1428 Nucleic Acids Research, Vol. 20, No. 6
Dinucleotide repeat polymorphism at the DXS441 locus
An STS in the human parvalbumin gene (PVALB)
Kavitha T.Ram, David F.Barker1 and Jennifer M.Puck* Department of Pediatrics, Children's Hospital of Philadelphia and University of PA School of Medicine, Philadelphia, PA 10194 and 'Department of Genetic Epidemiology, University of Utah, Salt Lake City, UT 84108, USA
J.M.Ritzler and M.W.Berchtold* Institute of Pharmacology and Biochemistry, University of ZOrich-Irchel, Winterthurerstrasse 190, CH-8057 Zurich, Switzerland
Source and Description of Clone: A repetitive TG:AC sequence was found at the locus DXS441 in Xql3.3 by Southern blot hybridization of poly-AC to a 0.8 kb HindIH fragment of the original CH35 clone defining this locus, RX214 (1). Sequencing the HindU fragment subcloned into pUC8 showed a run of 19 AC units. Flanking PCR primers were designed to amplify a 183 bp fragment including this repeat (EMBL accession no. X64294). PCR Primers: CTC ACT ATA TGT GGA GGA ACG (AC strand) AAG TCA GTC ACT TCA GTT TTC C (TG strand) Frequencies: Estimated from 40 chromosomes of unrelated individuals in SCIDX1 pedigrees (2), the heterozygosity = 0.76; combined heterozygosity at DXS441 based on 34 chromosomes for both the poly-TG and the TaqI RFLP previously described by Barker (1) is 0.82. Allele (bp) Frequency Allele (bp) Frequency .40 B4 (183) .10 B8 (173) .05 B3 (185) .15 B7 (175) .025 B2 (187) .20 B6 (177) BI (189) .025 .05 B5 (181) Chromosomal Localization: DXS441 has previously been mapped to Xql3.3 (1,3). No recombination occurred between the polyTG polymorphism and the TaqI RFLP in 14 doubly informative meioses in the SCIDX1 pedigrees. Mendelian Inheritance: Co-dominant X-linked inheritance was observed in 13 families with phase confirmation in human/rodent somatic cell hybrids. PCR Conditions and Other Comments: PCR was performed using 50-100 ng of genomic DNA with 13 pmol of each oligodeoxyribonucleotide primer, one of which was end-labeled with 32-P ATP. The 25 tl reaction volume contained 0.25 mM dNTP, 10 mM Tris HCl at pH 8.3, 50 mM KCI and 1.5 mM MgCl2. DNA was amplified for 30 cycles of 2 minutes at 95°C, 1 minute at 62°C, and 2 minutes at 75°C. Amplified alleles were resolved on denaturing polyacrylamide gels and detected by autoradiography. References: 1) Davies et al. (1990) Cytogenet. Cell Genet. 55, 254-313. 2) Puck,J.M. et al. (1990) Am. J. Hum. Genet. (Suppl). 47, A195. 3) Lafreniere,R.G. et al. (1991) Genomics 11, 352-363.
*
To whom correspondence should be addressed
Parvalbumin is a low molecular, high-affinity Ca2+-binding protein which is mainly localized in the cytosol of skeletal muscle and in the brain of vertebrates (1). In the muscle parvalbumin is present mainly in the fast contracting/relaxing IB fibre types whereas in the brain mainly GABA-ergic cells are parvalbumin positive. The single copy human parvalbumin gene (PVALB) is located on chromosome 22ql2-ql3.1 within a region of conserved synteny also present on mouse chromosome 15E (2). Using the polymerase chain reaction (PCR) described below, a 151 bp fragment was amplified from human genomic DNA and also from human brain cDNA (3) (Fig. 1, lane 1 and 2, respectively). This new STS is located in the 3' non-coding region (exon 5) of the human parvalbumin gene (EMBL no. X63578). PCR Primers: Forward (1-20) CACCTCTCTGCCCTGAACAC Reverse (132-151) ACCTTTATTGCTTCTCCAGC PCR Components in a 10 !d Reaction: 50 ng human genomic DNA, Tris-HCl 10 mM, MgCl2 1.5 mM, KCI 50 mM, gelatin 0.1 mg/ml, 200 ILM dNTPs, 0.2 U Taq polymerase (Boehringer), 1 RM of each oligonucleotide. PCR Profile: Initial denaturation step: 95°C for 3 minutes; 30 cycles each at 95°C for 40 seconds, 60°C for 40 seconds, 73°C for 1 minute followed by 5 minutes incubation at 73°C. Sequence of the PCR Product:
CACCTCTCTGCCCTGAACACCCAATCTCGGCCCCTC TCGCCACCCTCCTGCATTT CTGTTCAGTTCGTTTATGTTATTTTTTACTCCCCCATCCCCTGTGGCCCTCTAAT GACACCATTCTTCTGGAAAATGCTGGAGAAGCAATAAAGGT Acknowledgements: We thank the Swiss National Foundation (grant 31.28847.90), the Julius Klaus Foundation, the Cloetta Foundation, and the Stipendienfond der Basler Chemischen Industrie for financial support. References: 1) Berchtold,M.W. (1989) Biochem. Biophys. Acta. 1009, 201-215. 2) Ritzler,J.M., Sawhney,R., Geurts van Kessel,A.H.M., Grzeschik,K.-H., Schinzel,A. and Berchtold,M.W. Genomics in press. 3) Berchtold,M.W. (1989) J. Mol. Biol. 210, 417-427. bp _
*
To whom