Blood Cells, Molecules and Diseases 54 (2015) 116–122
Contents lists available at ScienceDirect
Blood Cells, Molecules and Diseases journal homepage: www.elsevier.com/locate/bcmd
Dioxin-induced thrombocyte aggregation in zebrafish Seongcheol Kim, Hemalatha Sundaramoorthi, Pudur Jagadeeswaran ⁎ Department of Biological Sciences, University of North Texas, 1510 Chestnut, Denton TX 76203, USA
a r t i c l e
i n f o
Article history: Submitted 8 May 2014 Revised 18 July 2014 Accepted 18 July 2014 Available online 14 August 2014 (Communicated by M. Narla, DSc, 18 July 2014) Keywords: TCDD Thrombocyte Zebrafish Signaling ADP
a b s t r a c t 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a canonical member of a group of dioxins which are byproducts of industrial combustion and are dangerous environmental pollutants. TCDD has been shown to cause several abnormalities in humans and wildlife, and recently, some dioxins have been found to activate platelets. However, TCDD-mediated platelet activation pathways are elusive and virtually nothing is known about TCDD activation of fish thrombocytes. To investigate TCDD effect on thrombocyte function, we tested zebrafish blood in presence of TCDD using a thrombocyte functional assay. We found that TCDD activated thrombocytes. Further experiments showed that thrombocytes of fish treated with TCDD formed both aggregates and filopodia. To investigate the mechanism of TCDD-mediated activation of thrombocytes we used inhibitors for Gq, cyclooxygenase-1, aryl hydrocarbon receptor (AHR), c-src, Akt, and ERK1/2. We found that TCDD induces AHR which activates c-src and signals the activation of Akt and ERK1/2 which are ultimately involved in generation of thromboxane A2. Furthermore, we found that ADP potentiates TCDD action, which led to the discovery that ADP itself activates AHR in the absence of TCDD. Taken together, these results resolved the pathway of TCDD activation of thrombocytes and led to the finding that ADP is an activator of AHR. © 2014 Published by Elsevier Inc.
Introduction Polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated biphenyls (PCBs) are global environmental contaminants resistant to biological degradation. As a result, PCDDs and PCBs bioaccumulate in all vertebrate species and produce a plethora of toxic effects, crippling developmental, reproductive, and immunological pathways [1–4]. Tremendous progress has been made in understanding the toxicity of these compounds by studying the effects of the most potent member of the above halogenated aromatic hydrocarbons, 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD), on mice, trout, zebrafish, and other vertebrate species [5–9]. It is widely accepted that the majority of the toxic effects of TCDD occur via aryl hydrocarbon receptor (AHR), a member of the helix loop helix-PAS family of DNA binding proteins [10]. When TCDD activates AHR, the AHR–TCDD complex translocates to the nucleus, dimerizes with Ah receptor nuclear translocator (ARNT), and controls transcription of genes such as cytochrome P450 [11,12]. Although the effect of TCDD has been studied in several organ systems, only limited reports are available on TCDD and hemostasis [13–19]. Studies from other laboratories have shown that certain PCB congeners induce human platelet aggregation [16]. Other PCBs do not demonstrate aggregating activity even though they have been shown to generate arachidonic acid and thromboxane A2, both
⁎ Corresponding author. E-mail address: [email protected] (P. Jagadeeswaran).
http://dx.doi.org/10.1016/j.bcmd.2014.07.010 1079-9796/© 2014 Published by Elsevier Inc.
of which are known to cause platelet aggregation [17]. In one study, using TCDD in the rat model, the authors suggested that TCDD causes aggregation and incorporation of platelets into microthrombi, which are known to cause strokes [13]. Exposure to high doses of TCDD in humans has been shown to cause thrombosis [20,21]. Long-term, lowdose treatment of monkeys also yielded thrombotic conditions [19]. Furthermore, since TCDD tends to bioaccumulate due to its long halflife, even with the low dose of daily intake from foods the body burden of TCDD increases with age. This body burden is a serious health concern for both aged individuals and animals due to increased clotting factor levels and thrombotic tendencies. Recently, AHR null mice have been used to show that AHR plays a role in both megakaryocyte polyploidization and collagen mediated activation of platelets [22,23]. However, nothing is known about the role of AHR nor the mechanism of TCDD activation of thrombocytes in earlier vertebrates. Such studies in fish will not only address TCDD action in earlier vertebrate animals but may also provide insight into the evolution of TCCD action. In this paper, we used zebrafish thrombocytes as a model to study the mechanism of TCDD activation [24]. We found that TCDD does in fact activate zebrafish thrombocytes in both a Gq-dependent (G-protein) manner under acute in vitro exposure and a Gqindependent pathway with in vivo long-term exposure. Our data also provide evidence that under acute exposure when TCDD binds to AHR it releases c-src kinase which activates other kinases such as PI3 kinase/Akt and ERK1/2. The activation of these kinases ultimately results in the generation of thromboxane A2, a strong platelet activator. Long-term TCDD exposure increases von Willebrand Factor (vWF)
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
which, in turn, may amplify the activation of thrombocytes in a Gqindependent pathway. We also found that in the absence of TCDD, AHR plays a role in the ADP activation pathway of thrombocytes. Taken together, these data partially establish the mechanism of TCDDmediated thrombocyte activation via AHR. Materials and methods Blood collection We collected blood from three types of adult zebrafish (wildtype, TCDD-treated, and TG(fli1:EGFP)y1) by using a 27G11/4 needle to gently pierce the lateral surface of the fish body where the caudal artery and the caudal vein anastomose. Using a micropipette tip, we collected 1 μl of blood welling out from the vessel. This blood was immediately dispensed into a 0.5 ml Eppendorf tube containing either 0.2 μl of 3.8% sodium citrate in PBS, pH 7.4 (citrated blood) or 1 μl of 20 mg heparin in 1 ml PBS, pH 7.4 (heparinized blood). Histology of thrombocytes Blood was collected from TG(fli1:EGFP)y1 zebrafish in which thrombocytes are labeled with green fluorescence protein (GFP) [25]. The blood was smeared on microscope slides and both bright field and fluorescence images (excited at 450–490 nm) were acquired using a Nikon E995 CoolPix digital camera mounted on a fluorescence microscope. Individual thrombocytes were distinguished from the aggregates by morphology. Thrombocyte aggregation assay The thrombocyte aggregation assay was performed using 1 μl of citrated blood in the conical well of a microtiter plate. The final agonist and/or inhibitor concentrations used are described below. We used 0.63% sodium citrate in PBS to achieve a final incubation volume of 10 μl. The plate was tilted manually every 5 min for 1 to 1.5 h at 25 °C to determine the time taken to stop the flow of blood down the walls of the well, i.e. time taken for aggregation of thrombocytes (TTA). Aggregation was qualitatively visualized by either a “firm button” of blood at the bottom of the well (complete aggregation) or as a “stuck out tongue” (incomplete aggregation). The following agonists were used and their final concentrations are provided in parentheses. Collagen (0.1 mg/ml), arachidonic acid (12 mM), ADP (0.02 mM), PAR1 peptide (1 μg/ml), epinephrine (1 μM), ristocetin (0.3 mg/ml), and TCDD (1 nM with 0.01% DMSO). For a negative control, we used DMSO at a final concentration of 0.01%. PAR1 peptide was obtained from Biosynthesis, Lewisville, TX and the remaining agonists were obtained from Sigma-Aldrich, St. Louis, MO. Inhibitors used were Gq inhibitor, indomethacin, AHR antagonist, c-src inhibitor (SU-6656), ERK1/2 inhibitor, and Akt/PI3K inhibitor (LY2940020). All inhibitors were used at 5 μM final concentration in the reaction mixture. Gq inhibitor was a gift from Satya Kunapuli from Temple University. Indomethacin was purchased from Sigma Aldrich, St. Louis, MO. The remaining inhibitors are from EMD Chemicals Inc., Gibbstown, VT. Annexin V binding assay To detect annexin V binding, we added 1 μl of TCDD or 1 μl of PBS (for the control) to 4 μl of heparinized blood. The mixture was incubated for 3 min at 25 °C and was immediately fixed with 10 μl of 4% paraformaldehyde. We added 2 μl of 10X annexin binding buffer and 3.5 μl of annexin V-FITC (BD Biosciences, San Jose, CA) to this mixture and incubated in the dark at 25 °C for 1 min. The mixture was then smeared on a slide and placed under a cover slip. The fluorescence images of thirty thrombocytes were then taken using a Nikon Eclipse 80i microscope
117
with excitation at 450–490 nm and constant exposure times. Their intensities were measured using NIS Elements AR 2.30 software. The intensities were plotted as levels of annexin V binding [14]. In vivo TCDD treatment of fish and RT-PCRs Zebrafish were incubated in small plastic containers containing 99 ml water and 1 ml of 1 μM TCDD in 10% DMSO to achieve a final concentration of 10 nM TCDD. The blood collected from these in vivo TCDDtreated fish is hereafter referred to as T-blood. For a negative control, fish were incubated with 0.1% DMSO alone (vehicle). After 24 h, total RNA was prepared from the white cell fraction of both the control fish blood and the T-blood. From this total RNA, we amplified both vWF and elongation factor 1-α (EF1-α) control mRNA by RT-PCR. We designed forward 5′- CACAGAGTCCTCCAACTGACG-3′ and reverse 5′AATGTTTTCAAGTCCTCAAACTG-3′ primers for vWF, and forward 5′CGGTGACAACATGCTGGAGG -3′ and reverse 5′-ACCAGTCTCCACACGA CCCA-3′ primers for EF1-α; these were synthesized by Biosynthesis, Lewisville, TX. 2-log DNA Ladder was used for DNA size markers (New England Biolabs, Ipswich, MA). The primers were used to amplify the 335 bp product for vWF and the 220 bp product for the EF1-α control. The RT-PCR products were resolved on 1.5% agarose gels. The densities of RT-PCR products were measured using Quantity One software from Bio-Rad Laboratories, Inc. Hercules, CA. The ratio of intensities between the EF1-α and the vWF bands of the control sample was taken as 100%. This ratio was compared to the ratio of intensities of EF1-α and the vWF bands from the TCDD experiment and the relative percentages were calculated based on the 100% control ratio values. The average percentages from three independent experiments were plotted. Quantitative RT-PCR was performed using BioRad iQ5 machine on both control and TCDD treated RNAs which were prepared as described above using the same set of primers and included SYBR Green dye in the reaction mixture. Each sample was normalized to EF1-α cDNA, and the average relative gene expression from three independent experiments was plotted using the calculations based on fold changes (ΔΔCt) [26]. Statistical analysis Statistical analysis was performed using Sigma Plot 10 with Sigma Stat integration software. Statistical significance between control and experimental reactions was assessed by ANOVA and a P value b 0.05 was considered significant. Results and discussion Characterization of thrombocyte activation by TCDD It has been shown in humans that symptoms such as chloracne and thrombosis occurred at a dose of approximately 100,000 pg TCDD/g lipid. Based on a total lipid concentration of approximately 400– 800 mg/dl of serum we calculated that high dose exposure to TCDD yields an approximate blood concentration of 2 nM TCDD. Thus, we believe 1 nM TCDD to be a reasonably relevant toxic dose. Furthermore, other reports have used similar concentrations of TCDD to study the effects of TCDD in zebrafish development [27]. Therefore, we used TCDD in our in vitro thrombocyte activation experiments at a final concentration of 1 nM. To first test whether TCDD induces thrombocyte aggregation, we added TCDD (1 nM final concentration) to our qualitative whole blood thrombocyte aggregation assay (Fig. 1a). TCDD treated blood aggregated in approximately 30–40 min showing a “firm button” whereas the control samples showed incomplete aggregation (“stuck out tongue”) in the same time period (Fig. 1a). To further verify the aggregation we used TCDD to activate blood from a zebrafish line which carries GFP labeled thrombocytes. In our laboratory, we have previously characterized both the CD41-GFP and TG(fli1:EGFP)y1 zebrafish lines and found
118
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
Fig. 1. TCDD-induced thrombocyte aggregation. a. Plate tilt assay measuring thrombocyte function. Left well contains control blood; note lack of aggregation or “stuck out tongue.” Right well contains blood treated with TCDD; note aggregation seen by “firm button” formation. b. TCDD induced thrombocyte aggregates in blood from TG(fli1:EGFP)y1 line. Left and right panels are images of thrombocyte cluster formation before and after TCDD treatment, respectively. Top and bottom panels are bright field and fluorescence images, respectively. c. Spreading of thrombocytes after addition of TCDD. Images of a representative control thrombocyte (left panel) and a representative TCDD treated thrombocyte (right panel). d. Measurement of TCDD activation of thrombocytes by annexin V binding. Graph shows fluorescence intensity of control thrombocytes (black bar) and thrombocytes activated by TCDD (white bar). N = 30 and P = 0.001.
that they are essentially identical in terms of GFP thrombocyte labeling [25]. Although the CD41-GFP line has been more commonly used in thrombocyte functional analysis, we chose to use the TG(fli1:EGFP)y1 line of zebrafish because we have continuously maintained this line in our laboratory. We found that TCDD treated zebrafish blood contained thrombocyte aggregates (Fig. 1b). Also, TCDD treated thrombocytes showed filopodial extensions and spreading (Fig. 1c) as well as increased annexin V binding (Fig. 1d). These results demonstrated that TCDD indeed activates thrombocytes and causes aggregation. To identify the minimal dose at which TCDD induces thrombocyte aggregation, we performed a dose response and found that aggregation occurred at doses of 0.4 nM and higher. Moreover, when we tested higher concentrations in vitro, there was no discernible difference in “firm button” formation between 1 nM and 10 nM doses. TCDD-induced thromboxane generation It has been observed that TCDD induces in vitro platelet aggregation by thromboxane generation. Since thromboxane induces platelet aggregation via a Gq-mediated pathway, we used the TTA assay to test whether a Gq-specific inhibitor would abrogate thrombocyte aggregation. As predicted, TCDD failed to activate the thrombocytes (Fig. 2, left panel) in the presence of Gq inhibitor, consistently yielding a TTA of approximately 60 min compared to the approximately 30 minute TTA in the absence of Gq inhibitor. Similarly, we blocked thromboxane generation by inhibiting cyclooxygenase-1 (Cox-1) using indomethacin. We found that TCDD did not activate thrombocytes in the presence of indomethacin as shown by prolonged TTA (Fig. 2, left panel). The above results suggested that TCDD activation of thrombocytes involves
Fig. 2. Inhibition of TCDD activation of thrombocytes by Gq inhibitor and indomethacin. Time taken to complete aggregation (TTA) of thrombocytes is shown on the Y-axis. Inhibitors added are listed along the X-axis. Left panel: Blood samples derived from normal zebrafish. Vehicle and TCDD represent wild-type blood with DMSO or TCDD added in vitro, respectively. Right panel: Blood samples derived from T-blood. Vehicle and T-blood represent blood from fish treated in vivo with DMSO or TCDD, respectively. For both in vitro and in vivo results, P values show the significance between respective controls and samples and are all b0.05. N = 6 for all samples.
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
119
thromboxane in a manner similar to that found in platelets. They also suggest that thromboxane generation via a Cox-1 pathway and that thromboxane action via a Gq-dependent pathway are present in zebrafish thrombocytes. To determine whether TCDD activates thrombocytes in vivo, we incubated zebrafish for 24 h in 10 nM TCDD. Since it is difficult to predict the actual concentration of TCDD levels in the blood when fish are incubated in TCCD water, we used 10 nM TCDD water to assure a minimum blood concentration of 1 nM. We found that T-blood (i.e. blood collected from fish which have undergone in vivo TCDD treatment) alone yielded a TTA similar to the TTA obtained by in vitro addition of TCDD (Fig. 2). This result suggested that TCDD activates thrombocytes in vivo as well. We then used T-blood to perform TTA assays in the presence of Gq and indomethacin. Interestingly, the results showed that T-blood activation by TCDD is not completely reversible by the in vitro addition of either Gq inhibitor or indomethacin (Fig. 2, right panel). These results suggested that there is a Gq-independent genomic pathway in thrombocytes that may contribute to the overall activation of thrombocytes by TCDD in vivo. TCDD-mediated AHR pathway In cell types other than thrombocytes it has been shown that TCDD binds to and activates AHR, resulting in the release of c-src which subsequently activates ERK1/2 and Akt [28,29]. This ERK1/2 and Akt activation ultimately leads to thromboxane generation. Therefore, the use of AHR inhibitor should inhibit the TCDD-mediated AHR activation and the subsequent thromboxane generation. Similarly, inhibitors for c-src, ERK1/2, and Akt should also inhibit TCDD-mediated thromboxane generation. As shown above, in thrombocytes, TCDD-mediated thromboxane generation resulted in aggregation as seen by shortened TTAs. Thus, use of the above inhibitors of AHR and its downstream pathway components should block thromboxane generation resulting in reduced thrombocyte aggregation and prolonged TTAs. Therefore, to identify whether activation of thrombocytes involves AHR we used AHR inhibitor on wildtype zebrafish blood in the presence of TCDD in vitro, in our thrombocyte aggregation assays. We found that AHR inhibitor + TCDD yielded prolonged TTAs similar to control values (vehicle), indicating that the in vitro effect of TCDD was completely reversed by AHR inhibitor (Fig. 3a). Similar results were obtained when using T-blood (Fig. 3b). Thus, the results showed that in both in vitro (Fig. 3a) and in vivo (Fig. 3b) TCDD treatment, in vitro addition of AHR inhibitor reversed the effect of TCDD suggesting that AHR is indeed involved in TCDDmediated signaling pathway. We then tested the downstream components c-src, ERK1/2, and Akt by using inhibitors specific for these proteins in our thrombocyte aggregation assays. We first used wildtype zebrafish blood and added TCDD in vitro. To these samples we then added each of the above inhibitors and found that that all four of these inhibitors blocked thrombocyte aggregation as seen by prolonged TTAs (Fig. 3a). These results suggested that all three of the above AHR pathway components (i.e. c-src, ERK1/2, and Akt) are involved in TCDD-mediated signaling. It is likely that TCDD activates thrombocytes via the release of c-src which subsequently activates ERK1/2 and Akt, as this pathway has been established in other cell types [29–31]. Interestingly, both the sample with AHR inhibitor and that with c-src inhibitor yielded TTAs similar to the vehicle (control). However, the samples with either ERK1/2 or Akt inhibitor had TTAs which were slightly less than the control. These results indicate that TCDD almost completely signals via c-src whereas ERK 1/2 and Akt appear to be only partially activated via a TCDD-mediated pathway. Since AHR is known to have genomic effects, we conducted thrombocyte functional assays by adding each of the above inhibitors to wells containing T-blood to determine the role of AHR in the in vivo TCDD activation of thrombocytes. Our T-blood results corroborated the above in vitro findings that c-src, ERK 1/2, and Akt are all involved in TCDD-mediated thrombocyte aggregation. Interestingly, all three
Fig. 3. Inhibition of TCDD-induced thrombocyte activation by AHR, ERK, and Akt inhibitors. Time taken to complete aggregation (TTA) of thrombocytes is shown on the Y-axis. Inhibitors added are listed along the X-axis. (a): Blood samples derived from normal zebrafish. Vehicle and TCDD represent wild-type blood with DMSO or TCDD added, respectively. (b): Blood samples derived from T-blood. Vehicle and T-blood represent blood from fish incubated in vivo with DMSO or TCDD, respectively. For both in vitro and in vivo results, P values show the significance between respective controls and samples and are all b0.05. N = 6 for all samples.
inhibitors only partially inhibited TCDD activation as seen by TTAs which were less than that obtained from the control. Furthermore, the TTAs obtained when adding c-src, ERK 1/2, and Akt inhibitors to our T-blood experiments (approximately 50, 40, and 45 min, respectively) were all lower than those obtained in the in vitro experiments (approximately 60, 50, and 52 min respectively) even though the concentrations of inhibitors used in both sets of experiments were identical. The fact that the results obtained from T-blood differed from those observed with in vitro TCDD treated blood suggests that there may be additional genomic pathways involved in TCDD-mediated thrombocyte aggregation.
120
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
Since it has been shown in other cell types that c-src activates ERK 1/ 2 and Akt independently [32,33], we tested whether combining inhibitors for ERK 1/2 and Akt would affect the level of TCDD-mediated thrombocyte aggregation by adding both of the above inhibitors to wells containing T-blood. Interestingly, the combination of ERK1/2 and Akt inhibitors mitigated the thrombocyte aggregation of T-blood more effectively than either one alone, as seen by a TTA of almost 60 min compared to TTAs of 40 and 45 min for ERK 1/2 and Akt, respectively (Fig. 3b). The increased TTA obtained by the combination of these two inhibitors suggests that Akt and ERK1/2 may each be independently activated by c-src. This finding is consistent with similar observations in other cells types as mentioned above. Taken together, our experiments involving inhibitors for c-src, ERK 1/2, and Akt on both wildtype blood with in vitro TCDD addition and T-blood (obtained from TCDD treated fish) have demonstrated that TCDD activation of AHR leads to activation of these downstream components. AHR activation by platelet agonists To test whether AHR inhibitor affects thrombocyte activation mediated by platelet agonists, we performed TTA experiments using each platelet agonist alone and in combination with AHR inhibitor using wild-type zebrafish blood (Fig. 4). The TTAs for wildtype blood with TCDD and TCDD + AHR inhibitor are provided for comparison (Fig. 4). The thrombocyte aggregation induced by ADP was inhibited by AHR inhibitor as seen by a prolonged TTA. AHR inhibitor did not affect the thrombocyte activation by the remainder of the agonists. These results suggested that ADP activates thrombocytes in part via an AHRmediated pathway. To test the effects of combining TCDD and platelet agonists on thrombocyte aggregation, we performed TTA experiments on T-blood (i.e., blood from fish subjected to in vivo TCCD treatment) and each of the platelet agonists (Fig. 5, solid bars). We used T-blood alone as a control (TTA of approximately 30 min). ADP + T-blood and ristocetin + T-blood both yielded shorter TTAs (20 min) than the control, while T-blood treated with collagen, epinephrine, or PAR1 peptide all yielded 30 minute TTAs, similar to the control. These results suggested that ADP and ristocetin potentiated the TCDD-mediated thrombocyte activation.
Fig. 5. Effect of AHR inhibitor on TTA of T-blood in the presence of various platelet agonists. TTA of thrombocytes is shown on the Y-axis. The inhibitors and/or agonists added to T-blood are indicated along the X-axis. P values show the significance between respective controls and samples and are all b0.05. N = 6 for all samples.
To test whether AHR inhibitor mitigates this potentiation, we performed TTA experiments on T-blood in the presence of AHR inhibitor and each of the platelet agonists (Fig. 5, hashed bars). We used T-blood + AHR inhibitor as a control (TTA of approximately 60 min). AHR inhibitor almost completely mitigated the ADP-mediated potentiation of the TCDD pathway, yielding a TTA of approximately 55 min. This finding suggested that ADP potentiation primarily involves nongenomic cytoplasmic signaling by AHR. However, the ristocetin potentiation was minimally reversed by AHR inhibitor, yielding a 25 minute TTA. This result suggested that not only is non-genomic cytoplasmic signaling by AHR involved in ristocetin potentiation to some extent, but that a genomic nuclear signaling pathway may also be involved. The remaining three agonists all yielded 60 minute TTAs, similar to T-blood + AHR inhibitor alone, suggesting that these are not involved in potentiating the TCDD effect on thrombocyte aggregation. Ristocetin-mediated potentiation involves increases in vWF synthesis
Fig. 4. Effect of AHR inhibitor on TTA in the presence of various agonists in vitro. TTA of thrombocytes is shown on Y-axis. The inhibitors and/or agonists added are indicated along X-axis. Blood samples are derived from normal zebrafish. P values show the significance between respective controls and samples and are all b0.05. N = 6 for all samples.
Since the above results suggested that ristocetin-mediated potentiation is primarily independent of non-genomic AHR signaling, we hypothesized that increases in vWF by genomic signaling via AHR may be involved in the enhanced thrombocyte aggregation seen in T-blood. Therefore, we used RT-PCR to test for increases in vWF mRNA of thrombocytes from T-blood. We used EF1-α as a control. We calculated the relative intensities of amplified bands of EF1-α and vWF and found that vWF mRNA levels increase by two fold in T-blood (Fig. 6a and b). To corroborate these results we performed quantitative RT-PCR experiments and found that vWF showed about a seven fold increase in levels of mRNA compared to EF1- α controls (Fig. 6c). The difference between the two fold increase in the standard RT-PCR experiments and the seven fold increase in the quantitative RT-PCR experiments is probably due to the fact that the standard RT-PCR reactions may have reached saturation levels. Taken together, these results are consistent with the increased activation of thrombocytes in T-blood, particularly because genome-mediated increases in vWF via AHR may have resulted prior to the inhibition of AHR in T-blood shown in Fig. 5b.
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
121
hsp90 complex. Then c-src stimulates the downstream targets ERK1/2 and Akt in a non-genomic pathway [2,4]. In human platelets, it has been shown that thromboxane is generated due to the action of TCDD [17]. It has also been shown that src kinase is associated with the activation of both PI3 kinase/Akt activation and ERK1/2 pathway. This activation results in cPLA2 activation and ultimately generates arachidonic acid [37]. Moreover, we found that ADP activation of thrombocytes involves AHR. Taken together, we deduced the TCDD-induced thrombocyte activation signaling pathway wherein TCDD activates AHR which is potentiated by ADP. This activation enhances the c-src mediated pathway to activate Akt and ERK1/2 pathways which ultimately results in cPLA2 activation to release arachidonic acid. In turn, arachidonic acid generates thromboxane to further activate thrombocytes via thromboxane receptor. Our finding that AHR is involved in the ADP-mediated activation of thrombocytes raises a question: whether there are proteins that directly bind to AHR after ADP activation or whether the inhibitor we used is competitively blocking ADP from binding to its receptor. At present this mechanism is unknown and remains to be resolved.
Conclusions This investigation demonstrates that TCDD activates zebrafish thrombocytes via the AHR receptor. The important components involved in the signaling pathway are c-src, Akt, and ERK1/2, all of which are also known to be involved in TCDD activation of other cell types. We also found that ADP activation of thrombocytes involves AHR and the combined action of ADP and TCDD enhances the strength of the ADP activation. Furthermore, we found that vWF mRNA increases with in vivo TCDD treatment of fish. This correlates with our findings that the combined action of ristocetin and TCDD also enhances thrombocyte activation. In summary, we report here the signaling pathway of TCDD activation of thrombocytes and the role of AHR in ADP-mediated thrombocyte aggregation.
Acknowledgments We thank Vidya Diaz for editorial help and Satya Kunapuli for providing Gq inhibitor. This study was supported by NIH grant HL077910.
References Fig. 6. Amplification of vWF and EF1-α mRNA by RT-PCR. (a): Representative agarose gel showing the 335 bp and 220 bp RT-PCR amplified bands (denoted by arrows) corresponding to vWF and EF1-α mRNA respectively. DNA size markers (Marker) are in left lane. (b): Graph showing the quantitation of the above bands. The relative percentages of vWF mRNA levels represented by RT-PCR products as measured by Quantity One software. (c): Quantitative RT-PCR showing TCDD induced vWF mRNA increases. Relative gene expression levels of vWF in thrombocyte enriched white cell fraction of T-blood. N = 3; P = 0.036 between control and TCDD treated samples is indicated by *.
The role of AHR in thrombocyte activation AHR is a member of the PAS superfamily of transcription factors which, upon binding to TCDD in the cytosol, translocates to the nucleus [34]. In the nucleus, it dimerizes with ARNT. The dimer of AHR-ARNT then binds to specific cis-acting DNA binding sequences called xenobiotic response elements (XREs) [35]. This binding to XREs activates transcription of TCDD responsive genes [36]. Our results (Fig. 6) indicate that TCDD appears to activate the vWF gene, increasing the levels of vWF mRNA. This is consistent with the genomic action of AHR found in other systems. In addition to this transcriptional control by the genomic pathway, AHR activation leads to the dissociation of c-src from cdc37-c-src-
[1] D.J. Lisk, Environmental implications of incineration of municipal solid waste and ash disposal, Sci. Total Environ. 74 (1988) 39–66. [2] F. Matsumura, The significance of the nongenomic pathway in mediating inflammatory signaling of the dioxin-activated Ah receptor to cause toxic effects, Biochem. Pharmacol. 77 (2009) 608–626. [3] K.W. Bock, C. Kohle, Ah receptor: dioxin-mediated toxic responses as hints to deregulated physiologic functions, Biochem. Pharmacol. 72 (2006) 393–404. [4] I. Deportes, J.L. Benoit-Guyod, D. Zmirou, Hazard to man and the environment posed by the use of urban waste compost: a review, Sci. Total Environ. 172 (1995) 197-22. [5] H. Iwata, E.Y. Kim, M. Yamauchi, S. Inoue, T. Agusa, S. Tanabe, Chemical contamination in aquatic ecosystems, Yakugaku Zasshi 127 (2007) 417–428. [6] J. Verreault, G.W. Gabrielsen, J.O. Bustnes, The Svalbard glaucous gull as bioindicator species in the European arctic: insight from 35 years of contaminants research, Rev Environ Contam Toxicol 205 (2010) 77–116. [7] C.F. Vogel, N. Nishimura, E. Sciullo, P. Wong, W. Li, F. Matsumura, Modulation of the chemokines KC and MCP-1 by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in mice, Arch. Biochem. Biophys. 461 (2007) 169–175. [8] M.W. Hornung, J.M. Spitsbergen, R.E. Peterson, 2,3,7,8-Tetrachlorodibenzo-p-dioxin alters cardiovascular and craniofacial development and function in sac fry of rainbow trout (Oncorhynchus mykiss), Toxicol. Sci. 47 (1999) 40–51. [9] M.J. Carvan III, T.P. Dalton, G.W. Stuart, D.W. Nebert, Transgenic zebrafish as sentinels for aquatic pollution, Ann. N. Y. Acad. Sci. 919 (2000) 133–147. [10] N. Marinkovic, D. Pasalic, G. Ferencak, B. Grskovic, A. Stavljenic Rukavina, Dioxins and human toxicity, Arh Hig Rada Toksikol 61 (2010) 445–453. [11] K.W. Bock, Aryl hydrocarbon or dioxin receptor: biologic and toxic responses, Rev. Physiol. Biochem. Pharmacol. 125 (1994) 1–42. [12] D. Brauze, M. Widerak, J. Cwykiel, K. Szyfter, W. Baer-Dubowska, The effect of aryl hydrocarbon receptor ligands on the expression of AhR, AhRR, ARNT, Hif1alpha, CYP1A1 and NQO1 genes in rat liver, Toxicol. Lett. 167 (2006) 212–220.
122
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
[13] J.B. Weissberg, J.G. Zinkl, Effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin upon hemostasis and hematologic function in the rat, Environ. Health Perspect. 5 (1973) 119–123. [14] D.C. Volz, D.C. Bencic, D.E. Hinton, J.M. Law, S.W. Kullman, 2,3,7,8-Tetrachlorodibenzop-dioxin (TCDD) induces organ- specific differential gene expression in male Japanese medaka (Oryzias latipes), Toxicol. Sci. 85 (2005) 572–584. [15] J.H. Evans, D.J. Fergus, C.C. Leslie, Inhibition of the MEK1/ERK pathway reduces arachidonic acid release independently of cPLA2 phosphorylation and translocation, BMC Biochem. 3 (2002) 30. [16] M. Raulf, W. Konig, In vitro effects of polychlorinated biphenyls on human platelets, Immunology 72 (1991) 287–291. [17] P.K. Forsell, A.O. Olsson, E. Andersson, L. Nallan, M.H. Gelb, Polychlorinated biphenyls induce arachidonic acid release in human platelets in a tamoxifen sensitive manner via activation of group IVA cytosolic phospholipase A2-alpha, Biochem. Pharmacol. 71 (2005) 144–155. [18] C. Vogel, U.S. Schuhmacher, G.H. Degen, H.M. Bolt, T. Pineau, J. Abel, Modulation of prostaglandin H synthase-2 mRNA expression by 2,3,7,8-tetrachlorodibenzo-pdioxin in mice, Arch. Biochem. Biophys. 351 (1998) 265–271. [19] T. Korenaga, T. Fukusato, M. Ohta, K. Asaoka, N. Murata, A. Arima, S. Kubota, Longterm effects of subcutaneously injected 2,3,7,8-tetrachlorodibenzo-p-dioxin on the liver of rhesus monkeys, Chemosphere 67 (2007) S399–S404. [20] O. Sorg, M. Zennegg, P. Schmid, R. Fedosyuk, R. Valikhnovskyi, O. Gaide, V. Kniazevych, J.H. Saurat, 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) poisoning in Victor Yushchenko: identification and measurement of TCDD metabolites, Lancet 374 (2009) 1179–1185. [21] A. Geusau, E. Tschachler, M. Meixner, S. Sandermann, O. Papke, C. Wolf, E. Valic, G. Stingl, M. McLachlan, Olestra increases faecal excretion of 2,3,7,8-tetrachlorodibenzop-dioxin, Lancet 354 (1999) 1266–1267. [22] S. Lindsey, E.T. Papoutsakis, The aryl hydrocarbon receptor (AHR) transcription factor regulates megakaryocytic polyploidization, Br J Haematol 152 (2011) 469–484. [23] S. Lindsey, J. Jiang, D. Woulfe, E.T. Papoutsakis, Platelets from mice lacking the aryl hydrocarbon receptor exhibit defective collagen-dependent signaling, J Thromb Haemost 12 (2014) 383–394. [24] P. Jagadeeswaran, J.P. Sheehan, F.E. Craig, D. Troyer, Identification and characterization of zebrafish thrombocytes, Br. J. Haematol. 107 (1999) 731–738. [25] P. Jagadeeswaran, S. Lin, B. Weinstein, A. Hutson, S. Kim, Loss of GATA1 and gain of FLI1 expression during thrombocyte maturation, Blood Cells Mol Dis 44 (2010) 175–180. [26] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RTPCR, Nucleic Acids Res. 29 (2001) e45. [27] H.M. Handley-Goldstone, M.W. Grow, J.J. Stegeman, Cardiovascular gene expression profiles of dioxin exposure in zebrafish embryos, Toxicol. Sci. 85 (2005) 683–693.
[28] S. Park, O. Mazina, A. Kitagawa, P. Wong, F. Matsumura, TCDD causes suppression of growth and differentiation of MCF10A, human mammary epithelial cells by interfering with their insulin receptor signaling through c-Src kinase and ERK activation, J. Biochem. Mol. Toxicol. 18 (2004) 322–331. [29] C.A. Pontillo, M.A. Garcia, D. Pena, C. Cocca, F. Chiappini, L. Alvarez, D. Kleiman de Pisarev, A.S. Randi, Activation of c-Src/HER1/STAT5b and HER1/ERK1/2 signaling pathways and cell migration by hexachlorobenzene in MDA-MB-231 human breast cancer cell line, Toxicol Sci 120 (2011) 284–296. [30] E. Enan, F. Matsumura, Identification of c-Src as the integral component of the cytosolic Ah receptor complex, transducing the signal of 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) through the protein phosphorylation pathway, Biochem. Pharmacol. 52 (1996) 1599–1612. [31] N.S. Ahn, H. Hu, J.S. Park, J.S. Kim, S. An, G. Kong, O.I. Aruoma, Y.S. Lee, K.S. Kang, Molecular mechanisms of the 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced inverted U-shaped dose responsiveness in anchorage independent growth and cell proliferation of human breast epithelial cells with stem cell characteristics, Mutat. Res. 579 (2005) 189–199. [32] J.J. Acosta, R.M. Munoz, L. Gonzalez, A. Subtil-Rodriguez, M.A. DominguezCaceres, J.M. Garcia-Martinez, A. Calcabrini, I. Lazaro-Trueba, J. Martin-Perez, Src mediates prolactin-dependent proliferation of T47D and MCF7 cells via the activation of focal adhesion kinase/Erk1/2 and phosphatidylinositol 3-kinase pathways, Mol. Endocrinol. 17 (2003) 2268–2282. [33] V. Bouchard, M.J. Demers, S. Thibodeau, V. Laquerre, N. Fujita, T. Tsuruo, J.F. Beaulieu, R. Gauthier, A. Vezina, L. Villeneuve, P.H. Vachon, Fak/Src signaling in human intestinal epithelial cell survival and anoikis: differentiation state-specific uncoupling with the PI3-K/Akt-1 and MEK/Erk pathways, J. Cell. Physiol. 212 (2007) 717–728. [34] E.A. Thackaberry, D.M. Gabaldon, M.K. Walker, S.M. Smith, Aryl hydrocarbon receptor null mice develop cardiac hypertrophy and increased hypoxia-inducible factor1alpha in the absence of cardiac hypoxia, Cardiovasc. Toxicol. 2 (2002) 263–274. [35] C.M. Klinge, J.L. Bowers, P.C. Kulakosky, K.K. Kamboj, H.I. Swanson, The aryl hydrocarbon receptor (AHR)/AHR nuclear translocator (ARNT) heterodimer interacts with naturally occurring estrogen response elements, Mol. Cell. Endocrinol. 157 (1999) 105–119. [36] P. Huang, S. Ceccatelli, H. Hakansson, L. Grandison, A. Rannug, Constitutive and TCDD-induced expression of Ah receptor-responsive genes in the pituitary, Neurotoxicology 23 (2002) 783–793. [37] W.K. Han, A. Sapirstein, C.C. Hung, A. Alessandrini, J.V. Bonventre, Cross-talk between cytosolic phospholipase A2 alpha (cPLA2 alpha) and secretory phospholipase A2 (sPLA2) in hydrogen peroxide-induced arachidonic acid release in murine mesangial cells: sPLA2 regulates cPLA2 alpha activity that is responsible for arachidonic acid release, J. Biol. Chem. 278 (2003) 24153–24163.
Contents lists available at ScienceDirect
Blood Cells, Molecules and Diseases journal homepage: www.elsevier.com/locate/bcmd
Dioxin-induced thrombocyte aggregation in zebrafish Seongcheol Kim, Hemalatha Sundaramoorthi, Pudur Jagadeeswaran ⁎ Department of Biological Sciences, University of North Texas, 1510 Chestnut, Denton TX 76203, USA
a r t i c l e
i n f o
Article history: Submitted 8 May 2014 Revised 18 July 2014 Accepted 18 July 2014 Available online 14 August 2014 (Communicated by M. Narla, DSc, 18 July 2014) Keywords: TCDD Thrombocyte Zebrafish Signaling ADP
a b s t r a c t 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a canonical member of a group of dioxins which are byproducts of industrial combustion and are dangerous environmental pollutants. TCDD has been shown to cause several abnormalities in humans and wildlife, and recently, some dioxins have been found to activate platelets. However, TCDD-mediated platelet activation pathways are elusive and virtually nothing is known about TCDD activation of fish thrombocytes. To investigate TCDD effect on thrombocyte function, we tested zebrafish blood in presence of TCDD using a thrombocyte functional assay. We found that TCDD activated thrombocytes. Further experiments showed that thrombocytes of fish treated with TCDD formed both aggregates and filopodia. To investigate the mechanism of TCDD-mediated activation of thrombocytes we used inhibitors for Gq, cyclooxygenase-1, aryl hydrocarbon receptor (AHR), c-src, Akt, and ERK1/2. We found that TCDD induces AHR which activates c-src and signals the activation of Akt and ERK1/2 which are ultimately involved in generation of thromboxane A2. Furthermore, we found that ADP potentiates TCDD action, which led to the discovery that ADP itself activates AHR in the absence of TCDD. Taken together, these results resolved the pathway of TCDD activation of thrombocytes and led to the finding that ADP is an activator of AHR. © 2014 Published by Elsevier Inc.
Introduction Polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated biphenyls (PCBs) are global environmental contaminants resistant to biological degradation. As a result, PCDDs and PCBs bioaccumulate in all vertebrate species and produce a plethora of toxic effects, crippling developmental, reproductive, and immunological pathways [1–4]. Tremendous progress has been made in understanding the toxicity of these compounds by studying the effects of the most potent member of the above halogenated aromatic hydrocarbons, 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD), on mice, trout, zebrafish, and other vertebrate species [5–9]. It is widely accepted that the majority of the toxic effects of TCDD occur via aryl hydrocarbon receptor (AHR), a member of the helix loop helix-PAS family of DNA binding proteins [10]. When TCDD activates AHR, the AHR–TCDD complex translocates to the nucleus, dimerizes with Ah receptor nuclear translocator (ARNT), and controls transcription of genes such as cytochrome P450 [11,12]. Although the effect of TCDD has been studied in several organ systems, only limited reports are available on TCDD and hemostasis [13–19]. Studies from other laboratories have shown that certain PCB congeners induce human platelet aggregation [16]. Other PCBs do not demonstrate aggregating activity even though they have been shown to generate arachidonic acid and thromboxane A2, both
⁎ Corresponding author. E-mail address: [email protected] (P. Jagadeeswaran).
http://dx.doi.org/10.1016/j.bcmd.2014.07.010 1079-9796/© 2014 Published by Elsevier Inc.
of which are known to cause platelet aggregation [17]. In one study, using TCDD in the rat model, the authors suggested that TCDD causes aggregation and incorporation of platelets into microthrombi, which are known to cause strokes [13]. Exposure to high doses of TCDD in humans has been shown to cause thrombosis [20,21]. Long-term, lowdose treatment of monkeys also yielded thrombotic conditions [19]. Furthermore, since TCDD tends to bioaccumulate due to its long halflife, even with the low dose of daily intake from foods the body burden of TCDD increases with age. This body burden is a serious health concern for both aged individuals and animals due to increased clotting factor levels and thrombotic tendencies. Recently, AHR null mice have been used to show that AHR plays a role in both megakaryocyte polyploidization and collagen mediated activation of platelets [22,23]. However, nothing is known about the role of AHR nor the mechanism of TCDD activation of thrombocytes in earlier vertebrates. Such studies in fish will not only address TCDD action in earlier vertebrate animals but may also provide insight into the evolution of TCCD action. In this paper, we used zebrafish thrombocytes as a model to study the mechanism of TCDD activation [24]. We found that TCDD does in fact activate zebrafish thrombocytes in both a Gq-dependent (G-protein) manner under acute in vitro exposure and a Gqindependent pathway with in vivo long-term exposure. Our data also provide evidence that under acute exposure when TCDD binds to AHR it releases c-src kinase which activates other kinases such as PI3 kinase/Akt and ERK1/2. The activation of these kinases ultimately results in the generation of thromboxane A2, a strong platelet activator. Long-term TCDD exposure increases von Willebrand Factor (vWF)
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
which, in turn, may amplify the activation of thrombocytes in a Gqindependent pathway. We also found that in the absence of TCDD, AHR plays a role in the ADP activation pathway of thrombocytes. Taken together, these data partially establish the mechanism of TCDDmediated thrombocyte activation via AHR. Materials and methods Blood collection We collected blood from three types of adult zebrafish (wildtype, TCDD-treated, and TG(fli1:EGFP)y1) by using a 27G11/4 needle to gently pierce the lateral surface of the fish body where the caudal artery and the caudal vein anastomose. Using a micropipette tip, we collected 1 μl of blood welling out from the vessel. This blood was immediately dispensed into a 0.5 ml Eppendorf tube containing either 0.2 μl of 3.8% sodium citrate in PBS, pH 7.4 (citrated blood) or 1 μl of 20 mg heparin in 1 ml PBS, pH 7.4 (heparinized blood). Histology of thrombocytes Blood was collected from TG(fli1:EGFP)y1 zebrafish in which thrombocytes are labeled with green fluorescence protein (GFP) [25]. The blood was smeared on microscope slides and both bright field and fluorescence images (excited at 450–490 nm) were acquired using a Nikon E995 CoolPix digital camera mounted on a fluorescence microscope. Individual thrombocytes were distinguished from the aggregates by morphology. Thrombocyte aggregation assay The thrombocyte aggregation assay was performed using 1 μl of citrated blood in the conical well of a microtiter plate. The final agonist and/or inhibitor concentrations used are described below. We used 0.63% sodium citrate in PBS to achieve a final incubation volume of 10 μl. The plate was tilted manually every 5 min for 1 to 1.5 h at 25 °C to determine the time taken to stop the flow of blood down the walls of the well, i.e. time taken for aggregation of thrombocytes (TTA). Aggregation was qualitatively visualized by either a “firm button” of blood at the bottom of the well (complete aggregation) or as a “stuck out tongue” (incomplete aggregation). The following agonists were used and their final concentrations are provided in parentheses. Collagen (0.1 mg/ml), arachidonic acid (12 mM), ADP (0.02 mM), PAR1 peptide (1 μg/ml), epinephrine (1 μM), ristocetin (0.3 mg/ml), and TCDD (1 nM with 0.01% DMSO). For a negative control, we used DMSO at a final concentration of 0.01%. PAR1 peptide was obtained from Biosynthesis, Lewisville, TX and the remaining agonists were obtained from Sigma-Aldrich, St. Louis, MO. Inhibitors used were Gq inhibitor, indomethacin, AHR antagonist, c-src inhibitor (SU-6656), ERK1/2 inhibitor, and Akt/PI3K inhibitor (LY2940020). All inhibitors were used at 5 μM final concentration in the reaction mixture. Gq inhibitor was a gift from Satya Kunapuli from Temple University. Indomethacin was purchased from Sigma Aldrich, St. Louis, MO. The remaining inhibitors are from EMD Chemicals Inc., Gibbstown, VT. Annexin V binding assay To detect annexin V binding, we added 1 μl of TCDD or 1 μl of PBS (for the control) to 4 μl of heparinized blood. The mixture was incubated for 3 min at 25 °C and was immediately fixed with 10 μl of 4% paraformaldehyde. We added 2 μl of 10X annexin binding buffer and 3.5 μl of annexin V-FITC (BD Biosciences, San Jose, CA) to this mixture and incubated in the dark at 25 °C for 1 min. The mixture was then smeared on a slide and placed under a cover slip. The fluorescence images of thirty thrombocytes were then taken using a Nikon Eclipse 80i microscope
117
with excitation at 450–490 nm and constant exposure times. Their intensities were measured using NIS Elements AR 2.30 software. The intensities were plotted as levels of annexin V binding [14]. In vivo TCDD treatment of fish and RT-PCRs Zebrafish were incubated in small plastic containers containing 99 ml water and 1 ml of 1 μM TCDD in 10% DMSO to achieve a final concentration of 10 nM TCDD. The blood collected from these in vivo TCDDtreated fish is hereafter referred to as T-blood. For a negative control, fish were incubated with 0.1% DMSO alone (vehicle). After 24 h, total RNA was prepared from the white cell fraction of both the control fish blood and the T-blood. From this total RNA, we amplified both vWF and elongation factor 1-α (EF1-α) control mRNA by RT-PCR. We designed forward 5′- CACAGAGTCCTCCAACTGACG-3′ and reverse 5′AATGTTTTCAAGTCCTCAAACTG-3′ primers for vWF, and forward 5′CGGTGACAACATGCTGGAGG -3′ and reverse 5′-ACCAGTCTCCACACGA CCCA-3′ primers for EF1-α; these were synthesized by Biosynthesis, Lewisville, TX. 2-log DNA Ladder was used for DNA size markers (New England Biolabs, Ipswich, MA). The primers were used to amplify the 335 bp product for vWF and the 220 bp product for the EF1-α control. The RT-PCR products were resolved on 1.5% agarose gels. The densities of RT-PCR products were measured using Quantity One software from Bio-Rad Laboratories, Inc. Hercules, CA. The ratio of intensities between the EF1-α and the vWF bands of the control sample was taken as 100%. This ratio was compared to the ratio of intensities of EF1-α and the vWF bands from the TCDD experiment and the relative percentages were calculated based on the 100% control ratio values. The average percentages from three independent experiments were plotted. Quantitative RT-PCR was performed using BioRad iQ5 machine on both control and TCDD treated RNAs which were prepared as described above using the same set of primers and included SYBR Green dye in the reaction mixture. Each sample was normalized to EF1-α cDNA, and the average relative gene expression from three independent experiments was plotted using the calculations based on fold changes (ΔΔCt) [26]. Statistical analysis Statistical analysis was performed using Sigma Plot 10 with Sigma Stat integration software. Statistical significance between control and experimental reactions was assessed by ANOVA and a P value b 0.05 was considered significant. Results and discussion Characterization of thrombocyte activation by TCDD It has been shown in humans that symptoms such as chloracne and thrombosis occurred at a dose of approximately 100,000 pg TCDD/g lipid. Based on a total lipid concentration of approximately 400– 800 mg/dl of serum we calculated that high dose exposure to TCDD yields an approximate blood concentration of 2 nM TCDD. Thus, we believe 1 nM TCDD to be a reasonably relevant toxic dose. Furthermore, other reports have used similar concentrations of TCDD to study the effects of TCDD in zebrafish development [27]. Therefore, we used TCDD in our in vitro thrombocyte activation experiments at a final concentration of 1 nM. To first test whether TCDD induces thrombocyte aggregation, we added TCDD (1 nM final concentration) to our qualitative whole blood thrombocyte aggregation assay (Fig. 1a). TCDD treated blood aggregated in approximately 30–40 min showing a “firm button” whereas the control samples showed incomplete aggregation (“stuck out tongue”) in the same time period (Fig. 1a). To further verify the aggregation we used TCDD to activate blood from a zebrafish line which carries GFP labeled thrombocytes. In our laboratory, we have previously characterized both the CD41-GFP and TG(fli1:EGFP)y1 zebrafish lines and found
118
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
Fig. 1. TCDD-induced thrombocyte aggregation. a. Plate tilt assay measuring thrombocyte function. Left well contains control blood; note lack of aggregation or “stuck out tongue.” Right well contains blood treated with TCDD; note aggregation seen by “firm button” formation. b. TCDD induced thrombocyte aggregates in blood from TG(fli1:EGFP)y1 line. Left and right panels are images of thrombocyte cluster formation before and after TCDD treatment, respectively. Top and bottom panels are bright field and fluorescence images, respectively. c. Spreading of thrombocytes after addition of TCDD. Images of a representative control thrombocyte (left panel) and a representative TCDD treated thrombocyte (right panel). d. Measurement of TCDD activation of thrombocytes by annexin V binding. Graph shows fluorescence intensity of control thrombocytes (black bar) and thrombocytes activated by TCDD (white bar). N = 30 and P = 0.001.
that they are essentially identical in terms of GFP thrombocyte labeling [25]. Although the CD41-GFP line has been more commonly used in thrombocyte functional analysis, we chose to use the TG(fli1:EGFP)y1 line of zebrafish because we have continuously maintained this line in our laboratory. We found that TCDD treated zebrafish blood contained thrombocyte aggregates (Fig. 1b). Also, TCDD treated thrombocytes showed filopodial extensions and spreading (Fig. 1c) as well as increased annexin V binding (Fig. 1d). These results demonstrated that TCDD indeed activates thrombocytes and causes aggregation. To identify the minimal dose at which TCDD induces thrombocyte aggregation, we performed a dose response and found that aggregation occurred at doses of 0.4 nM and higher. Moreover, when we tested higher concentrations in vitro, there was no discernible difference in “firm button” formation between 1 nM and 10 nM doses. TCDD-induced thromboxane generation It has been observed that TCDD induces in vitro platelet aggregation by thromboxane generation. Since thromboxane induces platelet aggregation via a Gq-mediated pathway, we used the TTA assay to test whether a Gq-specific inhibitor would abrogate thrombocyte aggregation. As predicted, TCDD failed to activate the thrombocytes (Fig. 2, left panel) in the presence of Gq inhibitor, consistently yielding a TTA of approximately 60 min compared to the approximately 30 minute TTA in the absence of Gq inhibitor. Similarly, we blocked thromboxane generation by inhibiting cyclooxygenase-1 (Cox-1) using indomethacin. We found that TCDD did not activate thrombocytes in the presence of indomethacin as shown by prolonged TTA (Fig. 2, left panel). The above results suggested that TCDD activation of thrombocytes involves
Fig. 2. Inhibition of TCDD activation of thrombocytes by Gq inhibitor and indomethacin. Time taken to complete aggregation (TTA) of thrombocytes is shown on the Y-axis. Inhibitors added are listed along the X-axis. Left panel: Blood samples derived from normal zebrafish. Vehicle and TCDD represent wild-type blood with DMSO or TCDD added in vitro, respectively. Right panel: Blood samples derived from T-blood. Vehicle and T-blood represent blood from fish treated in vivo with DMSO or TCDD, respectively. For both in vitro and in vivo results, P values show the significance between respective controls and samples and are all b0.05. N = 6 for all samples.
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
119
thromboxane in a manner similar to that found in platelets. They also suggest that thromboxane generation via a Cox-1 pathway and that thromboxane action via a Gq-dependent pathway are present in zebrafish thrombocytes. To determine whether TCDD activates thrombocytes in vivo, we incubated zebrafish for 24 h in 10 nM TCDD. Since it is difficult to predict the actual concentration of TCDD levels in the blood when fish are incubated in TCCD water, we used 10 nM TCDD water to assure a minimum blood concentration of 1 nM. We found that T-blood (i.e. blood collected from fish which have undergone in vivo TCDD treatment) alone yielded a TTA similar to the TTA obtained by in vitro addition of TCDD (Fig. 2). This result suggested that TCDD activates thrombocytes in vivo as well. We then used T-blood to perform TTA assays in the presence of Gq and indomethacin. Interestingly, the results showed that T-blood activation by TCDD is not completely reversible by the in vitro addition of either Gq inhibitor or indomethacin (Fig. 2, right panel). These results suggested that there is a Gq-independent genomic pathway in thrombocytes that may contribute to the overall activation of thrombocytes by TCDD in vivo. TCDD-mediated AHR pathway In cell types other than thrombocytes it has been shown that TCDD binds to and activates AHR, resulting in the release of c-src which subsequently activates ERK1/2 and Akt [28,29]. This ERK1/2 and Akt activation ultimately leads to thromboxane generation. Therefore, the use of AHR inhibitor should inhibit the TCDD-mediated AHR activation and the subsequent thromboxane generation. Similarly, inhibitors for c-src, ERK1/2, and Akt should also inhibit TCDD-mediated thromboxane generation. As shown above, in thrombocytes, TCDD-mediated thromboxane generation resulted in aggregation as seen by shortened TTAs. Thus, use of the above inhibitors of AHR and its downstream pathway components should block thromboxane generation resulting in reduced thrombocyte aggregation and prolonged TTAs. Therefore, to identify whether activation of thrombocytes involves AHR we used AHR inhibitor on wildtype zebrafish blood in the presence of TCDD in vitro, in our thrombocyte aggregation assays. We found that AHR inhibitor + TCDD yielded prolonged TTAs similar to control values (vehicle), indicating that the in vitro effect of TCDD was completely reversed by AHR inhibitor (Fig. 3a). Similar results were obtained when using T-blood (Fig. 3b). Thus, the results showed that in both in vitro (Fig. 3a) and in vivo (Fig. 3b) TCDD treatment, in vitro addition of AHR inhibitor reversed the effect of TCDD suggesting that AHR is indeed involved in TCDDmediated signaling pathway. We then tested the downstream components c-src, ERK1/2, and Akt by using inhibitors specific for these proteins in our thrombocyte aggregation assays. We first used wildtype zebrafish blood and added TCDD in vitro. To these samples we then added each of the above inhibitors and found that that all four of these inhibitors blocked thrombocyte aggregation as seen by prolonged TTAs (Fig. 3a). These results suggested that all three of the above AHR pathway components (i.e. c-src, ERK1/2, and Akt) are involved in TCDD-mediated signaling. It is likely that TCDD activates thrombocytes via the release of c-src which subsequently activates ERK1/2 and Akt, as this pathway has been established in other cell types [29–31]. Interestingly, both the sample with AHR inhibitor and that with c-src inhibitor yielded TTAs similar to the vehicle (control). However, the samples with either ERK1/2 or Akt inhibitor had TTAs which were slightly less than the control. These results indicate that TCDD almost completely signals via c-src whereas ERK 1/2 and Akt appear to be only partially activated via a TCDD-mediated pathway. Since AHR is known to have genomic effects, we conducted thrombocyte functional assays by adding each of the above inhibitors to wells containing T-blood to determine the role of AHR in the in vivo TCDD activation of thrombocytes. Our T-blood results corroborated the above in vitro findings that c-src, ERK 1/2, and Akt are all involved in TCDD-mediated thrombocyte aggregation. Interestingly, all three
Fig. 3. Inhibition of TCDD-induced thrombocyte activation by AHR, ERK, and Akt inhibitors. Time taken to complete aggregation (TTA) of thrombocytes is shown on the Y-axis. Inhibitors added are listed along the X-axis. (a): Blood samples derived from normal zebrafish. Vehicle and TCDD represent wild-type blood with DMSO or TCDD added, respectively. (b): Blood samples derived from T-blood. Vehicle and T-blood represent blood from fish incubated in vivo with DMSO or TCDD, respectively. For both in vitro and in vivo results, P values show the significance between respective controls and samples and are all b0.05. N = 6 for all samples.
inhibitors only partially inhibited TCDD activation as seen by TTAs which were less than that obtained from the control. Furthermore, the TTAs obtained when adding c-src, ERK 1/2, and Akt inhibitors to our T-blood experiments (approximately 50, 40, and 45 min, respectively) were all lower than those obtained in the in vitro experiments (approximately 60, 50, and 52 min respectively) even though the concentrations of inhibitors used in both sets of experiments were identical. The fact that the results obtained from T-blood differed from those observed with in vitro TCDD treated blood suggests that there may be additional genomic pathways involved in TCDD-mediated thrombocyte aggregation.
120
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
Since it has been shown in other cell types that c-src activates ERK 1/ 2 and Akt independently [32,33], we tested whether combining inhibitors for ERK 1/2 and Akt would affect the level of TCDD-mediated thrombocyte aggregation by adding both of the above inhibitors to wells containing T-blood. Interestingly, the combination of ERK1/2 and Akt inhibitors mitigated the thrombocyte aggregation of T-blood more effectively than either one alone, as seen by a TTA of almost 60 min compared to TTAs of 40 and 45 min for ERK 1/2 and Akt, respectively (Fig. 3b). The increased TTA obtained by the combination of these two inhibitors suggests that Akt and ERK1/2 may each be independently activated by c-src. This finding is consistent with similar observations in other cells types as mentioned above. Taken together, our experiments involving inhibitors for c-src, ERK 1/2, and Akt on both wildtype blood with in vitro TCDD addition and T-blood (obtained from TCDD treated fish) have demonstrated that TCDD activation of AHR leads to activation of these downstream components. AHR activation by platelet agonists To test whether AHR inhibitor affects thrombocyte activation mediated by platelet agonists, we performed TTA experiments using each platelet agonist alone and in combination with AHR inhibitor using wild-type zebrafish blood (Fig. 4). The TTAs for wildtype blood with TCDD and TCDD + AHR inhibitor are provided for comparison (Fig. 4). The thrombocyte aggregation induced by ADP was inhibited by AHR inhibitor as seen by a prolonged TTA. AHR inhibitor did not affect the thrombocyte activation by the remainder of the agonists. These results suggested that ADP activates thrombocytes in part via an AHRmediated pathway. To test the effects of combining TCDD and platelet agonists on thrombocyte aggregation, we performed TTA experiments on T-blood (i.e., blood from fish subjected to in vivo TCCD treatment) and each of the platelet agonists (Fig. 5, solid bars). We used T-blood alone as a control (TTA of approximately 30 min). ADP + T-blood and ristocetin + T-blood both yielded shorter TTAs (20 min) than the control, while T-blood treated with collagen, epinephrine, or PAR1 peptide all yielded 30 minute TTAs, similar to the control. These results suggested that ADP and ristocetin potentiated the TCDD-mediated thrombocyte activation.
Fig. 5. Effect of AHR inhibitor on TTA of T-blood in the presence of various platelet agonists. TTA of thrombocytes is shown on the Y-axis. The inhibitors and/or agonists added to T-blood are indicated along the X-axis. P values show the significance between respective controls and samples and are all b0.05. N = 6 for all samples.
To test whether AHR inhibitor mitigates this potentiation, we performed TTA experiments on T-blood in the presence of AHR inhibitor and each of the platelet agonists (Fig. 5, hashed bars). We used T-blood + AHR inhibitor as a control (TTA of approximately 60 min). AHR inhibitor almost completely mitigated the ADP-mediated potentiation of the TCDD pathway, yielding a TTA of approximately 55 min. This finding suggested that ADP potentiation primarily involves nongenomic cytoplasmic signaling by AHR. However, the ristocetin potentiation was minimally reversed by AHR inhibitor, yielding a 25 minute TTA. This result suggested that not only is non-genomic cytoplasmic signaling by AHR involved in ristocetin potentiation to some extent, but that a genomic nuclear signaling pathway may also be involved. The remaining three agonists all yielded 60 minute TTAs, similar to T-blood + AHR inhibitor alone, suggesting that these are not involved in potentiating the TCDD effect on thrombocyte aggregation. Ristocetin-mediated potentiation involves increases in vWF synthesis
Fig. 4. Effect of AHR inhibitor on TTA in the presence of various agonists in vitro. TTA of thrombocytes is shown on Y-axis. The inhibitors and/or agonists added are indicated along X-axis. Blood samples are derived from normal zebrafish. P values show the significance between respective controls and samples and are all b0.05. N = 6 for all samples.
Since the above results suggested that ristocetin-mediated potentiation is primarily independent of non-genomic AHR signaling, we hypothesized that increases in vWF by genomic signaling via AHR may be involved in the enhanced thrombocyte aggregation seen in T-blood. Therefore, we used RT-PCR to test for increases in vWF mRNA of thrombocytes from T-blood. We used EF1-α as a control. We calculated the relative intensities of amplified bands of EF1-α and vWF and found that vWF mRNA levels increase by two fold in T-blood (Fig. 6a and b). To corroborate these results we performed quantitative RT-PCR experiments and found that vWF showed about a seven fold increase in levels of mRNA compared to EF1- α controls (Fig. 6c). The difference between the two fold increase in the standard RT-PCR experiments and the seven fold increase in the quantitative RT-PCR experiments is probably due to the fact that the standard RT-PCR reactions may have reached saturation levels. Taken together, these results are consistent with the increased activation of thrombocytes in T-blood, particularly because genome-mediated increases in vWF via AHR may have resulted prior to the inhibition of AHR in T-blood shown in Fig. 5b.
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
121
hsp90 complex. Then c-src stimulates the downstream targets ERK1/2 and Akt in a non-genomic pathway [2,4]. In human platelets, it has been shown that thromboxane is generated due to the action of TCDD [17]. It has also been shown that src kinase is associated with the activation of both PI3 kinase/Akt activation and ERK1/2 pathway. This activation results in cPLA2 activation and ultimately generates arachidonic acid [37]. Moreover, we found that ADP activation of thrombocytes involves AHR. Taken together, we deduced the TCDD-induced thrombocyte activation signaling pathway wherein TCDD activates AHR which is potentiated by ADP. This activation enhances the c-src mediated pathway to activate Akt and ERK1/2 pathways which ultimately results in cPLA2 activation to release arachidonic acid. In turn, arachidonic acid generates thromboxane to further activate thrombocytes via thromboxane receptor. Our finding that AHR is involved in the ADP-mediated activation of thrombocytes raises a question: whether there are proteins that directly bind to AHR after ADP activation or whether the inhibitor we used is competitively blocking ADP from binding to its receptor. At present this mechanism is unknown and remains to be resolved.
Conclusions This investigation demonstrates that TCDD activates zebrafish thrombocytes via the AHR receptor. The important components involved in the signaling pathway are c-src, Akt, and ERK1/2, all of which are also known to be involved in TCDD activation of other cell types. We also found that ADP activation of thrombocytes involves AHR and the combined action of ADP and TCDD enhances the strength of the ADP activation. Furthermore, we found that vWF mRNA increases with in vivo TCDD treatment of fish. This correlates with our findings that the combined action of ristocetin and TCDD also enhances thrombocyte activation. In summary, we report here the signaling pathway of TCDD activation of thrombocytes and the role of AHR in ADP-mediated thrombocyte aggregation.
Acknowledgments We thank Vidya Diaz for editorial help and Satya Kunapuli for providing Gq inhibitor. This study was supported by NIH grant HL077910.
References Fig. 6. Amplification of vWF and EF1-α mRNA by RT-PCR. (a): Representative agarose gel showing the 335 bp and 220 bp RT-PCR amplified bands (denoted by arrows) corresponding to vWF and EF1-α mRNA respectively. DNA size markers (Marker) are in left lane. (b): Graph showing the quantitation of the above bands. The relative percentages of vWF mRNA levels represented by RT-PCR products as measured by Quantity One software. (c): Quantitative RT-PCR showing TCDD induced vWF mRNA increases. Relative gene expression levels of vWF in thrombocyte enriched white cell fraction of T-blood. N = 3; P = 0.036 between control and TCDD treated samples is indicated by *.
The role of AHR in thrombocyte activation AHR is a member of the PAS superfamily of transcription factors which, upon binding to TCDD in the cytosol, translocates to the nucleus [34]. In the nucleus, it dimerizes with ARNT. The dimer of AHR-ARNT then binds to specific cis-acting DNA binding sequences called xenobiotic response elements (XREs) [35]. This binding to XREs activates transcription of TCDD responsive genes [36]. Our results (Fig. 6) indicate that TCDD appears to activate the vWF gene, increasing the levels of vWF mRNA. This is consistent with the genomic action of AHR found in other systems. In addition to this transcriptional control by the genomic pathway, AHR activation leads to the dissociation of c-src from cdc37-c-src-
[1] D.J. Lisk, Environmental implications of incineration of municipal solid waste and ash disposal, Sci. Total Environ. 74 (1988) 39–66. [2] F. Matsumura, The significance of the nongenomic pathway in mediating inflammatory signaling of the dioxin-activated Ah receptor to cause toxic effects, Biochem. Pharmacol. 77 (2009) 608–626. [3] K.W. Bock, C. Kohle, Ah receptor: dioxin-mediated toxic responses as hints to deregulated physiologic functions, Biochem. Pharmacol. 72 (2006) 393–404. [4] I. Deportes, J.L. Benoit-Guyod, D. Zmirou, Hazard to man and the environment posed by the use of urban waste compost: a review, Sci. Total Environ. 172 (1995) 197-22. [5] H. Iwata, E.Y. Kim, M. Yamauchi, S. Inoue, T. Agusa, S. Tanabe, Chemical contamination in aquatic ecosystems, Yakugaku Zasshi 127 (2007) 417–428. [6] J. Verreault, G.W. Gabrielsen, J.O. Bustnes, The Svalbard glaucous gull as bioindicator species in the European arctic: insight from 35 years of contaminants research, Rev Environ Contam Toxicol 205 (2010) 77–116. [7] C.F. Vogel, N. Nishimura, E. Sciullo, P. Wong, W. Li, F. Matsumura, Modulation of the chemokines KC and MCP-1 by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in mice, Arch. Biochem. Biophys. 461 (2007) 169–175. [8] M.W. Hornung, J.M. Spitsbergen, R.E. Peterson, 2,3,7,8-Tetrachlorodibenzo-p-dioxin alters cardiovascular and craniofacial development and function in sac fry of rainbow trout (Oncorhynchus mykiss), Toxicol. Sci. 47 (1999) 40–51. [9] M.J. Carvan III, T.P. Dalton, G.W. Stuart, D.W. Nebert, Transgenic zebrafish as sentinels for aquatic pollution, Ann. N. Y. Acad. Sci. 919 (2000) 133–147. [10] N. Marinkovic, D. Pasalic, G. Ferencak, B. Grskovic, A. Stavljenic Rukavina, Dioxins and human toxicity, Arh Hig Rada Toksikol 61 (2010) 445–453. [11] K.W. Bock, Aryl hydrocarbon or dioxin receptor: biologic and toxic responses, Rev. Physiol. Biochem. Pharmacol. 125 (1994) 1–42. [12] D. Brauze, M. Widerak, J. Cwykiel, K. Szyfter, W. Baer-Dubowska, The effect of aryl hydrocarbon receptor ligands on the expression of AhR, AhRR, ARNT, Hif1alpha, CYP1A1 and NQO1 genes in rat liver, Toxicol. Lett. 167 (2006) 212–220.
122
S. Kim et al. / Blood Cells, Molecules and Diseases 54 (2015) 116–122
[13] J.B. Weissberg, J.G. Zinkl, Effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin upon hemostasis and hematologic function in the rat, Environ. Health Perspect. 5 (1973) 119–123. [14] D.C. Volz, D.C. Bencic, D.E. Hinton, J.M. Law, S.W. Kullman, 2,3,7,8-Tetrachlorodibenzop-dioxin (TCDD) induces organ- specific differential gene expression in male Japanese medaka (Oryzias latipes), Toxicol. Sci. 85 (2005) 572–584. [15] J.H. Evans, D.J. Fergus, C.C. Leslie, Inhibition of the MEK1/ERK pathway reduces arachidonic acid release independently of cPLA2 phosphorylation and translocation, BMC Biochem. 3 (2002) 30. [16] M. Raulf, W. Konig, In vitro effects of polychlorinated biphenyls on human platelets, Immunology 72 (1991) 287–291. [17] P.K. Forsell, A.O. Olsson, E. Andersson, L. Nallan, M.H. Gelb, Polychlorinated biphenyls induce arachidonic acid release in human platelets in a tamoxifen sensitive manner via activation of group IVA cytosolic phospholipase A2-alpha, Biochem. Pharmacol. 71 (2005) 144–155. [18] C. Vogel, U.S. Schuhmacher, G.H. Degen, H.M. Bolt, T. Pineau, J. Abel, Modulation of prostaglandin H synthase-2 mRNA expression by 2,3,7,8-tetrachlorodibenzo-pdioxin in mice, Arch. Biochem. Biophys. 351 (1998) 265–271. [19] T. Korenaga, T. Fukusato, M. Ohta, K. Asaoka, N. Murata, A. Arima, S. Kubota, Longterm effects of subcutaneously injected 2,3,7,8-tetrachlorodibenzo-p-dioxin on the liver of rhesus monkeys, Chemosphere 67 (2007) S399–S404. [20] O. Sorg, M. Zennegg, P. Schmid, R. Fedosyuk, R. Valikhnovskyi, O. Gaide, V. Kniazevych, J.H. Saurat, 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) poisoning in Victor Yushchenko: identification and measurement of TCDD metabolites, Lancet 374 (2009) 1179–1185. [21] A. Geusau, E. Tschachler, M. Meixner, S. Sandermann, O. Papke, C. Wolf, E. Valic, G. Stingl, M. McLachlan, Olestra increases faecal excretion of 2,3,7,8-tetrachlorodibenzop-dioxin, Lancet 354 (1999) 1266–1267. [22] S. Lindsey, E.T. Papoutsakis, The aryl hydrocarbon receptor (AHR) transcription factor regulates megakaryocytic polyploidization, Br J Haematol 152 (2011) 469–484. [23] S. Lindsey, J. Jiang, D. Woulfe, E.T. Papoutsakis, Platelets from mice lacking the aryl hydrocarbon receptor exhibit defective collagen-dependent signaling, J Thromb Haemost 12 (2014) 383–394. [24] P. Jagadeeswaran, J.P. Sheehan, F.E. Craig, D. Troyer, Identification and characterization of zebrafish thrombocytes, Br. J. Haematol. 107 (1999) 731–738. [25] P. Jagadeeswaran, S. Lin, B. Weinstein, A. Hutson, S. Kim, Loss of GATA1 and gain of FLI1 expression during thrombocyte maturation, Blood Cells Mol Dis 44 (2010) 175–180. [26] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RTPCR, Nucleic Acids Res. 29 (2001) e45. [27] H.M. Handley-Goldstone, M.W. Grow, J.J. Stegeman, Cardiovascular gene expression profiles of dioxin exposure in zebrafish embryos, Toxicol. Sci. 85 (2005) 683–693.
[28] S. Park, O. Mazina, A. Kitagawa, P. Wong, F. Matsumura, TCDD causes suppression of growth and differentiation of MCF10A, human mammary epithelial cells by interfering with their insulin receptor signaling through c-Src kinase and ERK activation, J. Biochem. Mol. Toxicol. 18 (2004) 322–331. [29] C.A. Pontillo, M.A. Garcia, D. Pena, C. Cocca, F. Chiappini, L. Alvarez, D. Kleiman de Pisarev, A.S. Randi, Activation of c-Src/HER1/STAT5b and HER1/ERK1/2 signaling pathways and cell migration by hexachlorobenzene in MDA-MB-231 human breast cancer cell line, Toxicol Sci 120 (2011) 284–296. [30] E. Enan, F. Matsumura, Identification of c-Src as the integral component of the cytosolic Ah receptor complex, transducing the signal of 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) through the protein phosphorylation pathway, Biochem. Pharmacol. 52 (1996) 1599–1612. [31] N.S. Ahn, H. Hu, J.S. Park, J.S. Kim, S. An, G. Kong, O.I. Aruoma, Y.S. Lee, K.S. Kang, Molecular mechanisms of the 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced inverted U-shaped dose responsiveness in anchorage independent growth and cell proliferation of human breast epithelial cells with stem cell characteristics, Mutat. Res. 579 (2005) 189–199. [32] J.J. Acosta, R.M. Munoz, L. Gonzalez, A. Subtil-Rodriguez, M.A. DominguezCaceres, J.M. Garcia-Martinez, A. Calcabrini, I. Lazaro-Trueba, J. Martin-Perez, Src mediates prolactin-dependent proliferation of T47D and MCF7 cells via the activation of focal adhesion kinase/Erk1/2 and phosphatidylinositol 3-kinase pathways, Mol. Endocrinol. 17 (2003) 2268–2282. [33] V. Bouchard, M.J. Demers, S. Thibodeau, V. Laquerre, N. Fujita, T. Tsuruo, J.F. Beaulieu, R. Gauthier, A. Vezina, L. Villeneuve, P.H. Vachon, Fak/Src signaling in human intestinal epithelial cell survival and anoikis: differentiation state-specific uncoupling with the PI3-K/Akt-1 and MEK/Erk pathways, J. Cell. Physiol. 212 (2007) 717–728. [34] E.A. Thackaberry, D.M. Gabaldon, M.K. Walker, S.M. Smith, Aryl hydrocarbon receptor null mice develop cardiac hypertrophy and increased hypoxia-inducible factor1alpha in the absence of cardiac hypoxia, Cardiovasc. Toxicol. 2 (2002) 263–274. [35] C.M. Klinge, J.L. Bowers, P.C. Kulakosky, K.K. Kamboj, H.I. Swanson, The aryl hydrocarbon receptor (AHR)/AHR nuclear translocator (ARNT) heterodimer interacts with naturally occurring estrogen response elements, Mol. Cell. Endocrinol. 157 (1999) 105–119. [36] P. Huang, S. Ceccatelli, H. Hakansson, L. Grandison, A. Rannug, Constitutive and TCDD-induced expression of Ah receptor-responsive genes in the pituitary, Neurotoxicology 23 (2002) 783–793. [37] W.K. Han, A. Sapirstein, C.C. Hung, A. Alessandrini, J.V. Bonventre, Cross-talk between cytosolic phospholipase A2 alpha (cPLA2 alpha) and secretory phospholipase A2 (sPLA2) in hydrogen peroxide-induced arachidonic acid release in murine mesangial cells: sPLA2 regulates cPLA2 alpha activity that is responsible for arachidonic acid release, J. Biol. Chem. 278 (2003) 24153–24163.
![[Postpartal ADP- and collagen-induced thrombocyte aggregation in newborn infants (proceedings)].](/assets/img/hold.png)
