, which was then dried and autoradiographed. Autoradiographs were scanned with a BioRad Model 620 Vidiodensitometer. RNA sequence was determined as described (Case et al., 1988). The 70S toe-print assay was performed in the same way except that the binding reaction included 50S ribosomal subunits, IFI, IF2 and IF3, each at 0.4 jiM, 1 mM GTP, and fMettRNA et instead of tRNA et, In vitro RNA-OUT/RNA-IN pairing assays The gel-mobility pairing assay was perforned as follows. Purified transcripts were combined in 15 1I 10 mM Tris-acetate (pH 7.4), 75 mM ammonium chloride, 15 mM magnesium acetate and incubated at 37°C. At appropriate time intervals, 3 u1 aliquots were removed, diluted 10-fold with 10 mM Tris-HCI (pH 8.0), 1 mM EDTA, and held on ice until electrophoresed in an 8 % polyacrylamide gel, which was then dried and autoradiographed.

1273

C.Ma and R.W.Simons RNA-OUT/RNA-IN pairing was also assayed by reverse transcriptase primer extension inhibition (the OUT-print assay; see text), essentially as described

above.

Gel-mobility assay for translation initiation complex formation Samples were prepared as described in the toe-print assay, omitting the annealing and reverse transcriptase extension reactions. After mixing with an equal volume of 0.5 % melted agarose (in gel running buffer), these samples were loaded onto a 0.5% agarose + 2.25% polyacrylamide composite gel prepared in 25 mM Tris-HCI pH 8.0, 60 mM potassium acetate and 10 mM magnesium chloride (Dahlberg et al., 1969; Vary and Vournakis, 1985), and electrophoresed with the same buffer at 4°C and 80 V for 3 h. The gel was then dried and autoradiographed. Some gels included 16S and 23S E.coli rRNAs (Case et al., 1988) as size standards, which were visualized by staining with ethidium bromide.

Acknowledgements We gratefully acknowledge the participation of all members of this laboratory in discussions of the ideas presented here. We especially thank Chaitanya Jain and Nancy Kleckner for strains and the communication of unpublished data, Rob Trout for generously providing the purified 30S and 50S ribosomal subunits, and John Hershey for his generous gift of the purified translation initiation factors. R.W.S. was supported by a Junior Faculty Research Award (JFRA-130) from the American Cancer Society and C.M. was supported by a Predoctoral National Research Service Award. This research was supported by a grant from the National Institutes of Health to R.W.S.

(GM35322).

References Backman,K., Ptashne,M. and Gilbert,W. (1976) Proc. Natl. Acad. Sci. USA, 73, 4174-4178. Borisova,G.P., Volkova,T.M., Berzin,V., Rosenthal,G. and Gren,E.J. (1979) Nucleic Acids Res., 6, 1761-1774. Case,C.C., Roels,S.M., Simons,E.L. and Simons,R.W. (1988) Gene, 72, 219-236.

Case,C.C., Roels,S.R., Jensen,P., Lee,J., Kleckner,N. and Simons,R.W. (1989) EMBO J., 8, 4297-4305. Case,C.C., Simons,E.L. and Simons,R.W. (1990) EMBO J., 9, 1259-1266.

Dahlberg,A.E., Dingman,C.W.

and Peacock,A.C. (1969) J. Mol. Biol., 41, 139-147. Davis,M.A., Simons,R.W. and Kleckner,N. (1985) Cell, 43, 379-387. Farabaugh,P.J. (1978) Nature, 274, 765 -769. Foster,T., Davis,M.A., Takeshita,K., Roberts,D.E. and Kleckner,N. (1981) Cell, 23, 215-227. Gerdes,K., Helin,K., Christensen,O.W. and Lobner-Olesen,A. (1988) J. Mol. Biol., 203, 119-129. Gold,L. (1988) Annu. Rev. Biochem., 57, 199-233. Gold,L. and Stormo,J. (1987) In Neidhardt,F.C., Ingraham,J.L., Low,K.B., Magasanik,B., Schaechter,M. and Umbarger,E. (eds), E. coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society of Microbiology, Washington, pp. 1302-1307. Gualerzi,C.O., Calogero,R.A., Canonaco,M.A., Brombach,M. and Pon,C.L. (1988) In Tuite,M.F., Picard,M. and Bolotin-Fukuhara,M. (eds), Genetics of Translation. Springer-Verlag, Berlin, pp. 317-342. Hall,M.N., Gabay,J., Debarbouille,M. and Schwartz,M. (1982) Nature, 295, 616-618. Halling,S.M., Simons,R.W., Walsh,R.B. and Kleckner,N. (1982) Proc. Natl. Acad. Sci. USA, 79, 2608-2612. Hartz,D., McPheeters,D.S., Traut,R. and Gold,L. (1988) Methods Enzymol., 164, 419 -425. Hartz,D., McPheeters,D.S. and Gold,L. (1989) Genes Dev., 3, 1899-1912. Kaempfer,R. and Jay,G. (1979) Methods Enzymol., 60, 332-343. Kang,C. and Wu,C. (1987) Nucleic Acids Res., 15, 2279-2294. Kim,K. and Meyer,R.J. (1986) Nucleic Acids Res., 14, 8027-8046. Kittle,J.D. (1988) PhD Thesis. Harvard University, Cambridge, MA. Kittle,J.D., Simons,R.W. and Kleckner,N. (1989) J. Mol. Biol., 210, 561-572. Krinke,L. and Wulff,D.L. (1987) Genes Dev., 1, 1005-1013. Kroger,M. and Hobom,G. (1982) Nature, 297, 159-162. Lee,Y. and Schmidt,F. (1985) J. Bacteriol., 164, 556-562. Liao,S., Wu,T., Chiang,C.H., Susskind,M.M. and McClure,W.R. (1987) Genes Dev., 1, 197-203. Lodish,H.F. (1971) J. Mol. Biol., 56, 627-632.

1274

Maniatis,T., Fritsch,E.F. and Sambrook,J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. McDonald,P.M., Kutter,E. and Mosig,G. (1984) Genetics, 106, 17-27. McPheeters,D.S., Stormo,J.D. and Gold,L. (1988) J. Mol. Biol., 201, 517-535. Merril,C.R., Gottesman,M.E. and Adhya,S.L. (1981) J. Bacteriol., 147, 875 -887.

Mizuno,T., Chou,M. and Inouye,M. (1984) Proc. Natl. Acad. Sci. USA, 81, 1966-1970. Munson,L.M., Stormo,G.D., Niece,R.L. and Reznikoff,W.S. (1984) J. Mol. Biol., 177, 663 -683. Nomura,M., Gourse,R. and Baughman,G. (1984) Annu. Rev. Biochem., 53, 75-117. Raleigh,E.R. and Kleckner,N. (1986) Proc. Natl. Acad. Sci. USA, 83, 1787-1791.

Roberts,D., Hoopes,B.C., McClure,W.R. and Kleckner,N. (1985) Cell, 43, 117-130. Simons,R.W. (1988) Gene, 72, 35-44. Simons,R.W. and Kleckner,N. (1983) Cell, 34, 683-691. Simons,R.W. and Kleckner,N. (1988) Annu. Rev. Genet., 22, 567-600. Simons,R.W., Hoopes,B.C., McClure,W.R. and Kleckner,N. (1983) Cell, 34, 673-682. Simons,R.W., Houman,F. and Kleckner,N. (1987) Gene, 53, 85-96. Stormo,G.D. (1986) In Reznikoff,W. and Gold,L. (eds), Maximizing Gene Expression. Buttersworth, Boston, pp. 195 -224. Tai,P., Wallace,B.J. and Davis,B.D. (1973) Biochemistry, 12, 616-620. Timmerman,K.P. and Tu,C.-P.D. (1985) Nucleic Acids Res., 13, 2127-2130. Van Duin,J., Overbeek,G.P. and Backendorf,C. (1980) Eur. J. Biochem., 110, 593-597. Vary,C.P.H. and Vournakis,J.N. (1985) Gene Anal. Technol., 2, 50-56. Way,J.C. and Kleckner,N. (1984) Proc. Natl. Acad. Sci. USA, 81, 3452 -3456. Winter,R.B., Morrissey,L., Gauss,P., Gold,L., Hsu,T. and Karam,J. (1987) Proc. Natl. Acad. Sci. USA, 84, 7822-7826. Wu,T., Liao,S., McClure,W.R. and Susskind,M.M. (1987) Genes Dev., 1, 204-212. Wulff,D.L., Mahoney,M., Shatzman,A. and Rosenberg,M. (1984) Proc. Natl. Acad. Sci. USA, 81, 555-559. Yanisch-Perron,C., Viera,J. and Messing,J. (1985) Gene, 33, 103-119. Received on November 27, 1989