Molecular and Cellular Probes
(1991) 5, 215-219
Differentiation of Mycobacterium tuberculosis and Mycobacterium bovis BCG by a polymerase chain reaction
assay Bonnie B . Plikaytis,' Kathleen D . Eisenach 2 Jack T . Crawford' and Thomas M . Shinnick'* 'Division of Bacterial Diseases, Center for Infectious Diseases, Centers for Disease Control, Atlanta GA 30333, and 2Medical Research Service, McClellan Memorial Veterans Hospital, Little Rock AR 72205, USA (Received 19 September 1990, Accepted 18 December 1990)
Mycobacterium tuberculosis and Mycobacterium bovis are closely related species which carry different numbers of the repetitive DNA element IS6110 . A polymerase chain reaction assay was developed to assess the copy number of IS6110 in a strain and thereby differentiate these two important human pathogens .
KEYWORDS: mycobacteria, polymerase chain reaction, repetitive DNA .
INTRODUCTION and Mycobacterium bovis are important pathogens of humans and animals . Also, the M . bovis strain BCG is widely used as a vaccine to prevent tuberculosis. The currently used procedures for distinguishing these closely related
the species, the PCR amplification of a portion of the IS6110 element is compared to the amplification of a portion of the single copy gene, gro EL . (The gro EL gene was chosen because the nucleotide sequences of the M . tuberculosis and M . bovis gro EL genes are identical .)' ,' The key advantage of this approach is
Mycobacterium tuberculosis
species involve biochemical tests, such as niacin accumulation or nitrate reductase activity, and take at least 3-4 weeks from the time of specimen collection to identify the species .' We report here a rapid procedure for distinguishing M . bovis and M . tuberculosis strains . The procedure takes advantage of the observations that (1) M . tuberculosis strains carry 1015 copies of a repetitive DNA element (IS6110), (2) M . bovis strains carry only one to two copies of it, and (3) portions of the 156110 element can be efficiently amplified by the polymerase chain reaction (PCR) from both species ." To estimate the number of copies of IS6110 per genome, and hence to identify
that, by using PCR, one does not need to culture the organism, so that the entire assay can be completed in less than 8 h after specimen collection .
MATERIALS AND METHODS Mycobacterial strains The strains used in these studies are listed in Table 1 and were obtained from the stock culture collections of the Centers for Disease Control (CDC) or the
*Author to whom correspondence should be addressed . 0890-8508/91/030215 + 05 $03 .00/0
215
© 1991 Academic Press Limited
216 Table 1 .
B. B . Plikaytis Mycobacterial strains used in this study
M. tuberculosis"
M . bovis
M . microti
H37Ra Clinical T5 Clinical T6 Clinical T12 Clinical 1048
TMC401 TMC410 TMC602 BCG (TMC1013) BCG Glaxo (TMC1024) BCG-Rosenthal
TMC1619
Clinical 1049 Clinical 1053 Clinical 1055
M . africanum
TMC5122
* Clinical isolates T5, T6, and T12 were grown and DNA purified on CsCI gradients as previously described .' DNA was directly purified from sputum samples for clinical specimens 1048, 1049, 1053, and 1055 .
et al .
reaction mix containing 200 µM of each deoxynucleoside triphosphate, 0. 5 µM each of primers IS41 and 1543 and/or 1 . 0 µM each of primers TB15 and TB19, 2 . 5 units of Taq polymerase, 10 mm Tris-HCI (pH 8 . 3), 50 mm KCI, 1 . 5 mm MgCl2, and 0 .01 % gelatin as recommended by the GeneAmp Kit manufacturer (Perkin-Elmer Cetus, Norwalk, CT) . The amplifications were carried out in a Programmable Thermal Controller (MJ Research, Watertown, MA) in a two-step cycle of 75 s at 94 ° C followed by 3 min at 68 ° C. The amplification products were separated on 6% polyacrylamide-Tris-Borate-EDTA gels and visualized by ethidium bromide fluorescence .
RESULTS McClellan Memorial Veterans Hospital . Clinical isolates and specimens were obtained from the McClellan Memorial Veterans Hospital . Oligonucleotide primers Primers were synthesized on a DNA synthesizer (Model 381A, Applied Biosystems, Foster City, CA) using R-cyanoethyl phosphoramidite chemistry . The sequences and locations of the primers are shown in Table 2 . Preparation of DNA DNA was isolated from M . tuberculosis and M . bovis strains and was purified on CsCl gradients as previously described .' Sputum specimens were concentrated using the standard NALC-NaOH method . The sediment was treated with lysozyme and boiled in NaOH-SDS to lyse the bacilli . The DNA was recovered using the Gene Clean technique (K . Eisenach, M . Sifford, M. Cave, J . Bates, and J . Crawford, submitted for publication) . Crude lysates of some of the strains were prepared by homogenization in the presence of 0 . 1-mm glass beads and used directly in the PCR assays as previously described .' Polymerase chain reaction The template DNA in 5 µl H 2 O was added to 45 gl of Table 2. Primer TB15 TB19 IS41 1543
Approximately equal amounts of the 576-basepair piece of the gro EL gene were produced when 2 ng of M. tuberculosis genomic DNA or 2 ng of M . bovis BCG genomic DNA were amplified with primers TB15+TB19 for 30 cycles (Fig . la, lanes 2 and 3). A greater amount of the 317-bp piece of IS6110 was amplified by primers IS41+IS43 in 30 cycles from 2 ng of M . tuberculosis genomic DNA (Fig . la, lane 6) than from 2 ng of M . bovis BCG genomic DNA (Fig . la, lane 7), as is expected from the copy number of IS6110 . Both the 576-bp piece of the gro EL gene and 317-bp piece of IS6110 were produced when 2 ng of M . bovis BCG genomic DNA was amplified with a mixture of the four primers TB15 + TB19 + IS41 + IS43 for 30 cycles (Fig. la, lane 5) . However, the amount of the 576-bp gro EL product produced was somewhat less than expected (i .e., compare lanes 3 and 5, Fig. 1a) . In contrast, when 2 ng M . tuberculosis genomic DNA was amplified using the set of four primers for 30 cycles (Fig . la, lane 4), the 317-bp IS6110 target was efficiently amplified, but the 576-bp gro EL target was not amplified to a detectable level . The 576-bp piece is in fact amplified, but the amount produced is 10- to 20-fold less than expected from the amplification by primers TB15+TB19 alone (data not shown) . The influence of the relative copy number of the 156110 and gro EL targets on amplification of the 576bp and 317-bp products was further assessed by
Oligonucleotide primers used in this study Target
Sequence (5'-3')
Location°
gro EL EL 156110 IS6110
CATCTCGCCCCCACCGGGAA CTGGCCCAGATCCCCCAG CCTGCGAGCGTACGCGTCGG TCAGCCGCGTCCACGCCGCCA
1856-1837c 1281-1298 884-865c 568-588
gro
* The numbering of the residues of the gro EL gene is as reference 4. The numbering of the residues of as described by reference 8. A 'c' indicates the listed sequence is the complement of the published sequence . 156110 is
Multiplex PCR for M . bovis and M. tuberculosis
21 7
576 by -
317 by -3
Fig. 1 . (a) Amplification of the gro EL and 156110 targets from M . tuberculosis and M. bovis strains . Two nanograms of CsCI-purified M. tuberculosis genomic DNA was amplified for 30 cycles with primers TB15+TB19 (lane 2), primers TB15+TB19+IS41 +1543 (lane 4), and IS41 +IS43 (lane 6) . Two nanograms of CsCl-purified M . bovis BCG-Rosenthal genomic DNA was amplified for 30 cycles with primers TB15+TB19 (lane 3), primers TB15+TB19+1541 +IS43 (lane 5), and IS41 +IS43 (lane 7) . Lane 1 contains pBR322-Hin FI fragments . (b) Effect of copy number on amplification . CsCl-purified DNAs of M . tuberculosis and M . bovis BCG-Rosenthal were mixed to give ratios of the 156110 target to the gro EL target of 9 :1 (lane 3), 6 :1 (lane 4), 4 :1 (lane 5), and 2 :1 (lane 6) . Lane 2 represents a 12:1 ratio (M. tuberculosis) and lane 7 represents a 1 :1 ratio (M . bovis BCG-Rosenthal) . For each sample, 2 ng of DNA was amplified for 30 cycles using the set of four primers . Lane 1 contains pBR322-Hin FI fragments .
mixing M . tuberculosis and M . bovis BCG genomic DNAs in various ratios and then amplifying 2 ng of each mixture with the set of four primers for 30 cycles (Fig. 1b) . As expected, the amount of amplified 317-bp product increased with increasing copy number of IS6110 . In contrast, the amount of amplified 576-bp product decreased with the increase in the copy number of 156110, although the starting amount of the gro EL target was constant in each of the samples . DNA from pure cultures of four M . tuberculosis isolates, three M. bovis isolates, and three M . bovis BCG isolates were amplified using the set of four primers. Each of the M . tuberculosis strains produced a strong 317-bp product and no visible 576-bp product (e .g ., Fig . 2, lane 2) . Each of the M. bovis and M . bovis BCG strains produced both the 317-bp and 576bp product in roughly equal amounts (e .g ., Fig. 2, lanes 4-7) . Furthermore, DNA isolated directly from four sputum specimens known to contain M . tuberculosis generated a strong 317-bp band and no 576bp band (e .g ., Fig . 2, lane 3) . Two other members of the tuberculosis complex, M . microti and M . africanum, also carry 1S6110 . Each pair of primers, when used alone, efficiently amplified
the expected products from each species (data not shown) . The products amplified by the set of four primers from the M . microti isolate (Fig . 2, lane 9) resembled those of M . tuberculosis, thus suggesting that M . microti carries > 10 copies of IS6110 . On the other hand, the products amplified by the set of four primers from the M . africanum isolate were intermediate between those of M . tuberculosis and M . bovis (Fig. 2, lane 8) . This result suggests that M. africanum TMC5122 carries six to nine copies of IS6110 (i .e., compare Fig. lb and Fig . 2, lane 8) . Neither the 317-bp or the 576-bp product was amplified from other species of Mycobacterium, including M . avium, M . intracellulare, M . scrofulaceum, M . gordonae, M . leprae, M. kansasii, or M . fortuitum (data not shown) .
DISCUSSION AND CONCLUSIONS Although the amplification of the 317-bp piece of the IS6110 target was as expected for all samples, the extent of the amplification of the gro EL target in the assays using the mixture of four primers was less than
218
B . B. Plikaytis et al .
Fig. 2 . Amplification of DNA from Mycobacterium species using the set of four primers . Samples were amplified for 30 cycles using a mixture of primers TB15+TB19+ IS41 + 1543 . Lane 2, M. tuberculosis Clinical T12 ; lane 3, M . tuberculosis sputum specimen 1049 ; lane 4, M . bovis TMC401 ; lane 5, M. bovis TMC410 ; lane 6, M . bovis BCG (Glaxo) ; lane 7, M . bovis BCG (TMC1013); lane 8, M . africanum TMC5122 ; lane 9, M. microti TMC1619. Lane 1 contains pBR322-Hin Fl fragments .
expected, particularly for the samples containing > 5 copies of IS6110 per copy of gro EL . This is not a simple interaction of the primers, since in the absence of a IS6110 target (i .e ., amplification from an Escherichia coli plasmid carrying the gro EL gene), the extent of amplification the gro EL target by a mixture of the four primers was identical to that by TB15+TB19 alone (data not shown) . Also, we have observed similar inhibition of amplification of the gro EL product when using combinations of two other primer pairs for the gro EL target and one other
encountered in the clinical laboratory . An important additional consideration is that the assay is based on a difference in the copy numbers of 156110 in the genomes of M. tuberculosis and M . bovis . Although
primer pair for the IS6110 target. One possible explanation for these observations is that the results reflect competition for the Taq polymerase or for deoxynucleoside triphosphates . Perhaps, the PCR reaction reaches the plateau phase of amplification before the gro EL product reaches a detectable level . The kinetics of the polymerase chain reaction during the initial rounds of the amplification process may also favour replication of the repetitive element . The assay described here can clearly distinguish M . tuberculosis strains from M . bovis strains . One limitation is that M . tuberculosis strains are not distinguished from M . microti strains, nor are M. africanum strains easily distinguished from M. bovis strains . However, M . microti and M . africanum are rarely
strain . Despite these limitations, this PCR-based assay should be useful for rapidly distinguishing the most commonly encountered Mycobacterium species that
to date all well-characterized M . tuberculosis isolates carry >10 copies of IS6110 and M. bovis isolates, particularly BCG strains, carry
(1991) 5, 215-219
Differentiation of Mycobacterium tuberculosis and Mycobacterium bovis BCG by a polymerase chain reaction
assay Bonnie B . Plikaytis,' Kathleen D . Eisenach 2 Jack T . Crawford' and Thomas M . Shinnick'* 'Division of Bacterial Diseases, Center for Infectious Diseases, Centers for Disease Control, Atlanta GA 30333, and 2Medical Research Service, McClellan Memorial Veterans Hospital, Little Rock AR 72205, USA (Received 19 September 1990, Accepted 18 December 1990)
Mycobacterium tuberculosis and Mycobacterium bovis are closely related species which carry different numbers of the repetitive DNA element IS6110 . A polymerase chain reaction assay was developed to assess the copy number of IS6110 in a strain and thereby differentiate these two important human pathogens .
KEYWORDS: mycobacteria, polymerase chain reaction, repetitive DNA .
INTRODUCTION and Mycobacterium bovis are important pathogens of humans and animals . Also, the M . bovis strain BCG is widely used as a vaccine to prevent tuberculosis. The currently used procedures for distinguishing these closely related
the species, the PCR amplification of a portion of the IS6110 element is compared to the amplification of a portion of the single copy gene, gro EL . (The gro EL gene was chosen because the nucleotide sequences of the M . tuberculosis and M . bovis gro EL genes are identical .)' ,' The key advantage of this approach is
Mycobacterium tuberculosis
species involve biochemical tests, such as niacin accumulation or nitrate reductase activity, and take at least 3-4 weeks from the time of specimen collection to identify the species .' We report here a rapid procedure for distinguishing M . bovis and M . tuberculosis strains . The procedure takes advantage of the observations that (1) M . tuberculosis strains carry 1015 copies of a repetitive DNA element (IS6110), (2) M . bovis strains carry only one to two copies of it, and (3) portions of the 156110 element can be efficiently amplified by the polymerase chain reaction (PCR) from both species ." To estimate the number of copies of IS6110 per genome, and hence to identify
that, by using PCR, one does not need to culture the organism, so that the entire assay can be completed in less than 8 h after specimen collection .
MATERIALS AND METHODS Mycobacterial strains The strains used in these studies are listed in Table 1 and were obtained from the stock culture collections of the Centers for Disease Control (CDC) or the
*Author to whom correspondence should be addressed . 0890-8508/91/030215 + 05 $03 .00/0
215
© 1991 Academic Press Limited
216 Table 1 .
B. B . Plikaytis Mycobacterial strains used in this study
M. tuberculosis"
M . bovis
M . microti
H37Ra Clinical T5 Clinical T6 Clinical T12 Clinical 1048
TMC401 TMC410 TMC602 BCG (TMC1013) BCG Glaxo (TMC1024) BCG-Rosenthal
TMC1619
Clinical 1049 Clinical 1053 Clinical 1055
M . africanum
TMC5122
* Clinical isolates T5, T6, and T12 were grown and DNA purified on CsCI gradients as previously described .' DNA was directly purified from sputum samples for clinical specimens 1048, 1049, 1053, and 1055 .
et al .
reaction mix containing 200 µM of each deoxynucleoside triphosphate, 0. 5 µM each of primers IS41 and 1543 and/or 1 . 0 µM each of primers TB15 and TB19, 2 . 5 units of Taq polymerase, 10 mm Tris-HCI (pH 8 . 3), 50 mm KCI, 1 . 5 mm MgCl2, and 0 .01 % gelatin as recommended by the GeneAmp Kit manufacturer (Perkin-Elmer Cetus, Norwalk, CT) . The amplifications were carried out in a Programmable Thermal Controller (MJ Research, Watertown, MA) in a two-step cycle of 75 s at 94 ° C followed by 3 min at 68 ° C. The amplification products were separated on 6% polyacrylamide-Tris-Borate-EDTA gels and visualized by ethidium bromide fluorescence .
RESULTS McClellan Memorial Veterans Hospital . Clinical isolates and specimens were obtained from the McClellan Memorial Veterans Hospital . Oligonucleotide primers Primers were synthesized on a DNA synthesizer (Model 381A, Applied Biosystems, Foster City, CA) using R-cyanoethyl phosphoramidite chemistry . The sequences and locations of the primers are shown in Table 2 . Preparation of DNA DNA was isolated from M . tuberculosis and M . bovis strains and was purified on CsCl gradients as previously described .' Sputum specimens were concentrated using the standard NALC-NaOH method . The sediment was treated with lysozyme and boiled in NaOH-SDS to lyse the bacilli . The DNA was recovered using the Gene Clean technique (K . Eisenach, M . Sifford, M. Cave, J . Bates, and J . Crawford, submitted for publication) . Crude lysates of some of the strains were prepared by homogenization in the presence of 0 . 1-mm glass beads and used directly in the PCR assays as previously described .' Polymerase chain reaction The template DNA in 5 µl H 2 O was added to 45 gl of Table 2. Primer TB15 TB19 IS41 1543
Approximately equal amounts of the 576-basepair piece of the gro EL gene were produced when 2 ng of M. tuberculosis genomic DNA or 2 ng of M . bovis BCG genomic DNA were amplified with primers TB15+TB19 for 30 cycles (Fig . la, lanes 2 and 3). A greater amount of the 317-bp piece of IS6110 was amplified by primers IS41+IS43 in 30 cycles from 2 ng of M . tuberculosis genomic DNA (Fig . la, lane 6) than from 2 ng of M . bovis BCG genomic DNA (Fig . la, lane 7), as is expected from the copy number of IS6110 . Both the 576-bp piece of the gro EL gene and 317-bp piece of IS6110 were produced when 2 ng of M . bovis BCG genomic DNA was amplified with a mixture of the four primers TB15 + TB19 + IS41 + IS43 for 30 cycles (Fig. la, lane 5) . However, the amount of the 576-bp gro EL product produced was somewhat less than expected (i .e., compare lanes 3 and 5, Fig. 1a) . In contrast, when 2 ng M . tuberculosis genomic DNA was amplified using the set of four primers for 30 cycles (Fig . la, lane 4), the 317-bp IS6110 target was efficiently amplified, but the 576-bp gro EL target was not amplified to a detectable level . The 576-bp piece is in fact amplified, but the amount produced is 10- to 20-fold less than expected from the amplification by primers TB15+TB19 alone (data not shown) . The influence of the relative copy number of the 156110 and gro EL targets on amplification of the 576bp and 317-bp products was further assessed by
Oligonucleotide primers used in this study Target
Sequence (5'-3')
Location°
gro EL EL 156110 IS6110
CATCTCGCCCCCACCGGGAA CTGGCCCAGATCCCCCAG CCTGCGAGCGTACGCGTCGG TCAGCCGCGTCCACGCCGCCA
1856-1837c 1281-1298 884-865c 568-588
gro
* The numbering of the residues of the gro EL gene is as reference 4. The numbering of the residues of as described by reference 8. A 'c' indicates the listed sequence is the complement of the published sequence . 156110 is
Multiplex PCR for M . bovis and M. tuberculosis
21 7
576 by -
317 by -3
Fig. 1 . (a) Amplification of the gro EL and 156110 targets from M . tuberculosis and M. bovis strains . Two nanograms of CsCI-purified M. tuberculosis genomic DNA was amplified for 30 cycles with primers TB15+TB19 (lane 2), primers TB15+TB19+IS41 +1543 (lane 4), and IS41 +IS43 (lane 6) . Two nanograms of CsCl-purified M . bovis BCG-Rosenthal genomic DNA was amplified for 30 cycles with primers TB15+TB19 (lane 3), primers TB15+TB19+1541 +IS43 (lane 5), and IS41 +IS43 (lane 7) . Lane 1 contains pBR322-Hin FI fragments . (b) Effect of copy number on amplification . CsCl-purified DNAs of M . tuberculosis and M . bovis BCG-Rosenthal were mixed to give ratios of the 156110 target to the gro EL target of 9 :1 (lane 3), 6 :1 (lane 4), 4 :1 (lane 5), and 2 :1 (lane 6) . Lane 2 represents a 12:1 ratio (M. tuberculosis) and lane 7 represents a 1 :1 ratio (M . bovis BCG-Rosenthal) . For each sample, 2 ng of DNA was amplified for 30 cycles using the set of four primers . Lane 1 contains pBR322-Hin FI fragments .
mixing M . tuberculosis and M . bovis BCG genomic DNAs in various ratios and then amplifying 2 ng of each mixture with the set of four primers for 30 cycles (Fig. 1b) . As expected, the amount of amplified 317-bp product increased with increasing copy number of IS6110 . In contrast, the amount of amplified 576-bp product decreased with the increase in the copy number of 156110, although the starting amount of the gro EL target was constant in each of the samples . DNA from pure cultures of four M . tuberculosis isolates, three M. bovis isolates, and three M . bovis BCG isolates were amplified using the set of four primers. Each of the M . tuberculosis strains produced a strong 317-bp product and no visible 576-bp product (e .g ., Fig . 2, lane 2) . Each of the M. bovis and M . bovis BCG strains produced both the 317-bp and 576bp product in roughly equal amounts (e .g ., Fig. 2, lanes 4-7) . Furthermore, DNA isolated directly from four sputum specimens known to contain M . tuberculosis generated a strong 317-bp band and no 576bp band (e .g ., Fig . 2, lane 3) . Two other members of the tuberculosis complex, M . microti and M . africanum, also carry 1S6110 . Each pair of primers, when used alone, efficiently amplified
the expected products from each species (data not shown) . The products amplified by the set of four primers from the M . microti isolate (Fig . 2, lane 9) resembled those of M . tuberculosis, thus suggesting that M . microti carries > 10 copies of IS6110 . On the other hand, the products amplified by the set of four primers from the M . africanum isolate were intermediate between those of M . tuberculosis and M . bovis (Fig. 2, lane 8) . This result suggests that M. africanum TMC5122 carries six to nine copies of IS6110 (i .e., compare Fig. lb and Fig . 2, lane 8) . Neither the 317-bp or the 576-bp product was amplified from other species of Mycobacterium, including M . avium, M . intracellulare, M . scrofulaceum, M . gordonae, M . leprae, M. kansasii, or M . fortuitum (data not shown) .
DISCUSSION AND CONCLUSIONS Although the amplification of the 317-bp piece of the IS6110 target was as expected for all samples, the extent of the amplification of the gro EL target in the assays using the mixture of four primers was less than
218
B . B. Plikaytis et al .
Fig. 2 . Amplification of DNA from Mycobacterium species using the set of four primers . Samples were amplified for 30 cycles using a mixture of primers TB15+TB19+ IS41 + 1543 . Lane 2, M. tuberculosis Clinical T12 ; lane 3, M . tuberculosis sputum specimen 1049 ; lane 4, M . bovis TMC401 ; lane 5, M. bovis TMC410 ; lane 6, M . bovis BCG (Glaxo) ; lane 7, M . bovis BCG (TMC1013); lane 8, M . africanum TMC5122 ; lane 9, M. microti TMC1619. Lane 1 contains pBR322-Hin Fl fragments .
expected, particularly for the samples containing > 5 copies of IS6110 per copy of gro EL . This is not a simple interaction of the primers, since in the absence of a IS6110 target (i .e ., amplification from an Escherichia coli plasmid carrying the gro EL gene), the extent of amplification the gro EL target by a mixture of the four primers was identical to that by TB15+TB19 alone (data not shown) . Also, we have observed similar inhibition of amplification of the gro EL product when using combinations of two other primer pairs for the gro EL target and one other
encountered in the clinical laboratory . An important additional consideration is that the assay is based on a difference in the copy numbers of 156110 in the genomes of M. tuberculosis and M . bovis . Although
primer pair for the IS6110 target. One possible explanation for these observations is that the results reflect competition for the Taq polymerase or for deoxynucleoside triphosphates . Perhaps, the PCR reaction reaches the plateau phase of amplification before the gro EL product reaches a detectable level . The kinetics of the polymerase chain reaction during the initial rounds of the amplification process may also favour replication of the repetitive element . The assay described here can clearly distinguish M . tuberculosis strains from M . bovis strains . One limitation is that M . tuberculosis strains are not distinguished from M . microti strains, nor are M. africanum strains easily distinguished from M. bovis strains . However, M . microti and M . africanum are rarely
strain . Despite these limitations, this PCR-based assay should be useful for rapidly distinguishing the most commonly encountered Mycobacterium species that
to date all well-characterized M . tuberculosis isolates carry >10 copies of IS6110 and M. bovis isolates, particularly BCG strains, carry
