Molecular and Cellular Probes (1990) 4, 205-210
Specific identification of Mycobacterium leprae by the polyrnerase chain reaction
C . Hackel ; S. Houard, F. Portaels,2 A. van Eisen, A. Herzog and A. Bollen* Service for Applied Genetics, Université Libre de Bruxelles, rue de l'Industrie 24, B-1400 Nivelles, Belgium, 'Departamento de Genética Médica, Facultade de Ciencias Médicas, Universidade Estadual de Campinas, Caixa Postal 6111, 13100 Campinas, SP Brazil and 2 Department of Microbiology, Institute of Tropical Medicine, Nationalestraat 155, B-2018 Antwerp, Belgium
(Received 1 December 1989, Accepted 8 December 1989)
Oligonucleotide primers have been used to amplify DNA regions of the M . leprae genome by the polymerase chain reaction . A first set of primers, PLp1 and PLp2, identifies a specific 386 by DNA fragment located in the gene coding for the 65 kDa antigen of M. leprae. A second pair of primers, targetted to the same gene, leads to the amplification of a 154 by DNA piece conserved in mycobacteria . Primers PLp1 and PLp2 discriminate the pathogenic species from other mycobacteria, detect down to 40 bacilli, and constitute potentially useful tools for the identification of M . leprae in clinical specimens.
KEYWORDS : Mycobacterium leprae, DNA, polymerase chain reaction, enzymatic amplification, diagnosis .
INTRODUCTION Leprosy is a chronic infectious disease which still affects millions of people worldwide . Its etiological agent, Mycobacterium leprae, remains one of the few human pathogens which cannot be cultivated in vitro . The wide spectrum of clinical manifestations, together with the long incubation period of the disease, have hampered quick and reliable diagnosis of infections, especially in undeterminate and tuberculoid forms of leprosy .' Efforts have been concentrated on the development of DNA probes to discriminate the highly pathogenic Mycobacterium leprae from related mycobacterial species . 2.3 In this context, we report here the use of oligonucleotides to amplify DNA of M . leprae by means of the polymerase chain reaction . 4 We show that the assay is *Author to whom correspondence should be addressed .
0890-8508/90/030205+06 $03 .00/0
© 1990 Academic Press Limited 205
C . Hackel et al.
206
specific for this pathogen, that it detects low levels of infectious organisms and thus constitutes a useful tool for epidemiological and clinical studies of leprosy .
MATERIALS AND METHODS Twenty different mycobacterial species were used in this work (Table 1) . Sixteen of them were isolated by one of us (F . Portaels) as described previously' from tissues (liver, spleen and lymphonodes) of armadillos (Dasypus novemcinctus) naturally infected with M . leprae . Other strains derive from human sputum (M . tuberculosis) or are reference strains (M . avium ATCC 252g1 ; M . bovis-BCG Pasteur GL2 ; M . smegmatis 607 Montreal and M . fortuitum CIPT 14-0410-0002) . Mycobacterium leprae was extracted from infected tissues using the WHO protocol 1/79 .6 Cultivable species of mycobacteria were grown on Lowenstein-Jensen or Ogawa egg yolk medium . All the mycobacteria were resuspended in water and heatinactivated for 30 min at 75°C before use . Mycobacterial DNA was isolated from cells resuspended in 250 mm EDTA pH 7 . 0 containing 0-1 0/o Tween 80 and 4% sodium dodecyl sulphate . After an overnight incubation at 50 ° C, the lysate was twice extracted with an equal volume of phenol followed by three extractions with ether . The aqueous phase was then desalted on a Sephadex G50 column in deionized water . Fractions containing DNA were pooled and concentrations were estimated by comparing, on 1 0/o agarose gels, intensities
Table 1 .
Mycobacterial species
Species M . leprae M . tuberculosis M . terrae M . marinum M . gordonae M . chelonae M . malmoense M . scrofulaceum M . nonchromogenicum M . shimodei MAIS complex* 3 MAIS complex* 4 MAIS complex* 5 MAIS complex* 6 MAIS complex* 7 MAIS complex* 8 M . avium M . fortuitum varfortuitum M. bovis-BCG M . smegmatis
Strain
3013 1070 1725 2195 2277 1735 1734 1733 1193 1722 2265 2191 1722 2192 2264 ATCC 252g1 CIPT 14-0410-0002 Pasteur GL2 607 Montreal
Source
Source/Origin
Armadillo isolate Human sputum Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate
/F. Portaels /F. Portaels /F. Portaels /F . Portaels /F. Portaels /F. Portaels /F . Portaels /F. Portaels /F. Portaels /F . Portaels /F. Portaels /F . Portaels /F. Portaels /F. Portaels /F . Portaels /F. Portaels ATCCt CIPTI CIPT$
*M . avium-intracellulare-scrofulaceum complex . tAmerican type culture collection . $Collection Institut Pasteur.
Detection of Mycobacterium leprae
207
of DNA bands with those of standard amounts of reference DNA stained with ethidium bromide. Control DNAs were purified from an uninfected armadillo, human peripheral blood and Escherichia coli according to standard protocols .' Plasmid pIL161 was provided by Dr Lamb and Dr Colston (National Institute for Medical Research, London, England) and was used as a positive control in all experiments ; it carries a 3 . 3 kbase DNA fragment encoding the complete sequence of the 65-kDa-antigen of M . leprae inserted in pUC8 . DNA amplifications follow the protocol described in Houard et al .' with the following modification . In the first cycle of amplification, samples were heated to 94°C for 3 min, then cooled to 60°C for 90 s and heated to 70°C for 3 min . For the following 29 cycles, samples were heated to 94°C for 60 s, cooled to 60 ° C for 60 s and heated to 70°C for 2 min . In the last cycle, samples were maintained at 70°C for 7 min . Protocols for the analysis of reaction products on agarose gels, for filter hybridizations and for the synthesis of probes and primers have been described earlier .'
RESULTS AND DISCUSSION The choice of the selective primers and probe for M . leprae was made by comparing the DNA sequence of the gene encoding the 65 kDa-antigen of M. leprae 9 with similar regions of M . tuberculosis, M . bovis-BCG, C . burnetti and l0-13 E . coli . A first primer of amplification, PLp1, spans bases 2535 to 2558; the second primer, PLp2, spans bases 2899 to 2920 . Both primers define a 386 by fragment . The selective probe, PL, was chosen between the two primers, from base 2655 to 2679 (Table 2) . Table 2.
Primers and probes for the amplification of Mycobacterium leprae DNA by PCR
Oligonucleotide Sequence (5'--*3')
Length (bases)
Position and orientation on DNA sequence*
Td(° C)t
Mehra et al . (1986) 9 (Fig . 1, p . 705)
Specific sequences of the 65 kDa-antigen gene
PLp1 PLp2 PLprobe
TGCACGGTATAACTATTCGCACCT GCAGGTTAGAGTAGGCTGAGGC AGTATCGTGTTAGTGAACAGTGCAT
24 22 25
2535-+2558 2899+-2920 2655->2679
70° 70° 70°
Conserved sequences of the 65 kDa-antigen gene
PMp1 PMp2
GTCGCGGCCTCGAGCGGCGCTTGAA TCGCCAAGGAGATCGAGCTGAAGAA
Reference
Mehra et al . (1986)' (Fig . 1, p . 705) 25 25
241-+265 370i--394
86 ° 86°
*Arrows indicate orientation of the oligonucleotides . tTd(°C) : melting temperature for the oligonucleotides .
C . Hackel et al.
208
386 bp 154 bp
386 bp 15~ bp
15 16 17 18 19 20 21 22 23 2425 26 27 28
15 16 17 18 19 20 21 22 23 24 25 26 27 28
Fig. 1 . Specific amplification of Mycobacterium leprae DNA using primers PLp1 and PLp2 . PCR assays were performed as described in Materials and Methods ; one fifth of the amplification mixture was resolved onto agarose gels . Amplification of the common mycobacterial DNA sequence was performed with primers PMp1 and PMp2. The range of DNA concentrations from cultivable species of mycobacteria varied between 100 and 500 ng per reaction sample . (a) Visualization of amplified products with ethidium bromide . Lanes 1 and 15 molecular weight marker, 123 by ladder (Gibco-BRL) ; lane 2 - complete assay system without template ; lane 3 - purified human genomic DNA; lane 4 - purified armadillo genomic DNA ; lane 5 - M . leprae; lane 6 - M. tuberculosis; lane 7 - M . bovis-BCG; lane 8 - M . terrae; lane 9 - M . marinum ; lane 10 - M . gordonae; lane 11 - M . chelonae; lane 12 - M. malmoense ; lane 13 - M. avium; lane 14 M . scrofulaceum ; lane 16 - MAIS complex 3; lane 17 - MAIS complex 4; lane 18 - MAIS complex 5 ; lane 19 - MAIS complex 6; lane 20 - MAIS complex 7 ; lane 21 - MAIS complex 8; lane 22 - M . nonchromogenicum ; lane 23 - M. shimodei; lane 24 - M . fortuitum; lane 25 - M . smegmatis; lane 26 positive control pIL161; lane 27 - E. coli; lane 28 - herring sperm DNA . Primers in excess appear on the gel as mono- or multimers . (b) Hybridization of the amplified products with the labelled PL probe . DNA resolved on agarose gels was transferred onto nylon membranes and hybridized with probe PL . Lane occupancy is as above. Arrows point to the 386 by and 154 by amplification products .
The mycobacterial common amplification primers were selected by comparison of the homologous regions of the 65 kDa-antigen gene of M . leprae, M . tuberculosis and M. bovis-BCG . The 'common' primers, PMp1 and PMp2, are located between bases 241 and 394 of the 65 kDa-antigen gene of M. leprae and define a 154 by segment . In order to verify the specificity of the primers PLp1 and PLp2 for amplification of M. leprae DNA, polymerase chain reaction (PCR) assays were run on 20 mycobacterial species . As seen in Fig . la, the expected amplified 386 by DNA fragment was detected on 4% NuSieve agarose gels only in the M. leprae DNA and in the positive control, pIL161 . All other mycobacterial species were negative for this fragment as well as the negative controls . The amplification of the non-specific 154 by fragment was detected in all mycobacteria so far tested, thus providing a positive internal control for the reaction . To confirm the specificity of the amplification reaction, the amplified DNA was transferred from the NuSieve agarose gel onto nylon filters and then hybridized with
Detection of Mycobacterium leprae 1
4
5
2 09
10
II
12
386 bp
154 :bp
Fig. 2.
Detection threshold of M . leprae using amplification primers PLp1 and PLp2 . A stock sample of M. leprae cells (2 x 10' bacilli ml - ') was serially diluted (10- ' to 10 -8 ) and 20 pl aliquots were assayed by PCR . Lanes 1 and 12-molecular weight markers, 123 by ladder ; lanes 2 to 9 :10 - e to 10 - ' dilutions; M . leprae cells ranging from 2 x 10 -' to 2 x 106 bacilli ml - ' (10 fold increase in each lane) ; lane 10: 2 x 10 6 M. leprae cells ml - ' with both sets of primers (PLp1/PLp2 ; PMp1/PMp2); lane 11-complete
system without template .
the 32 P-labelled PL probe . Figure lb shows that only M . leprae DNA and plasmid plL161 score positive in the hybridization assay . The detection level of the PCR assay was estimated by performing amplification reactions on controlled numbers of cells . A stock sample of M . leprae was serially diluted in water ; the range of dilutions spanned from 10 -1 to 10 -8; 20µl aliquots, heated at 95°C for 15 min then cooled on ice, 14 were assayed for amplification using primers PLp1 and PLp2 . Amplified products were resolved on NuSieve agarose gels and visualized with ethidium bromide under u .v . light . As seen in Fig . 2, the sample corresponding to the 10 -4 dilution still displayed the expected 386 by DNA fragment . These results were confirmed after hybridization with the specific PL probe (not shown) . The number of M . leprae cells in the stock sample has been estimated at 2 x 10' bacilli ml -1 by counting ." ," On this basis, the PCR system thus detects M . leprae in 20-µt reaction samples containing about 40 mycobacteria . From these experiments, it appears that the specific amplification of mycobacterial DNA constitutes a promising technique for the rapid detection and identification of these bacteria in clinical samples . Moreover, from an epidemiological point of view, the development of specific and sensitive methods able to discriminate M . leprae from other mycobacteria colonizing human skin 17 '1 S could facilitate the early and accurate detection of household contacts of lepromatous leprosy patients and reveal the presence of M . leprae in paucibacillary forms of leprosy .
ACKNOWLEDGEMENTS We thank Dr I. Lamb and Dr J . C . Colston for providing the plasmid piL161 . We also thank K . De Ridder and K . Fissette for technical assistance . C . H . holds a grant from the Brazilian Government (CAPES, Ministério de Educaçao e Cultura) .
REFERENCES 1 . World Health Organization (1988) WHO Expert Committee on Leprosy : 6th Report . Technical Report Series, no . 768 . Geneva . 2 . Clark-Curtiss, J . E . & Docherty, M . A . (1989). A species-specific repetitive sequence in Mycobacterium leprae
DNA . Journal
Infectious Disease 159,
7-15 .
210
C. Hackel et al.
3 . Hartskeerl, R. A ., de Wit, M . Y . L. & Klatser, P . R . (1989). Polymerase chain reaction for the detection of Mycobacterium leprae . Journal of General Microbiology 135, 2357-64 . 4. Saiki, R . K ., Gelfand, D . H., Stoffel, S ., Scharf, S . J ., Higuchi, R ., Horn, G . T . et al. (1988) . Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase . Science 239, 48791 . 5. Portaels, F ., Walsh, G. P ., De Ridder, K ., Malaty, R ., Meyers, W . M . & Binford, Ch. (1987) . Cultivable mycobacteria isolated from 32 newly captured wild armadillos (Dasypus novemcinctus) from Louisiana . Twenty-second Joint US-Japan Leprosy Research Conference, National Institute of Health, Bethesda, Maryland, USA . 6 . World Health Organization (1980) . WHO Special Programme for Research and Training in Tropical Diseases . Report of the 5th Meeting of the Scientific Working Group on the Immunology of Leprosy (IMMLEP) . TDR/IMMLEP-SWG (5)/80 .3 Annex 4, p . 23, Geneva. 7 . Ausubel, F . M ., Brent, R., Kingston, R. E., Moore, D . D ., Smith, J . A., Seidman, J . G . & Struhl, K . (eds) (1987) . Preparation and analysis of DNA . In Current Protocols in Molecular Biology New York : John Wiley and Sons . 8 . Houard, S ., Hackel, C ., Herzog, A . & Bollen, A. (1989) . Specific identification of Bordetella pertussis by the polymerase chain reaction . Research in Microbiology 140, 477-87. 9 . Mehra, V ., Sweetser, D . & Young, R . A . (1986) . Efficient mapping of protein antigenic determinants . Proceedings of the National Academy Sciences USA 83, 7013-17 . 10 . Shinnick, T . M . (1987) . The 65-Kilodalton antigen of Mycobacterium tuberculosis . Journal of Bacteriology 169, 1080-8 . 11 . Thole, J . E. R ., Keulen, W . J ., Kolk, A. H . J., Groothuis, D . G ., Berwald, L . G ., Tiesjema, R . H . & van Embden, J . D . A. (1987) . Characterization, sequence determination, and immunogenicity of a 64Kilodalton protein of Mycobacterium bovis BCG expressed in Escherichia coli K-12 . Infectious Immunity 55, 1466-75 . 12 . Vodkin, M. H . & Williams, J . C. (1988) . A heat shock operon in Coxiella burneti produces a major antigen homologous to a protein in both mycobacteria and Escherichia coli. Journal of Bacteriology 170, 1227-34 . 13 . Chanda, P . K ., Ono, M., Kuwano, M . & Kung, H . F. (1985) . Cloning, sequence analysis, and expression of alteration of the mRNA stability gene (ams+) of Escherichia coli . Journal of Bacteriology 161, 446-9. 14 . Woods, S . (1989) . Detection of Mycobacterium leprae by the polymerase chain reaction . First International Symposium on Molecular Biology of the Mycobacteria, Guildford, Surrey, U .K . (7-9 September 1989) . 15 . Shepard, C. C . & McRae, D . H . (1965) . Mycobacterium leprae : viability at 0 ° C, 31°C and during freezing . International journal of Leprosy 33, 316-23 . 16 . Shepard, C . C. & McRae, D . H . (1968) . A method for counting acid-fast bacteria . International Journal of Leprosy 36, 78-82. 17 . Salem, J . I ., Gadelha, A . R ., Maroja, F . & David, H . L . (1989). Non-cultivable mycobacteria in ulcers of the skin . Acta Leprologica 7 (Suppl . 1), 10-15. 18. Salem, J . I ., Gontijo Filho, P., Lévy-Frébault, V . & David, H . L. (1989) . Isolation and characterization of mycobacteria colonizing the healthy skin . Acta Leprologica 7 (Suppl . 1), 18-20 .
Specific identification of Mycobacterium leprae by the polyrnerase chain reaction
C . Hackel ; S. Houard, F. Portaels,2 A. van Eisen, A. Herzog and A. Bollen* Service for Applied Genetics, Université Libre de Bruxelles, rue de l'Industrie 24, B-1400 Nivelles, Belgium, 'Departamento de Genética Médica, Facultade de Ciencias Médicas, Universidade Estadual de Campinas, Caixa Postal 6111, 13100 Campinas, SP Brazil and 2 Department of Microbiology, Institute of Tropical Medicine, Nationalestraat 155, B-2018 Antwerp, Belgium
(Received 1 December 1989, Accepted 8 December 1989)
Oligonucleotide primers have been used to amplify DNA regions of the M . leprae genome by the polymerase chain reaction . A first set of primers, PLp1 and PLp2, identifies a specific 386 by DNA fragment located in the gene coding for the 65 kDa antigen of M. leprae. A second pair of primers, targetted to the same gene, leads to the amplification of a 154 by DNA piece conserved in mycobacteria . Primers PLp1 and PLp2 discriminate the pathogenic species from other mycobacteria, detect down to 40 bacilli, and constitute potentially useful tools for the identification of M . leprae in clinical specimens.
KEYWORDS : Mycobacterium leprae, DNA, polymerase chain reaction, enzymatic amplification, diagnosis .
INTRODUCTION Leprosy is a chronic infectious disease which still affects millions of people worldwide . Its etiological agent, Mycobacterium leprae, remains one of the few human pathogens which cannot be cultivated in vitro . The wide spectrum of clinical manifestations, together with the long incubation period of the disease, have hampered quick and reliable diagnosis of infections, especially in undeterminate and tuberculoid forms of leprosy .' Efforts have been concentrated on the development of DNA probes to discriminate the highly pathogenic Mycobacterium leprae from related mycobacterial species . 2.3 In this context, we report here the use of oligonucleotides to amplify DNA of M . leprae by means of the polymerase chain reaction . 4 We show that the assay is *Author to whom correspondence should be addressed .
0890-8508/90/030205+06 $03 .00/0
© 1990 Academic Press Limited 205
C . Hackel et al.
206
specific for this pathogen, that it detects low levels of infectious organisms and thus constitutes a useful tool for epidemiological and clinical studies of leprosy .
MATERIALS AND METHODS Twenty different mycobacterial species were used in this work (Table 1) . Sixteen of them were isolated by one of us (F . Portaels) as described previously' from tissues (liver, spleen and lymphonodes) of armadillos (Dasypus novemcinctus) naturally infected with M . leprae . Other strains derive from human sputum (M . tuberculosis) or are reference strains (M . avium ATCC 252g1 ; M . bovis-BCG Pasteur GL2 ; M . smegmatis 607 Montreal and M . fortuitum CIPT 14-0410-0002) . Mycobacterium leprae was extracted from infected tissues using the WHO protocol 1/79 .6 Cultivable species of mycobacteria were grown on Lowenstein-Jensen or Ogawa egg yolk medium . All the mycobacteria were resuspended in water and heatinactivated for 30 min at 75°C before use . Mycobacterial DNA was isolated from cells resuspended in 250 mm EDTA pH 7 . 0 containing 0-1 0/o Tween 80 and 4% sodium dodecyl sulphate . After an overnight incubation at 50 ° C, the lysate was twice extracted with an equal volume of phenol followed by three extractions with ether . The aqueous phase was then desalted on a Sephadex G50 column in deionized water . Fractions containing DNA were pooled and concentrations were estimated by comparing, on 1 0/o agarose gels, intensities
Table 1 .
Mycobacterial species
Species M . leprae M . tuberculosis M . terrae M . marinum M . gordonae M . chelonae M . malmoense M . scrofulaceum M . nonchromogenicum M . shimodei MAIS complex* 3 MAIS complex* 4 MAIS complex* 5 MAIS complex* 6 MAIS complex* 7 MAIS complex* 8 M . avium M . fortuitum varfortuitum M. bovis-BCG M . smegmatis
Strain
3013 1070 1725 2195 2277 1735 1734 1733 1193 1722 2265 2191 1722 2192 2264 ATCC 252g1 CIPT 14-0410-0002 Pasteur GL2 607 Montreal
Source
Source/Origin
Armadillo isolate Human sputum Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate Armadillo isolate
/F. Portaels /F. Portaels /F. Portaels /F . Portaels /F. Portaels /F. Portaels /F . Portaels /F. Portaels /F. Portaels /F . Portaels /F. Portaels /F . Portaels /F. Portaels /F. Portaels /F . Portaels /F. Portaels ATCCt CIPTI CIPT$
*M . avium-intracellulare-scrofulaceum complex . tAmerican type culture collection . $Collection Institut Pasteur.
Detection of Mycobacterium leprae
207
of DNA bands with those of standard amounts of reference DNA stained with ethidium bromide. Control DNAs were purified from an uninfected armadillo, human peripheral blood and Escherichia coli according to standard protocols .' Plasmid pIL161 was provided by Dr Lamb and Dr Colston (National Institute for Medical Research, London, England) and was used as a positive control in all experiments ; it carries a 3 . 3 kbase DNA fragment encoding the complete sequence of the 65-kDa-antigen of M . leprae inserted in pUC8 . DNA amplifications follow the protocol described in Houard et al .' with the following modification . In the first cycle of amplification, samples were heated to 94°C for 3 min, then cooled to 60°C for 90 s and heated to 70°C for 3 min . For the following 29 cycles, samples were heated to 94°C for 60 s, cooled to 60 ° C for 60 s and heated to 70°C for 2 min . In the last cycle, samples were maintained at 70°C for 7 min . Protocols for the analysis of reaction products on agarose gels, for filter hybridizations and for the synthesis of probes and primers have been described earlier .'
RESULTS AND DISCUSSION The choice of the selective primers and probe for M . leprae was made by comparing the DNA sequence of the gene encoding the 65 kDa-antigen of M. leprae 9 with similar regions of M . tuberculosis, M . bovis-BCG, C . burnetti and l0-13 E . coli . A first primer of amplification, PLp1, spans bases 2535 to 2558; the second primer, PLp2, spans bases 2899 to 2920 . Both primers define a 386 by fragment . The selective probe, PL, was chosen between the two primers, from base 2655 to 2679 (Table 2) . Table 2.
Primers and probes for the amplification of Mycobacterium leprae DNA by PCR
Oligonucleotide Sequence (5'--*3')
Length (bases)
Position and orientation on DNA sequence*
Td(° C)t
Mehra et al . (1986) 9 (Fig . 1, p . 705)
Specific sequences of the 65 kDa-antigen gene
PLp1 PLp2 PLprobe
TGCACGGTATAACTATTCGCACCT GCAGGTTAGAGTAGGCTGAGGC AGTATCGTGTTAGTGAACAGTGCAT
24 22 25
2535-+2558 2899+-2920 2655->2679
70° 70° 70°
Conserved sequences of the 65 kDa-antigen gene
PMp1 PMp2
GTCGCGGCCTCGAGCGGCGCTTGAA TCGCCAAGGAGATCGAGCTGAAGAA
Reference
Mehra et al . (1986)' (Fig . 1, p . 705) 25 25
241-+265 370i--394
86 ° 86°
*Arrows indicate orientation of the oligonucleotides . tTd(°C) : melting temperature for the oligonucleotides .
C . Hackel et al.
208
386 bp 154 bp
386 bp 15~ bp
15 16 17 18 19 20 21 22 23 2425 26 27 28
15 16 17 18 19 20 21 22 23 24 25 26 27 28
Fig. 1 . Specific amplification of Mycobacterium leprae DNA using primers PLp1 and PLp2 . PCR assays were performed as described in Materials and Methods ; one fifth of the amplification mixture was resolved onto agarose gels . Amplification of the common mycobacterial DNA sequence was performed with primers PMp1 and PMp2. The range of DNA concentrations from cultivable species of mycobacteria varied between 100 and 500 ng per reaction sample . (a) Visualization of amplified products with ethidium bromide . Lanes 1 and 15 molecular weight marker, 123 by ladder (Gibco-BRL) ; lane 2 - complete assay system without template ; lane 3 - purified human genomic DNA; lane 4 - purified armadillo genomic DNA ; lane 5 - M . leprae; lane 6 - M. tuberculosis; lane 7 - M . bovis-BCG; lane 8 - M . terrae; lane 9 - M . marinum ; lane 10 - M . gordonae; lane 11 - M . chelonae; lane 12 - M. malmoense ; lane 13 - M. avium; lane 14 M . scrofulaceum ; lane 16 - MAIS complex 3; lane 17 - MAIS complex 4; lane 18 - MAIS complex 5 ; lane 19 - MAIS complex 6; lane 20 - MAIS complex 7 ; lane 21 - MAIS complex 8; lane 22 - M . nonchromogenicum ; lane 23 - M. shimodei; lane 24 - M . fortuitum; lane 25 - M . smegmatis; lane 26 positive control pIL161; lane 27 - E. coli; lane 28 - herring sperm DNA . Primers in excess appear on the gel as mono- or multimers . (b) Hybridization of the amplified products with the labelled PL probe . DNA resolved on agarose gels was transferred onto nylon membranes and hybridized with probe PL . Lane occupancy is as above. Arrows point to the 386 by and 154 by amplification products .
The mycobacterial common amplification primers were selected by comparison of the homologous regions of the 65 kDa-antigen gene of M . leprae, M . tuberculosis and M. bovis-BCG . The 'common' primers, PMp1 and PMp2, are located between bases 241 and 394 of the 65 kDa-antigen gene of M. leprae and define a 154 by segment . In order to verify the specificity of the primers PLp1 and PLp2 for amplification of M. leprae DNA, polymerase chain reaction (PCR) assays were run on 20 mycobacterial species . As seen in Fig . la, the expected amplified 386 by DNA fragment was detected on 4% NuSieve agarose gels only in the M. leprae DNA and in the positive control, pIL161 . All other mycobacterial species were negative for this fragment as well as the negative controls . The amplification of the non-specific 154 by fragment was detected in all mycobacteria so far tested, thus providing a positive internal control for the reaction . To confirm the specificity of the amplification reaction, the amplified DNA was transferred from the NuSieve agarose gel onto nylon filters and then hybridized with
Detection of Mycobacterium leprae 1
4
5
2 09
10
II
12
386 bp
154 :bp
Fig. 2.
Detection threshold of M . leprae using amplification primers PLp1 and PLp2 . A stock sample of M. leprae cells (2 x 10' bacilli ml - ') was serially diluted (10- ' to 10 -8 ) and 20 pl aliquots were assayed by PCR . Lanes 1 and 12-molecular weight markers, 123 by ladder ; lanes 2 to 9 :10 - e to 10 - ' dilutions; M . leprae cells ranging from 2 x 10 -' to 2 x 106 bacilli ml - ' (10 fold increase in each lane) ; lane 10: 2 x 10 6 M. leprae cells ml - ' with both sets of primers (PLp1/PLp2 ; PMp1/PMp2); lane 11-complete
system without template .
the 32 P-labelled PL probe . Figure lb shows that only M . leprae DNA and plasmid plL161 score positive in the hybridization assay . The detection level of the PCR assay was estimated by performing amplification reactions on controlled numbers of cells . A stock sample of M . leprae was serially diluted in water ; the range of dilutions spanned from 10 -1 to 10 -8; 20µl aliquots, heated at 95°C for 15 min then cooled on ice, 14 were assayed for amplification using primers PLp1 and PLp2 . Amplified products were resolved on NuSieve agarose gels and visualized with ethidium bromide under u .v . light . As seen in Fig . 2, the sample corresponding to the 10 -4 dilution still displayed the expected 386 by DNA fragment . These results were confirmed after hybridization with the specific PL probe (not shown) . The number of M . leprae cells in the stock sample has been estimated at 2 x 10' bacilli ml -1 by counting ." ," On this basis, the PCR system thus detects M . leprae in 20-µt reaction samples containing about 40 mycobacteria . From these experiments, it appears that the specific amplification of mycobacterial DNA constitutes a promising technique for the rapid detection and identification of these bacteria in clinical samples . Moreover, from an epidemiological point of view, the development of specific and sensitive methods able to discriminate M . leprae from other mycobacteria colonizing human skin 17 '1 S could facilitate the early and accurate detection of household contacts of lepromatous leprosy patients and reveal the presence of M . leprae in paucibacillary forms of leprosy .
ACKNOWLEDGEMENTS We thank Dr I. Lamb and Dr J . C . Colston for providing the plasmid piL161 . We also thank K . De Ridder and K . Fissette for technical assistance . C . H . holds a grant from the Brazilian Government (CAPES, Ministério de Educaçao e Cultura) .
REFERENCES 1 . World Health Organization (1988) WHO Expert Committee on Leprosy : 6th Report . Technical Report Series, no . 768 . Geneva . 2 . Clark-Curtiss, J . E . & Docherty, M . A . (1989). A species-specific repetitive sequence in Mycobacterium leprae
DNA . Journal
Infectious Disease 159,
7-15 .
210
C. Hackel et al.
3 . Hartskeerl, R. A ., de Wit, M . Y . L. & Klatser, P . R . (1989). Polymerase chain reaction for the detection of Mycobacterium leprae . Journal of General Microbiology 135, 2357-64 . 4. Saiki, R . K ., Gelfand, D . H., Stoffel, S ., Scharf, S . J ., Higuchi, R ., Horn, G . T . et al. (1988) . Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase . Science 239, 48791 . 5. Portaels, F ., Walsh, G. P ., De Ridder, K ., Malaty, R ., Meyers, W . M . & Binford, Ch. (1987) . Cultivable mycobacteria isolated from 32 newly captured wild armadillos (Dasypus novemcinctus) from Louisiana . Twenty-second Joint US-Japan Leprosy Research Conference, National Institute of Health, Bethesda, Maryland, USA . 6 . World Health Organization (1980) . WHO Special Programme for Research and Training in Tropical Diseases . Report of the 5th Meeting of the Scientific Working Group on the Immunology of Leprosy (IMMLEP) . TDR/IMMLEP-SWG (5)/80 .3 Annex 4, p . 23, Geneva. 7 . Ausubel, F . M ., Brent, R., Kingston, R. E., Moore, D . D ., Smith, J . A., Seidman, J . G . & Struhl, K . (eds) (1987) . Preparation and analysis of DNA . In Current Protocols in Molecular Biology New York : John Wiley and Sons . 8 . Houard, S ., Hackel, C ., Herzog, A . & Bollen, A. (1989) . Specific identification of Bordetella pertussis by the polymerase chain reaction . Research in Microbiology 140, 477-87. 9 . Mehra, V ., Sweetser, D . & Young, R . A . (1986) . Efficient mapping of protein antigenic determinants . Proceedings of the National Academy Sciences USA 83, 7013-17 . 10 . Shinnick, T . M . (1987) . The 65-Kilodalton antigen of Mycobacterium tuberculosis . Journal of Bacteriology 169, 1080-8 . 11 . Thole, J . E. R ., Keulen, W . J ., Kolk, A. H . J., Groothuis, D . G ., Berwald, L . G ., Tiesjema, R . H . & van Embden, J . D . A. (1987) . Characterization, sequence determination, and immunogenicity of a 64Kilodalton protein of Mycobacterium bovis BCG expressed in Escherichia coli K-12 . Infectious Immunity 55, 1466-75 . 12 . Vodkin, M. H . & Williams, J . C. (1988) . A heat shock operon in Coxiella burneti produces a major antigen homologous to a protein in both mycobacteria and Escherichia coli. Journal of Bacteriology 170, 1227-34 . 13 . Chanda, P . K ., Ono, M., Kuwano, M . & Kung, H . F. (1985) . Cloning, sequence analysis, and expression of alteration of the mRNA stability gene (ams+) of Escherichia coli . Journal of Bacteriology 161, 446-9. 14 . Woods, S . (1989) . Detection of Mycobacterium leprae by the polymerase chain reaction . First International Symposium on Molecular Biology of the Mycobacteria, Guildford, Surrey, U .K . (7-9 September 1989) . 15 . Shepard, C. C . & McRae, D . H . (1965) . Mycobacterium leprae : viability at 0 ° C, 31°C and during freezing . International journal of Leprosy 33, 316-23 . 16 . Shepard, C . C. & McRae, D . H . (1968) . A method for counting acid-fast bacteria . International Journal of Leprosy 36, 78-82. 17 . Salem, J . I ., Gadelha, A . R ., Maroja, F . & David, H . L . (1989). Non-cultivable mycobacteria in ulcers of the skin . Acta Leprologica 7 (Suppl . 1), 10-15. 18. Salem, J . I ., Gontijo Filho, P., Lévy-Frébault, V . & David, H . L. (1989) . Isolation and characterization of mycobacteria colonizing the healthy skin . Acta Leprologica 7 (Suppl . 1), 18-20 .
