Development of a quantitative PCR assay for monitoring Streptococcus agalactiae colonization and tissue tropism in experimentally infected tilapia.

doi:10.1111/jfd.12358

Journal of Fish Diseases 2016, 39, 229–238

Development of a quantitative PCR assay for monitoring Streptococcus agalactiae colonization and tissue tropism in experimentally infected tilapia Y-L Su1,2, J Feng2, Y-W Li1, J-S Bai3 and A-X Li1 1 Key Laboratory for Aquatic Products Safety of Ministry of Education/State Key Laboratory of Biocontrol, The School of Life Sciences, Sun Yat-sen University, Haizhu District, Guangzhou, Guangdong Province, China 2 Key Laboratory of South China Sea Fishery Resources Exploitation & Utilization, Ministry of Agriculture, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou, Guangdong Province, China 3 Guangzhou Airport Extry-Exit Inspection and Quarantine Bureau, Guangzhou, Guangdong Province, China

Abstract

Streptococcus agalactiae has become one of the most important emerging pathogens in the aquaculture industry and has resulted in large economic losses for tilapia farms in China. In this study, three pairs of specific primers were designed and tested for their specificities and sensitivities in quantitative real-time polymerase chain reactions (qPCRs) after optimization of the annealing temperature. The primer pair IGS-s/IGS-a, which targets the 16S-23S rRNA intergenic spacer region, was finally chosen, having a detection limit of 8.6 copies of S. agalactiae DNA in a 20 lL reaction mixture. Bacterial tissue tropism was demonstrated by qPCR in Oreochromis niloticus 5 days postinjection with a virulent S. agalactiae strain. Bacterial loads were detected at the highest level in brain, followed by moderately high levels in kidney, heart, spleen, intestines, and eye. Significantly lower bacterial loads were observed in muscle, gill and liver. In addition, significantly lower bacterial loads were observed in the brain of convalescent O. niloticus 14 days post-injection with several different S. agalactiae strains. The qPCR for the detection of S. agalactiae developed in this study Correspondence A-X Li, Key Laboratory for Aquatic Products Safety of Ministry of Education/State Key Laboratory of Biocontrol, The School of Life Sciences, Sun Yat-sen University, 135 Xingang West Street, Haizhu District, Guangzhou 510275, Guangdong Province, China (e-mail: [email protected]. cn) Ó 2015 John Wiley & Sons Ltd

229

provides a quantitative tool for investigating bacterial tissue tropism in infected fish, as well as for monitoring bacterial colonization in convalescent fish. Keywords: bacterial colonization, Oreochromis niloticus, quantitative real-time PCR, Streptococcus agalactiae.

Introduction

Streptococcus agalactiae, or group B streptococcus (GBS), is an important pathogen frequently associated with neonatal meningitis in humans (Melin 2011), mastitis in cows (Radtke et al. 2012) and meningoencephalitis in fish (Liu, Zhang & Lu 2012). Infection by GBS has been reported in many fish species, including seabream, Sparus auratus (Evans et al. 2002), rainbow trout, Oncorhynchus mykiss (Pourgholam et al. 2011), barcoo grunter, Scortum barcoo (Liu et al. 2014), channel catfish, Ictalurus punctatus, and tilapia, Oreochromis spp. (Garcia et al. 2008). The most frequent clinical signs of affected fish are haemorrhage in or around the eye, exophthalmia, erratic swimming and rapidly progressing mortality. In some cases, the fish may show no obvious clinical signs before death (Johri et al. 2006). China has the largest tilapia farming industry in the world, producing approximately 40% of the world’s tilapia products. Since 2009, large-scale outbreaks of


severe GBS infections have occurred continuously within tilapia farms in China, causing high mortalities and large economic losses (Chen et al. 2012). Although the pathogenicity of S. agalactiae has been ascertained, and its genome has been sequenced (Liu et al. 2012; Li et al. 2014), bacterial tissue tropism in infected tilapia remains a mystery. To effectively control the disease, it is essential to recognize and understand the host– bacteria interactions. Traditional methods that are currently used for the detection S. agalactiae in host tissues are based on bacterial culture. However, most media used for isolating S. agalactiae are low selectivity, and performing cultures is time-consuming. Furthermore, these methods may misestimate the number of target bacteria as a result of the presence of other microbial competitors in analysed samples (Mahmmod et al. 2013). To overcome these drawbacks, DNA-based methods such as PCR and loop-mediated isothermal amplification are increasingly being used (Jimenez et al. 2011; Huy et al. 2012). Nevertheless, all of these methods fail to produce quantitative measurements of bacterial load in tested samples. Quantitative real-time polymerase chain reaction (qPCR) is an accurate, rapid and highly sensitive method for the quantitative detection of bacteria (Lee, Ow & Oh 2006). Several investigators have used qPCR strategies for the quantitative evaluation of S. agalactiae infection in humans and other mammalian hosts (de Zoysa et al. 2012; Mahmmod et al. 2013). The objective of this study was to develop and optimize a SYBR Green qPCR assay to detect and quantify S. agalactiae in a piscine host. This will provide a better understanding of the pathogenesis of GBS infections in aquaculture.

Materials and methods

Y-L Su et al. qPCR assay of Streptococcus agalactiae

tarda, Vibrio harveyi and Photobacterium damselae subsp. piscicida were kindly provided by Liwen Xu and Ruixuan Wang (South China Sea Fisheries Research Institute, Guangzhou, China). These bacterial strains were cultured following previously published methods (Wang et al. 2010, 2013). Extraction of DNA was performed using the E.Z.N.A. Bacterial DNA kit (Omega Bio-Tek) according to the manufacturer’s protocol. The final elution volume was 100 lL, and the concentration of DNA was measured on a NanoDrop spectrophotometer (Thermo Scientific). The DNA was diluted (50 ng lL1) and stored at 20 °C until use. Genomic DNA extraction from fish tissues. Fresh tissue samples, weighing 50–100 mg, were taken from healthy fish or experimentally infected Nile tilapia Oreochromis niloticus and rinsed in TE buffer. All tissue samples were crushed into a fine powder using a mixer mill (Retsch MM400, Dusseldorf, Germany). The DNA was extracted as described for bacterial DNA extraction above. Primer design Based on the S. agalactiae sequences in GenBank, three pairs of primers were designed with PRIMER3.0 (http://frodo.wi.mit.edu/primer3), Primer Explorer (http://primerexplorer.jp/e/) and NCBI primer-Blast tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast). Primers were synthesized commercially at Sangon Biological Engineering Technology and Services Co. Ltd. (Shanghai, China). The primer pairs cpsE-s/cpsEa, sip-s/sip-a and IGS-s/IGS-a target the capsular polysaccharide (cpsE) gene, surface immunogenic protein (sip) gene and the 16S-23S rRNA intergenic spacer region (ISR), respectively, within the S. agalactiae genome (Table 1).

Genomic DNA extraction Genomic DNA extraction from bacterial strains. Strains of S. agalactiae and S. iniae, originally isolated from infected tilapia during outbreaks of streptococcosis throughout South China (Zou et al. 2011; Li et al. 2014), were grown aerobically overnight at 28 °C in a shaker bath, followed by dilution at 1:100 in brain–heart infusion (BHI; Guangdong Huankai Microbial Sci. & Tech. Co., Ltd. ). The strains of Staphylococcus aureus, Mycobacterium marinum, Nocardia seriolae, Edwardsiella Ó 2015 John Wiley & Sons Ltd

230

Annealing temperature optimization For all pairs of designed primers, different annealing temperatures were simultaneously evaluated using qPCR and agarose gel electrophoresis. The PCR mixture (20 lL) contained 10 lL of 2 9 SYBR Green Real-time PCR master mix (Toyobo, Osaka, Japan), 0.5 lM of each specific primer and 1 lL of template DNA. The PCR was performed in an Eppendorf Mastercycler ep realplex (Eppendorf) with the following program; 94°C for



Table 1 Primers information for quantitative real-time PCR reactions in this study Primer

Sequences(50 –30 )

Target

Length (bp)

GenBank No.

cpsE-s cpsE-a sip-s sip-a IGS-s IGS-a

TTCCAACAAACCGTAAT CTTCCCACTGAACAATAA GTATGACACCAGAAGCAGCAA TCAGCGGCAACAGAAGC GGAAACCTGCCATTTGCGTCT AATCTATTTCTAGATCGTGGAAT

cpsE gene

246

AB017355

sip gene

250

HQ148671

16S-23S rRNA ISR

190

FJ555494

1 min, 40 cycles of amplification (94°C for 30 s, 55°C–65°C for 30 s and 72°C for 20 s), followed by a final 10-min extension at 72°C. The qPCR run was performed in triplicate for each assay. Amplified products were further analysed by electrophoresis to confirm the qPCR results.

V. harveyi and P. damselae subsp. piscicida. O. niloticus and I. punctatus DNA was extracted from the brains of healthy fish according to the methods described for bacterial DNA isolation. The qPCR mixtures and programs were identical to those described above using the predetermined optimized annealing temperatures.

Standard curve generation for sensitivity assay Positive PCR products for each primer pair were purified using a DNA Gel Extraction Kit (Dongsheng Biotech.) and inserted separately into the pMD-18T vector (TaKaRa Bio, Inc.). The recombinant plasmids were transformed into competent Escherichia coli DH5a cells (Tiangen Biotech [Beijing] Co., Ltd.) which were grown in Luria– Bertani medium. Plasmids were extracted with a plasmid extraction kit (Tiangen Biotech [Beijing] Co., Ltd.), and plasmid concentration was determined using a Nanodrop 2000 spectrophotometer. A 10-fold serial dilution of each positive vector was used as templates for the qPCR assays described above using the optimized annealing temperatures. Standard curve slopes, cycle threshold number (Ct) versus log quantity and PCR efficiencies (E) were calculated using the Realplexautomated qPCR instrument (Eppendorf). The PCR efficiency was calculated from the standard curve as the percentage of template molecules that were doubled during each cycle (E = [101/ (slope) 1] 9 100). The detection limit was determined as the lowest concentration (within the linear range) that produced an amplification signal on the Eppendorf Mastercycler ep realplex. This was repeated on three occasions. Specificity assay S. agalactiae DNA was used as the positive control. Negative controls consisted of standard human DNA (ABI, Carlsbad, CA, USA) and DNA from O. niloticus, I. punctatus, S. iniae, S. aureus, M. marinum, N. seriolae, E. tarda, Ó 2015 John Wiley & Sons Ltd

231

Repeatability and reproducibility of 16S-23S rRNA ISR-based qPCR assay To evaluate repeatability and reproducibility of the optimized qPCR assay, the recombinant plasmids containing 16S-23S rRNA ISR ranging from 6.04 9 108 copies lL1 to 6.04 9 101 copies lL1 were tested repeatedly. Three separate dilution series were assayed in a single run to evaluate intra-assay variations. Whereas, the interassay variations were measured by testing each dilution in three separate consecutive runs. The mean, standard deviation (SD) and coefficient of variation (CV) for both intra-assay and interassay variations were calculated separately for each standard DNA dilution based on their Ct values using Microsoft Excel software. Detection and quantification of S. agalactiae in experimentally infected fish by qPCR Ten S. agalactiae strains with differing virulence (TGY1201, TZQ1001, TZQ1002, THK1104, TMM1101, TMM1102, TZH1201, TZC1101, THN0901 and TFJ0901) were used (Li et al. 2014). O. niloticus (average weight = 76.0 g) were purchased from a breeding farm in Guangdong province, China. The fish were maintained in 0.25m3 tanks with constant aeration and a water temperature of 29 1 °C. A commercial diet was fed twice per day. After acclimation for 14 days, the fish were distributed into eleven groups of 30 fish (15 fish per tank in duplicate) with two replicate tanks of tilapia serving as controls. The tilapia within each of the ten experimental groups were


injected intraperitoneally with 107 CFU of a different strain of S. agalactiae (in a total volume of 0.1 mL) (Li et al. 2014). The control fish were injected with 0.1 mL PBS. Three fish were randomly collected 5 days post-injection (dpi) from the group challenged with the virulent S. agalactiae strain THN0901. Fish were killed by an overdose of anaesthetic (MS-222, Sigma), and the following tissues were sampled: brain, eye, kidney, spleen, heart, liver, intestines, muscle and gill. In addition, three fish brains were sampled at 14 dpi from each group. All tissue samples were stored at 80 °C. The optimized qPCR protocol, using the primer pair IGS-s/IGS-a, was applied to detect and quantify S. agalactiae in challenged fish. There are seven copies of the 16S-23S rRNA ISR per S. agalactiae genome, based on the five complete genome sequences of S. agalactiae found in databases at NCBI (GenBank Accession No. NC_018646, NC_019048, NC_007432, NC_004368 and NC_004116). The concentration of S. agalactiae in the fish tissue samples was calculated using the following formula: copies of S. agalactiae per mg tissue (copies mg1) = [copies of 16S-23S rRNA ISR per mg tissue (copies mg1)]/7. All experimental procedures in this research conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Results

Annealing temperature optimization As shown in Fig. 1, the optimized annealing temperatures were 55.8, 56.7 and 60.4 °C for the primer pairs cpsE-s/cpsE-a, sip-s/sip-a and IGS-s/ IGS-a, respectively. Sensitivity assay The concentrations of the recombinant plasmids containing cpsE, sip and 16S-23S rRNA ISR were 178.3, 217.6 and 190.9 ng lL1, which equate 5.53 9 1010, 6.74 9 1010 and 6.04 9 1010 copies lL1, respectively. Each standard curve produced from the amplification of a 10-fold serial dilution of the recombinant plasmids containing cpsE (5.53 9 101–5.53 9 108 copies lL1), sip (6.74 9 101–6.74 9 109 copies lL1) and 16S23S rRNA ISR (6.04 9 101–6.04 9 108 copies lL1) demonstrated a strong correlation between the template concentration and the Ct value Ó 2015 John Wiley & Sons Ltd

232


(Fig. 2). The reaction efficiency of the primer pairs was between 102% and 111%, and the R2 values for all pairs were >0.990 (Fig. 2). The detection limits of the qPCR assays were 55.3, 67.4 and 60.4 copies of the target sequence in a 20 lL reaction volume for the primer pairs cpsEs/cpsE-a, sip-s/sip-a and IGS-s/IGS-a, respectively. As seven 16S-23S rRNA ISRs are present in the complete genome, the detection limit for S. agalactiae with the primer pair IGS-s/IGS-a was 8.6 genome equivalents per reaction. Specificity of primers Different templates were chosen as controls to test the specificity of the designed primers. With the exception of the S. agalactiae-positive templates, no PCR products were amplified in any of the controls with the IGS-s/IGS-a primer pair. However, some unexpected products were amplified from E. tarda, V. harveyi and I. punctatus with the cpsE-s/cpsE-a primer pair, and from S. iniae, P. damselae subsp. piscicida and I. punctatus with the sip-s/sip-a primer pair (Fig. 3). The results demonstrate that the IGSs/IGS-a primer pair was specific for S. agalactiae detection. Thus, primer pair IGS-s/IGS-a appeared to be a good candidate for GBS detection. Repeatability and reproducibility of 16S-23S rRNA ISR-based qPCR assay Repeatability and reproducibility of the assay was assessed based on the Ct values obtained from testing DNA standard in triplicates. The intra-assay variability of the assay was analysed using 10-fold dilutions of the plasmid DNA standard ranging from 6.04 9 108 to 6.04 9 101 copies lL1 in triplicates per run. The calculated SD and CV values were ranging from 0.03 to 0.40 and from 0.13% to 1.88%, respectively (Table 2). Whereas, the interassay variability was assessed by testing dilutions of the plasmid DNA standard in the range of 6.04 9 108 to 6.04 9 101 copies lL1 in three different experiments. The calculated SD and CV values were ranging from 0.20 to 0.52 and from 0.64% to 3.63%, respectively (Table 2). Detection and quantification of S. agalactiae in tissues of challenged fish Mortalities of tilapia experimentally infected with different S. agalactiae strains occurred in large



(a)

(b)

(c)

Figure 1 Quantitative real-time PCR amplifications with the primer pairs cpsE-s/ cpsE-s (a), sip-s/sip-a (b) and IGS-s/IGS-a (c), respectively, at different annealing temperatures. The upper places show the Ct values with different annealing temperatures. Results are for n = 3 SD. The lower places show the agarose gel electrophoresis results corresponding to the bar charts.

quantities from 1 dpi to 5 dpi. Differing degrees of clinical signs, including anorexia, erratic swimming, exophthalmia and haemorrhage in the eyes, appeared in each group beginning at 3 dpi with the exception of the group challenged with S. agalactiae TFJ0901. Tilapia injected with S. agalactiae THN0901 showing severe clinical signs were sampled 5 dpi, and the tissues were quantified by qPCR. To minimize intersample variation, the Ó 2015 John Wiley & Sons Ltd

233

data were converted into logarithmic values (Fig. 4). S. agalactiae was detectable in all examined tissues, although the number of bacteria differed across different tissues. The levels of bacterial load in infected tissues could be divided into three different groups. The highest level of S. agalactiae was detected in the brain (2.4 9 105 copies per mg tissue), which was significantly higher (P < 0.001) than that in all other tissues.



(a)

(b)

(c)

Figure 2 Amplification plots and standard curves of quantitative real-time PCR assay based on recombinant plasmids copy numbers. Amplification plot of 10-fold serial diluted recombinant plasmid DNA ranging from 5.53 9 101–5.53 9 108, 6.74 9 101– 6.74 9 109 and 6.04 9 101–6.04 9 108 copies lL1 with primer pair cpsE-s/cpsE-a (a), sip-s/sip-a (b) and IGS-s/IGS-a (c), respectively; corresponding standard curve (right).

The kidney, heart, spleen, intestine and eye all showed intermediate levels of the pathogen, with 1.1 9 104–3.6 9 104 copies per mg tissue. The bacterial loads in muscle, gill and liver were detected at significantly lower levels (8.3 9 102– 2.3 9 103 copies per mg tissue P < 0.001). Tilapia in each group infected with the different S. agalactiae strains steadily recovered from all clinical signs, with behaviour returning to normal at 10 dpi. The survivors within each group ranged from 13.3% to 93.3%. No clinical signs were observed among all remaining tilapia by 14 dpi. Considering bacterial tissue tropism, brains Ó 2015 John Wiley & Sons Ltd

234

were obtained from the survivors of each group at this time point. The quantity of bacteria detected in each treatment group was typically between 6.1 9 102 and 1.2 9 103 copies per mg tissue. Although the S. agalactiae strains with differing virulence were used in the study, no significant differences in brain bacterial loads were observed in convalescent tilapia from each group (Fig. 5). The results for the control samples in this experiment were negative, as the corresponding Ct values were beyond the limit of detection of the assay.



(a)

(b)

Figure 4 The detection and quantification of Streptococcus agalactiae by quantitative real-time PCR assay in brain, eye, kidney, liver, spleen, gill, intestines, heart and muscle of Oreochromis niloticus at 5 days post-injection with virulent S. agalactiae strain THN0901. Results are for n = 3 SD. ‘P < 0.001’ indicates a statistically significant difference at greater than the 0.001 level of probability.

(c) Figure 3 Corresponding agarose gel electrophoresis of quantitative real-time PCR products showing the specificity of primer pair cpsE-s/cpsE-s (a), sip-s/sip-a (b) and IGS-s/IGS-a (c), respectively. Lane M, DL2000 marker; 1ane 1, DNA of Streptococcus agalactiae; 1ane 2, DNA of Streptococcus iniae; lane 3, DNA of Staphylococcus aureus; 1ane 4, DNA of Mycobacterium marinum; 1ane 5, DNA of Nocardia seriolae; 1ane 6, DNA of Edwardsiella tarda; 1ane 7, DNA of Vibrio harveyi; 1ane 8, DNA of Photobacterium damselae subsp. piscicida; 1ane 9, DNA of Ictalurus punctatus; 1ane 10, DNA of Oreochromis niloticus; 1ane 11, human DNA.

Table 2 Repeatability and reproducibility of 16S-23S rRNA ISR-based quantitative real-time PCR assay

DNA copies lL1 6.04 6.04 6.04 6.04 6.04 6.04 6.04 6.04

9 9 9 9 9 9 9 9

108 107 106 105 104 103 102 101

Intra-assay variation

Interassay variation

Mean Ct

SD

CV (%)

Mean Ct

SD

CV (%)

10.06 13.47 15.69 19.15 21.96 25.34 27.87 32.13

0.19 0.13 0.03 0.28 0.25 0.40 0.04 0.28

1.88 0.97 0.17 1.47 1.14 1.60 0.13 0.87

10.62 13.64 16.29 19.31 21.92 24.41 27.42 31.25

0.31 0.49 0.52 0.29 0.22 0.34 0.29 0.20

2.92 3.63 3.19 1.50 1.00 1.38 1.06 0.64

Discussion

In this study, three primer pairs were designed based upon the sequences of the cpsE, sip and Ó 2015 John Wiley & Sons Ltd

235

Figure 5 Bacterial loads in brain of Oreochromis niloticus at 14 days post-injection with Streptococcus agalactiae strain THK1104, TGY1201, TFJ0901, TZQ1001, TMM1102, TZQ1002, TMM1101, TZH1201, THN0901 and TZC1101, respectively, by quantitative real-time PCR assay. Results are for n = 3 SD. No significant differences between each group (P > 0.05).

16S-23S rRNA ISR genes. There is evidence to suggest that seven rRNA operons were present in the complete genome of S. agalactiae (Pereira et al. 2013). The NCBI primer-Blast tool was also used to screen the genomes of different S. agalactiae strains for the presence of seven conserved 16S-23S rRNA ISRs. Thus, the lowest level of detection with the IGS-s/IGS-a primer pair was as low as 8.6 genome equivalents and was approximately seven times more sensitive than the results obtained using the other primer pairs designed in the current study. This level of sensitivity is also in agreement with a real-time RT-PCR assay for the detection of Streptococcus milleri using the 16S rRNA gene as a target (Olson et al. 2010). In comparison with a previously published qPCR


assay targeting the CAMP-factor (cfb) gene for the detection of S. agalactiae in neonatal blood (Golden et al. 2004), the present assay was more sensitive. Further, low CV values obtained for intra- and inter-runs indicate a high level of assay repeatability and reproducibility. Therefore, this assay provides precise quantitative detection and effectively eliminates the need for sample dilution for many practical applications. The ISR, a stretch of DNA that lies in the rRNA operon, has been proven to be much more variable than the adjacent 16S and 23S rRNA genes (Hassan et al. 2003). In the present study, the high specificity of the IGS-s/IGS-a primer pair targeting the 16S-23S rRNA ISR was confirmed by testing different control templates, including related species (S. iniae), aquatic Gram-positive bacteria (S. aureus, M. marinum and N. seriolae), aquatic Gram-negative bacteria (E. tarda, V. harveyi and P. damselae subsp. piscicida), piscine hosts (I. punctatus and O. niloticus) and the human genome. These results are consistent with the findings reported by Jimenez et al. (2011), as no products were also amplified from other fish bacterial pathogens using the primers targeting the 16S-23S rRNA ISR. In addition, the specificity of the assays was also assessed using two different approaches: (1) the expected size of the PCR amplicons was confirmed by agarose gel electrophoresis and (2) melt curve analysis demonstrated a specific amplification by generation of a consistent melting peak. There were no primer–dimers or nonspecific products detected (data not shown), confirming that the designed primer pair targeting the 16S-23S rRNA ISR was specific for detecting S. agalactiae in fish tissues. The use of cps and sip gene sequences for the detection of S. agalactiae in humans has previously been described (Poyart et al. 2007; El Aila et al. 2011). In the current study, however, qPCR assays based on these genes showed cross-reactions with DNA from some aquatic bacteria and piscine hosts. For example, the sip gene primer pair did not enable S. agalactiae to be distinguished from the related species S. iniae, which has also been associated with streptococcosis in fish (Agnew & Barnes 2007). In the present study, healthy tilapia were successfully infected with ten different S. agalactiae strains. The severity of the clinical signs observed in infected tilapia, which peaked between 3 dpi and 5 dpi, was consistent with the observations of Pereira et al. (2010). Using the experimentally Ó 2015 John Wiley & Sons Ltd

236


infected tilapia as a model, we determined the bacterial tissue tropism. During the acute phase of the infection, S. agalactiae was shown to be present in large amounts in the examined organs. The results indicated that GBS could proliferate in many different tissues and that the tissue distribution of S. agalactiae was very broad. The highest bacterial load was observed in the brain, which suggests that the brain of tilapia is a most appropriate target tissue for GBS invasion. A previous study has reported that GBS is capable of replicating in the zebrafish bloodstream and penetrating the blood–brain barrier (Patterson et al. 2012). Because subsequent bacterial replication within the central nervous system would provoke the host inflammatory response resulting in meningitis, it is very plausible that the swimming of tilapia was affected accordingly. An interesting feature was the detection of high bacterial loads in the eye, spleen and kidney, which could be due to the spread of infection through the circulatory system or by bacterial multiplication in these tissues. This is consistent with the clinical signs in various fish species which developed haemorrhage in the eye, corneal opacity, exophthalmia, and congestion of the kidney and spleen after GBS infection (Duremdez et al. 2004; Zamri-Saad et al. 2010; Liu et al. 2014). It is surprising that the intestines and heart of tilapia, which were anticipated to contain a low bacterial load, had high copy numbers of S. agalactiae DNA. The high bacterial colonization density in these tissues is interesting, considering that GBS has the ability to adhere to and invade female (intestinal and vaginal) epithelial cells (Lalioui et al. 2005) and that GBS can cause infective endocarditis in human (Patane 2014). This may suggest that S. agalactiae could interact with fish intestinal epithelial cells and cardiomyocytes, resulting in corresponding lesions in fish. The S. agalactiae strain THN0901, isolated from an intensive tilapia farm in the Hainan province of China in 2009, is a highly pathogenic strain that causes high mortality with typical pathological changes. In contrast, TFJ0901 is a lowvirulence strain, isolated from the Fujian province of China in 2009, which results in low mortality (Li et al. 2014). Despite these differences in strain virulence, bacterial DNA loads in the brain of tilapia from each treatment group were similar at 14 dpi. This is interesting and suggests that intraperitoneal inoculation with the different GBS strains resulted in acute infections followed by a


diminishing but lasting detection of bacterial DNA in convalescent fish. In summary, the real-time PCR assay developed in this study provides a rapid, specific and sensitive method for the identification and quantification of S. agalactiae in tilapia tissues. To our knowledge, this assay presents the first reported molecular method for the quantitative detection of S. agalactiae in fish tissues. The analytical quantification of bacterial load provides a tool for studying bacterial tissue tropism in infected tilapia, as well as for monitoring bacterial colonization in convalescent tilapia. Quantitative analysis of bacterial load will be valuable for further study of bacterial pathogenesis, including the investigation of bacterial replication, kinetic analysis in fish tissues and host–bacteria interactions. Acknowledgements This work was supported by grants from Key Projects in the National Science & Technology Pillar Program (2012BAD17B00) and Science and Technique Program of Government of Guangdong Province (2012A020800006). We thank Prof. Liwen XU and Dr. Ruixuan WANG in South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences for providing the strains Staphylococcus aureus, Mycobacterium marinum, Nocardia seriolae, Edwardsiella tarda, Vibrio harveyi and Photobacterium damselae subsp. Piscicida. References Agnew W. & Barnes A.C. (2007) Streptococcus iniae: an aquatic pathogen of global veterinary significance and a challenging candidate for reliable vaccination. Veterinary Microbiology 122, 1–15. Chen M., Li L.P., Wang R., Liang W.W., Huang Y., Li J., Lei A.Y., Huang W.Y. & Gan X. (2012) PCR detection and PFGE genotype analyses of streptococcal clinical isolates from tilapia in China. Veterinary Microbiology 159, 526– 530. Duremdez R., Al-Marzouk A., Qasem J.A., Al-Harbi A. & Gharabally H. (2004) Isolation of Streptococcus agalactiae from cultured silver pomfret, Pampus argenteus (Euphrasen), in Kuwait. Journal of Fish Diseases 27, 307–310. El Aila N.A., Tency I., Claeys G., Verstraelen H., Deschaght P., Decat E., Lopes dos Santos Santiago G., Cools P., Temmerman M. & Vaneechoutte M. (2011) Comparison of culture with two different qPCR assays for detection of rectovaginal carriage of Streptococcus agalactiae (group B streptococci) in pregnant women. Research in Microbiology 162, 499–505.

Ó 2015 John Wiley & Sons Ltd

237


Evans J.J., Klesius P.H., Gilbert P.M., Shoemaker C.A., Al Sarawi M.A., Landsberg J., Duremdez R., Al Marzouk A. & Al Zenki S. (2002) Characterization of b-haemolytic Group B Streptococcus agalactiae in cultured seabream, Sparus auratus L., and wild mullet, Liza klunzingeri (Day), in Kuwait. Journal of Fish Diseases 25, 505–513. Garcia J.C., Klesius P.H., Evans J.J. & Shoemaker C.A. (2008) Non-infectivity of cattle Streptococcus agalactiae in Nile tilapia, Oreochromis niloticus and channel catfish, Ictalurus punctatus. Aquaculture 281, 151–154. Golden S.M., Stamilio D.M., Faux B.M., Shoemaker C.T., Blackmon C.L., Stassen S.D., Clark V.M., Smith J.W. & Johnson O.L. (2004) Evaluation of a real-time fluorescent PCR assay for rapid detection of Group B Streptococci in neonatal blood. Diagnostic Microbiology and Infectious Disease 50, 7–13. Hassan A.A., Khan I.U., Abdulmawjood A. & L€ammler C. (2003) Inter-and intraspecies variations of the 16S–23S rDNA intergenic spacer region of various streptococcal species. Systematic and Applied Microbiology 26, 97–103. Huy N.T., Hang L.T.T., Boamah D., Lan N.T.P., Thanh P., Watanabe K., Huong V.T.T., Kikuchi M., Ariyoshi K., Morita K. & Hirayama K. (2012) Development of a singletube loop-mediated isothermal amplification assay for detection of four pathogens of bacterial meningitis. FEMS Microbiology Letters 337, 25–30. Jimenez A., Tibata V., Junca H., Ariza F., Verjan N. & Iregui C. (2011) Evaluating a nested-PCR assay for detecting Streptococcus agalactiae in red tilapia (Oreochromis sp.) tissue. Aquaculture 321, 203–206. Johri A.K., Paoletti L.C., Glaser P., Dua M., Sharma P.K., Grandi G. & Rappuoli R. (2006) Group B Streptococcus: global incidence and vaccine development. Nature Reviews Microbiology 4, 932–942. Lalioui L., Pellegrini E., Dramsi S., Baptista M., Bourgeois N., Doucet-Populaire F., Rusniok C., Zouine M., Glaser P., Kunst F., Poyart C. & Trieu-Cuot P. (2005) The SrtA Sortase of Streptococcus agalactiae is required for cell wall anchoring of proteins containing the LPXTG motif, for adhesion to epithelial cells, and for colonization of the mouse intestine. Infection and Immunity 73, 3342–3350. Lee C.L., Ow D.S.W. & Oh S.K.W. (2006) Quantitative realtime polymerase chain reaction for determination of plasmid copy number in bacteria. Journal of Microbiological Methods 65, 258–267. Li W., Su Y.L., Mai Y.Z., Li Y.W., Mo Z.Q. & Li A.X. (2014) Comparative proteome analysis of two Streptococcus agalactiae strains from cultured tilapia with different virulence. Veterinary Microbiology 170, 135–143. Liu G., Zhang W. & Lu C. (2012) Complete genome sequence of Streptococcus agalactiae GD201008-001, isolated in China from tilapia with meningoencephalitis. Journal of Bacteriology 194, 6653–6653. Liu L., Li Y.W., He R.Z., Xiao X.X., Zhang X., Su Y.L., Wang J. & Li A.X. (2014) Outbreak of Streptococcus agalactiae infection in barcoo grunter, Scortum barcoo (McCulloch & Waite), in an intensive fish farm in China. Journal of Fish Diseases, 37, 1067–1072.


Mahmmod Y.S., Toft N., Katholm J., Grønbæk C. & Klaas I.C. (2013) Estimation of test characteristics of real-time PCR and bacterial culture for diagnosis of subclinical intramammary infections with Streptococcus agalactiae in Danish dairy cattle in 2012 using latent class analysis. Preventive Veterinary Medicine 109, 264–270. Melin P. (2011) Neonatal group B streptococcal disease: from pathogenesis to preventive strategies. Clinical Microbiology Infection 17, 1294–1303. Olson A.B., Sibley C.D., Schmidt L., Wilcox M.A., Surette M.G. & Corbett C.R. (2010) Development of real-time PCR assays for detection of the Streptococcus milleri group from cystic fibrosis clinical specimens by targeting the cpn60 and 16S rRNA genes. Journal of Clinical Microbiology 48, 1150–1160. Patane S. (2014) Is there a need for bacterial endocarditis prophylaxis in patients undergoing urological procedures? Journal of Cardiovascular Translational Research 7, 369–371. Patterson H., Saralahti A., Parikka M., Dramsi S., Trieu-Cuot P., Poyart C., Rounioja S. & R€amet M. (2012) Adult zebrafish model of bacterial meningitis in Streptococcus agalactiae infection. Developmental & Comparative Immunology 38, 447–455. Pereira U.P., Mian G.F., Oliveira I.C.M., Benchetrit L.C., Costa G.M. & Figueiredo H.C.P. (2010) Genotyping of Streptococcus agalactiae strains isolated from fish, human and cattle and their virulence potential in Nile tilapia. Veterinary Microbiology 140, 186–192. Pereira U.D., dos Santos A.R., Hassan S.S., Aburjaile F.F., Aburjaile F.F., Soares S.D., Ramos R.T.J., Carneiro A.R., Guimaraes L.C., de Almeida S.S., Diniz C.A.A., Barbosa M.S., de Sa P.G., Ali A., Bakhtiar S.M., Dorella F.A., Zerlotini A., Araujo F.M.G., Leite L.R., Oliveira G., Miyoshi A., Silva A., Azevedo V. & Figueiredo H.C.P. (2013) Complete genome sequence of Streptococcus agalactiae strain SA20-06, a fish pathogen associated to meningoencephalitis outbreaks. Standards in Genomic Sciences 8, 188–197. Pourgholam R., Laluei F., Saeedi A.A., Zahedi A., Safari R., Taghavi M.J., Nasrollhzadeh Saravi H. & Pourgholam H.

Ó 2015 John Wiley & Sons Ltd

238


(2011) Distribution and molecular identification of some causative agents of streptococcosis isolated from farmed rainbow trout (Oncorhynchus mykiss, Walbaum) in Iran. Iranian Journal of Fisheries Sciences 10, 109–122. Poyart C., Tazi A., Reglier-Poupet H., Billo€et A., Tavares N., Raymond J. & Trieu-Cuot P. (2007) Multiplex PCR assay for rapid and accurate capsular typing of group B streptococci. Journal of Clinical Microbiology 45, 1985–1988. Radtke A., Bruheim T., Afset J.E. & Bergh K. (2012) Multiple-locus variant-repeat assay (MLVA) is a useful tool for molecular epidemiologic analysis of Streptococcus agalactiae strains causing bovine mastitis. Veterinary Microbiology 157, 398–404. Wang R., Liu G., Wang J., Feng J., Guo Z. & Xu L. (2010) Studies on nocardiasis infected farming Trachinotus ovatus. Transactions of Oceanology and Limnology 1, 52–58 (in Chinese, with English abstract). Wang R., Feng J., Su Y., Ye L. & Wang J. (2013) Studies on the isolation of Photobacterium damselae subsp. piscicida from diseased golden pompano (Trachinotus ovatus Linnaeus) and antibacterial agents sensitivity. Veterinary Microbiology 162, 957–963. Zamri-Saad M., Amal M.N.A. & Siti-Zahrah A. (2010) Pathological changes in red tilapias (Oreochromis spp.) Naturally Infected by Streptococcus agalactiae. Journal of Comparative Pathology 143, 227–229. Zou L., Wang J., Huang B., Xie M. & Li A. (2011) MtsB, a hydrophobic membrane protein of Streptococcus iniae, is an effective subunit vaccine candidate. Vaccine 29, 391–394. de Zoysa A., Edwards K., Gharbia S., Underwood A., Charlett A. & Efstratiou A. (2012) Non-culture detection of Streptococcus agalactiae (Lancefield group B Streptococcus) in clinical samples by real-time PCR. Journal of Medical Microbiology 61, 1086–1090. Received: 18 November 2014 Revision received: 10 January 2015 Accepted: 10 January 2015

commercial tilapia.

Japanese encephalitis virus tropism in experimentally infected pigs.

Molecular identification and histopathological study of natural Streptococcus agalactiae infection in hybrid tilapia (Oreochromis niloticus).

Draft Genome Sequences of Streptococcus agalactiae Serotype Ia and III Isolates from Tilapia Farms in Thailand.

Complete Genome Sequence of a Virulent Streptococcus agalactiae Strain, 138P, Isolated from Diseased Nile Tilapia.

Molecular cloning and bioinformatic analysis of the Streptococcus agalactiae neuA gene isolated from tilapia.

Development and validation of a quantitative real-time PCR assay for the early diagnosis of coccidioidomycosis.

Experimental early pathogenesis of Streptococcus agalactiae infection in red tilapia Oreochromis spp.

Draft Genome Sequences of Streptococcus agalactiae Strains Isolated from Nile Tilapia (Oreochromis niloticus) Farms in Thailand.

Phosphoglycerate kinase enhanced immunity of the whole cell of Streptococcus agalactiae in tilapia, Oreochromis niloticus.

Development of a Quantitative PCR Assay for Thermophilic Spore-Forming Geobacillus stearothermophilus in Canned Food.

Development of a multiplex PCR assay to detect Edwardsiella tarda, Streptococcus parauberis, and Streptococcus iniae in olive flounder (Paralichthys olivaceus).

Comparative proteome analysis of two Streptococcus agalactiae strains from cultured tilapia with different virulence.

Tissue-specific methylation of human insulin gene and PCR assay for monitoring beta cell death.

Complete Genome Sequence of Streptococcus agalactiae Strain S25 Isolated from Peritoneal Liquid of Nile Tilapia.

Maternal colonization with Streptococcus agalactiae and associated stillbirth and neonatal disease in coastal Kenya.

A high-throughput assay for quantitative measurement of PCR errors.

Prevalence of colonization by Streptococcus agalactiae among pregnant women in Bukavu, Democratic Republic of the Congo.

Development of Methanoculleus-specific real-time quantitative PCR assay for assessing methanogen communities in anaerobic digestion.

Effect of milking without pulsation on teat duct colonization with Streptococcus agalactiae and penetrability to endotoxin.

Screening and management of maternal colonization with Streptococcus agalactiae: an Italian cohort study.

Increasing of temperature induces pathogenicity of Streptococcus agalactiae and the up-regulation of inflammatory related genes in infected Nile tilapia (Oreochromis niloticus).

Molecular characterization and expression of Lck in Nile tilapia (Oreochromis niloticus) in response to Streptococcus agalactiae stimulus.

Development of a quantitative PCR assay for rapid detection of Lactobacillus plantarum and Lactobacillus fermentum in cocoa bean fermentation.