RESEARCH LETTER
Discovery of two novel b-glucosidases from an Amazon soil metagenomic library Jessica C. Bergmann1, Ohana Yonara A. Costa1, John M. Gladden2,3, Steven Singer2,4, Richard Heins2,3, Patrik D’haeseleer2,5, Blake A. Simmons2,3 & Betania F. Quirino1,6 lica de Brası´lia, Brası´lia, Brazil; 2Joint BioEnergy Institute, Emeryville, CA, USA; Genomic Sciences and Biotechnology Program, Universidade Cato Biological and Materials Science Center, Sandia National Laboratory, Livermore, CA, USA; 4Earth Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA, USA; 5Bioscience and Biotechnology Division, Lawrence Livermore National Laboratory, Livermore, CA, USA; and 6 Embrapa-Agroenergy, Brasılia, Brazil 1 3
Correspondence: Betania F. Quirino, Embrapa-Agroenergy, Parque Estacß~ao gica, s/n; 70.770-901 Brasılia, DF, Brazil. Biolo Tel.: +55 61 3448 7115; fax: +55 61 3274 3127; e-mails: betania. [email protected]; and bfq@uwalumni. com Received 20 August 2013; revised 7 November 2013; accepted 7 November 2013. Final version published online 16 December 2013.
Abstract An Amazon soil microbial community metagenomic fosmid library was functionally screened for b-glucosidase activity. Contig analysis of positive clones revealed the presence of two ORFs encoding novel b-glucosidases, AmBGL17 and AmBGL18, from the GH3 and GH1 families, respectively. Both AmBGL17 and AmBGL18 were functionally identified as b-glucosidases. The enzymatic activity of AmBGL17 was further characterized. AmBGL17 was tested with different substrates and showed highest activity on pNPbG substrate with an optimum temperature of 45 °C and an optimum pH of 6. AmBGL17 showed a Vmax of 116 mM s 1 and Km of 0.30 0.017 mM. This is the first report of b-glucosidases from an Amazon soil microbial community using a metagenomic approach.
DOI: 10.1111/1574-6968.12332
MICROBIOLOGY LETTERS
Editor: Juan Imperial Keywords beta-glucosidase; functional screen; GH1; GH3; metagenomic library.
Introduction The metabolic diversity of microbial communities, both the cultivable and uncultivable members, makes them a potentially rich source of novel enzymes for industrial applications, including biofuel production. One way to tap this microbial metabolic resource is to use a combination of functional screening of metagenomic libraries and high-throughput sequencing. Soil is a phylogenetically and functionally hyperdiverse environment (Vos et al., 2013). The forest floor of the Amazon is covered with organic matter of plant origin, which is degraded by microorganisms, enabling efficient recycling of nutrients. Given that up to 60% of plant biomass is cellulose (Hamelinck et al., 2005), it is expected that these microorganisms are able to express a number of cellulosedegrading enzymes, including b-glucosidases. b-glucosidases (b-D-glucoside glucohydrolase, EC 3.2. 1.21) are glycosyl hydrolases that break b-glucosidic bonds between carbohydrate residues in aryl-, amino-, or
FEMS Microbiol Lett 351 (2014) 147–155
alkyl-b-D-glucosides, cyanogenic glucosides, short-chain oligosaccharides, and disaccharides (Bhatia et al., 2002). These oligosaccharides are formed by the synergistic action of endoglucanases (EC 3.2.1.4) and exoglucanases (EC 3.2.1.91) that break the crystalline structure of cellulose. Together, endoglucanases, exoglucanases, and b-glucosidases make a potent system for cellulose degradation, in which b-glucosidases play a critical role (Bhatia et al., 2002). If b-glucosidases are not present in sufficient amounts, not enough glucose will be produced, and cellobiose will accumulate, impacting negatively on glucose formation because cellobiose is an inhibitor of endo- and exoglucanases (Dekker, 1986). b-glucosidases have several biotechnological applications that range from medical applications (i.e. in Gaucher’s disease), to detoxification of cassava cyanogenic glucosides, to aroma enhancement by release of aromatic aglycones in wine-making (Cairns & Esen, 2010). Another application is the use of b-glucosidases in plant biomass deconstruction. Each biotechnological application requires ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
148
b-glucosidases with different biochemical properties, and therefore, a broad range of these enzymes will need to be discovered and characterized. The aim of this study was to identify new b-glucosidases produced by a microbial community from Amazon forest soil. This is the first report of the isolation of b-glucosidases from an Amazon soil microbial community using a metagenomic approach.
Materials and methods Construction of soil metagenomic library
Four Amazon soil samples were collected in a preserved forest region near the city of Moju, Para State, Brazil. Total microbial community DNA was extracted using the protocol described by Smalla et al. (1993). Briefly, 5 mL of NaCl 5 M was added to a tube containing 2 g of soil and 3 g of glass beads (c. 200 lm). Tubes were vortexed three times for 90 s, and 180 lL of SDS 20% was added before tubes were incubated on ice. A total of 4 mL of phenol/chloroform solution (25 : 24 v/v) was then added to the tubes, and the mixture was centrifuged for 8 min at 3250 g at 4 °C. The supernatant was transferred to another tube and extracted with 4 mL of chlorophorm/ isoamyl alcohol (24 : 1 v/v). The tubes were centrifuged again as described above. The supernatant was transferred to another tube, and 500 lL of 5 M NaCl and 7 mL of 100% ethanol were added. Tubes were kept at 40 °C for 40 min and centrifuged for 10 min at 18 000 g. A pellet was formed and washed twice with 70% ethanol prior to resuspension in 200 lL TE 19. The DNA solution was divided into two tubes, and 0.1 g of cesium chloride was added to each tube and homogenized. Tubes were kept at room temperature for 1 h. After this, samples were centrifuged for 20 min at 1250 g. The supernatants were transferred into a tube, and 400 lL of ultrapure water and 300 lL of cold isopropanol were then added followed by centrifugation for 15 min at 10 000 g. The resulting pellet was washed once with cold isopropanol and twice with cold 70% ethanol and centrifuged again as described above. Each final pellet was resuspended in 50 lL of TE 19. High molecular weight DNA in the range of 30–50 kb was selected using pulsed-field gel electrophoresis (PFGE) and used for the construction of a fosmid metagenomic library in the pCC1FOSTM vector with E. coli strain EPI300-T1R as a host, according to the manufacturer’s instructions for CopyControlTM fosmid library kit (Epicentre Biotechnology). b-glucosidase activity function-based screening
Screening for b-glucosidase activity was performed by plating metagenomic library clones on Luria–Bertani (LB) ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
J.C. Bergmann et al.
agar supplemented with 12.5 µg mL 1 of chloramphenicol containing 0.05% (w/v) ferric citrate and 0.01% (w/v) esculin, according to Eberhart et al. (1964). Positive clones displayed a dark halo. Phenotype stability was tested extracting the fosmid from positive clones using the QIAprep Miniprep kit (Qiagen) and re-transforming into EPI300-T1R host cells (Epicentre Biotechnologies). b-glucosidase activity was confirmed using methylumbeliferil-b-D-glycoside (MUG), by overlaying colonies with 1% (w/v) agarose and 2 mM of MUG dissolved in potassium phosphate buffer (50 mM, pH 7.0). Activity was detected as fluorescence after exposure of colonies to UV light (Healy et al., 1995). Fosmid DNA analysis
Two positive clones were sequenced using Illumina technology. Annotation of putative GH-coding genes (CDS) was performed using the Integrated Microbial Genomes (IMG/MER) system (Markowitz et al., 2012). Protein translations of CDS were chosen to be expressed, and a BLAST was performed at UniProt (The UniProt Consortium, 2011). Eight of the best hits were chosen for alignment using WebPrank (L€ oytynoja & Goldman, 2010). Sequences of top BLASTN (NCBI) homolog hits were aligned with WebPrank, and a phylogenetic tree was constructed with MEGA 5.1 software (Tamura et al., 2011) using the neighbor-joining method (Saitou & Nei, 1987) with a bootstrap of 1000. In addition, we used dbCAN (Yin et al., 2012) to identify glycoside hydrolase (GH) families. The theoretical isoelectric point (pI) was predicted using the ExPASy website (http://web.expasy.org/cgi-bin/protparam/ protparam). PCR amplification and cloning
b-glucosidase genes were amplified by PCR using the EK/ LIC cloning kit (Novagen, Germany). For the amplification of the 2250 bp of AmBGL17, a forward primer (5′ GTAGAAGCAACCAAATCGC3′) and a reverse primer (5′ CAACTGCTTGAGAAGATTGG3′) were used. For the amplification of 1401 bp of AmBGL18, a forward primer (5′GTCCCGCCATGCTGCGCTTTCC3′) and a reverse primer (5′TCTGCGNGAGGATCCGGCG3′) were used. Amplification was performed using the following cycles: 1 cycle at 95 °C for 120 s, followed by 20 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 10 s, and extension at 72 °C for 20 s. PCR products were cloned into pCDF-2-EK/LIC, following the manufacturer’s instructions. The resulting plasmids were introduced into the RosettaGamiBTM strain for efficient expression of the enzymes. FEMS Microbiol Lett 351 (2014) 147–155
149
Amazon soil beta-glucosidases
Protein expression and purification
Crude extract was used to confirm the activity of the protein using 4-nitrophenyl-b-D-glucopiranoside (pNPbG) substrate. For this, the pET system 11th manual (Novagen, Darmstadt, Germany) protocol was followed starting from a single colony grown in 10 mL of TB (Terrific Broth) with 30 lg mL 1 of spectinomycin. After induction, flasks were incubated for 18 h at 30 °C. BugBuster Master Mix (Novagen) was used to lyse cells, following manufacturers’ instructions. Ten microliters of phenylmethylsulfonyl fluoride (pMSF) was added to the lysate. The lysate was tested for b-glucosidase activity with the pNPbG assay (described below). The original nucleotide sequence was codon-optimized for E. coli expression by GenScript (Piscataway, NJ) into the vector pCDF-1b and transformed into E. coli BL21 (DE3) Gold from Agilent Technologies (La Jolla, CA). One colony of the transformed bacteria was grown in 4 mL pre-inoculum in terrific broth (TB) containing spectinomycin (30 lg mL 1) overnight in a shaker at 37 °C and used to inoculate 400 mL of TB with spectinomycin. Incubation was at 37 °C and 200 r.p.m. until an OD600 of 0.6 was reached. Protein expression was induced with 200 lL of 1 M isopropyl-b-D-galactopyranoside (IPTG) and incubated for 18 h at 20 °C. Purification was performed using the Ni Sepharose 6 Fast Flow resin (GE Healthcare). Gels were stained with Coomasie blue, and protein quantification was based on band volume and intensity observed in gels using the ImageJ program (http:// rsbweb.nih.gov). Enzyme assays
pNPbG was used as a substrate for enzyme characterization. Standard enzymatic activity was measured by pNP assays according to Deshpande et al. (1984). Briefly, 10 lL of 50 mM pNPbG was added to 10 lL of the diluted purified enzyme in 80 lL of buffer (20 mM HEPES, 50 mM NaCl at pH 6.0). Reaction was stopped by adding 100 lL of 2% Na2CO3 (w/v), and absorbance was read at 405 nm on a SpectraMax M2 spectrophotometer (Molecular Devices). All reactions were performed in triplicate and incubated for 15 min in a thermocycler. Optimum temperature was determined incubating the pure enzyme at temperatures ranging from 20 to 70 °C at pH 6.0. The optimal pH was determined using 80 lL of buffer (10 mM NaOAc, 50 mM MES, and 50 mM HEPES) at eleven different pH ranging from 3.9 to 8.1. Substrate affinity was measured as described above; however, the substrates were 10 lL of 50 mM 4-nitrophenyl-b-D-cellobioside (pNPbC) or 50 mM 4nitrophenyl b-D-xylopyranoside (pNPbX). Enzyme stability FEMS Microbiol Lett 351 (2014) 147–155
was determined at optimum pH and in two different temperatures (the optimum temperature and at 35 °C), and residual activity was analyzed over an 8-h period using the pNPbG assay. Enzyme kinetic parameters were obtained by measuring the rate of hydrolysis of pNPbG using the Michaelis–Menten equation (Johnson & Goody, 2011). Enzymatic reactions were performed under standard conditions with 3 nM of AmBGL17 enzyme and pNPbG substrate ranging from 0.1 to 5 mM. Vmax, Km, and kcat were determined by the Hanes-Woolf plot method using linear regression analysis. Catalytic efficiency (kcat/Km) was also calculated. Accession numbers
AmBGL17 and AMBGL18 nucleotide sequences (i.e. not codon-optimized) were deposited at GenBank database under accession numbers KF433952 and KF433953, respectively. The ID at IMG/MER for fosmid f17 is AmsFos_DRAFT_100282 and for f18 is AmsFos_DRAFT_100264.
Results Soil metagenomic library construction and screening
A fosmid metagenomic library with c. 213 000 clones was successfully constructed. Approximately 97 500 clones were screened for b-glucosidase activity, and five positive clones were identified. Fosmid DNA was extracted and re-transformed back into E. coli to check for phenotype stability. b-glucosidase activity was reproducible in only two clones, which also showed activity when tested using a MUG cellobiose analogue. Sequence analysis
Positive clones for b-glucosidase activity, f17 and f18, were purified, barcoded, and sequenced. Fosmid f17 was almost completely sequenced, and two contigs were obtained, contig 1 with 21 088 bp and contig 2 with 23 227 bp. Fosmid f18 was completely sequenced yielding a single contig of 31 551 bp. For fosmid f17 (contigs 1 and 2), a total of 36 ORFs were identified using the Joint Genome Institute (JGI) annotation pipeline. Contig 1 had 14 ORFs, including one putative b-glucosidase that was chosen to be amplified and one putative a-1,2-mannosidase (Fig. 1a). The putative b-glucosidase was named AmBGL17, for Amazon b-Glucosidase 17. AmBGL17 is predicted to have a molecular mass of 81.7 kDa and a theoretical pI of 4.93. Alignment with similar proteins in the Pfam database and annotation using dbCAN (Yin ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
150
J.C. Bergmann et al.
(a)
(b)
Fig. 1. Schematic of fosmid DNA inserts from b-glucosidase positive clones. (a) Fosmid f17 contig 1 insert. This contig has 21 088 bp, and a total of 14 ORFs are present, two of which (shown in black) are putative carbohydrate-active enzymes: a beta-glucosidase-related glycosidase and a putative alpha-1,2-mannosidase. The ORF for the beta-glucosidase-related glycosidase (1590–3842 bp) was chosen to be investigated. (b) Fosmid f18 partial insert. A total of 30 ORFs were identified in f18, 18 of which are shown. Two of these shown in black are putative carbohydrate-active enzymes: beta-glucosidase/6-phospho-beta-glucosidase/beta-galactosidase and beta-galactosidase/beta-glucoronidase. The ORF for the beta-glucosidase/6-phospho-beta-glucosidase/beta-galactosidase (2206–3609 bp) was chosen to be investigated.
et al., 2012) showed that it belongs to the glycoside hydrolase 3 (GH3) protein family (Henrissat, 1991). Pfam matches indicate that the AmBGL17 protein structure has an N-terminal GH3 domain, a C terminal GH3 domain, and a fibronectin type III-like domain of 71 amino acid residues at the C terminal. For fosmid f18, a total of 30 ORFs were annotated. Analysis of f18 ORFs identified one encoding putative betaglucosidase/6-phospho-beta-glucosidase/beta-galactosidase and a putative beta-galactosidase/beta-glucuronidase (Fig. 1b). The putative beta-glucosidase/6-phospho-betaglucosidase/beta-galactosidase was named AmBGL18 and chosen to be expressed. AmBGL18 is predicted to have a molecular mass of 52.37 kDa and a theoretical pI of 5.12. Alignment with similar proteins in the Pfam database and annotation using dbCAN (Yin et al., 2012) showed that AmBGL18 has one glycosyl hydrolase family 1 (GH1) domain. ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Multiple alignment was performed with similar proteins, and a phylogenetic tree was constructed (Supporting Information, Fig. S1a). AmBGL17 is closely related to a b-glucosidase from a Methanocella paludicola, a putative beta-glucosidase from Caldilinea aerophila and a beta-glucosidase of an Anaerolinea thermophila. A phylogenetic tree was constructed for AmBGL18 (Fig. S1b) and showed a cluster with beta-glucosidases from Corallococcus coralloides, Myxococcus fulvus, Myxococcus xanthus, and Chondromyces apiculatus. Partial alignments of AmBGL17 and AmBGL18 with homologous proteins are shown in Fig. 2a and b, respectively. The AmBGL17 aligned with other b-glucosidases from the UniProt database shows two conserved regions, KHF and SDW characteristic of GH3 proteins. In AmBGL18, two conserved regions present in GH1 proteins, NEP and ENG, were identified (Withers et al., 1990; Wang et al., 1995). FEMS Microbiol Lett 351 (2014) 147–155
Amazon soil beta-glucosidases
151
(a)
(b)
Fig. 2. Partial alignment of b-glucosidases protein sequences. (a) A segment of the AmBGL7 protein aligned with b-glucosidases from different microorganisms. Conserved regions in all GH3 b-glucosidases are marked with asterisks (KHF and SDW). Sequences homologous to AmBGL17 were chosen from UniProt to be aligned except for the first sequence that was chosen from a published paper that had the structure defined: Thermotoga neapolitana (ABI29899.1), Dictyoglomus turgidum (YP_002352162.1), Mahella australiensis (YP_004462668.1), Thermobaculum terrenum (YP_003321925.1), Thermobacillus composti (YP_007211661.1), Alicyclobacillus acidocaldarius (YP_003183780.1), Caldilinea aerophila (YP_005440889.1), Anaerolinea thermophila (YP_004175122.1), Methanocella paludicola (YP_003356366.1). (b) A segment of the AmBGL8 protein aligned with b-glucosidases from different microorganisms. Conserved regions in all GH1 b-glucosidases are marked with asterisks (NEP and ENG). Sequences homologous to AmBGL18 were chosen from UniProt to be aligned except for the first sequence that was chosen from a published paper that had the structure determined: Thermus nonproteolyticus (AF225213), Caldilinea aerophila (YP_005440889.1), Cystobacter fuscus (F8CBN7), Stigmatella aurantiaca (YP_003954970.1), Sorangium cellulosum (YP_001614940.1), Myxococcus fulvus (YP_004665730.1), Myxococcus xanthus (YP_634677.1), Myxococcus sp. (J1SG72), Corallococcus coralloides (YP_005369946.1). Protein alignments was obtained with WebPrank and visualized with MEGA 5.1.
FEMS Microbiol Lett 351 (2014) 147–155
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
152
Enzyme expression, purification, and characterization
The ORF encoding the AmBGL17 putative b-glucosidase was expressed, and the enzyme purified and characterized. AmBGL18 was successfully expressed and shown to have b-glucosidase activity (Fig. S2). However, efforts to purify the protein were not successful, and therefore, its biochemical characterization was not performed. As shown in Fig. 3, a band of 81.7 kDa corresponding to AmBGL17 was obtained, and protein purity was assessed on SDSPAGE as > 90%. To determine substrate specificity of AmBGL17 recombinant enzymes, different substrates were tested (Fig. 4a), and highest activity was observed toward pNPbG for the enzyme. Optimum temperature (Fig. 4b) was tested using the pNPbG, and AmBGL17 had an optimum temperature of 45 °C. Optimum pH was determined toward pNPbG (Fig. 4c). AmBGL17 enzyme was most active in the range between 5.6 and 7.0, pH 6.0 being the optimum pH. Regarding enzyme stability, AmBGL17 showed a relative stability above 50% for 2 h at the optimum temperature of 45 °C and a relative stability above 70% at 35 °C. Enzyme kinetic parameters were determined (Table 1), and the values of standard deviations for AmBGL17 were Km 0.30 0.017 mM and Vmax 116 mM s 1. The value for kcat was calculated for
Fig. 3. SDS-PAGE analysis of purified AmBGL17. Lane 1, PageRulerTM Prestained Protein Ladder (Fermentas); Lane 2, AmBGL17 purified with the size of 81.7 kDa.
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
J.C. Bergmann et al.
AmBGL17 as being 38.57 0.37 s 1, and its catalytic efficiency (kcat/Km) was 128.56 mM 1 s 1.
Discussion The construction of a metagenomic library followed by a functional screen for a specific enzyme activity is one approach to potentially identify novel proteins. Although there are many Amazon soil microbial diversity studies, this is the first report of the construction of an Amazon soil microbial community metagenomic library that was functionally screened for enzymes with potential biotechnological application. In this work, two fosmid metagenomic clones that showed b-glucosidase activity in a functional screen were chosen for sequencing. Analysis of the fosmids’ sequences identified the presence of other putative glycosyl hydrolases, besides the putative b-glucosidases named AmBGL17 and AmBGL18. In fosmid f17, a putative alpha-1,2-mannosidase with 1055 amino acids was next to the putative b-glucosidase AmBGL17, but this ORF was in the opposite DNA strand (Fig. 1). In fosmid f18, a beta-galactosidase/beta-glucuronidase with 1053 aminoacids was adjacent and in the same direction and reading frame as the putative beta-glucosidase AmBGL18. This suggests that maybe both of these enzymes belong to an operon involved in carbohydrate hydrolysis, but further studies are needed to confirm this hypothesis. The phylogenetic tree of AmBGL17 (Fig. S1) showed that it clustered with putative b-glucosidases belonging to Methanocella paludicola, Caldilinea aerophila, and Anaerolinea thermophila. Methanocella paludicola is a methanogenic Archaea that is known for the emission of methane, being responsible for the final step of the anoxic degradation of organic substances (Sakai et al., 2008). Caldilinea aerophila and Anaerolinea thermophila are thermophilic bacteria of the phylum Chloroflexi and were first isolated from a sludge blanket reactor fed with soybean curd (Sekiguchi, 2003). There is no functional evidence for b-glucosidase activity for any of these three proteins that clustered with AmBGL17. Because AmBGL17 has been experimentally shown in this work to encode a protein with b-glucosidase activity, it is expected that these other related proteins have a similar function. Clustering of AmBGL17 in a clade that includes both Archaea and Bacteria may indicate that AmBGL17 comes from a deepbranching unknown microorganism or that horizontal gene transfer is the explanation for the presence of similar proteins in distantly related microorganisms. The phylogenetic tree constructed with AmBGL18 and homologous protein sequences (Fig. S1) showed that AmBGL18 clustered with b-glucosidases from Corallococcus coralloides, Myxococcus fulvus, Myxococcus xanthus, FEMS Microbiol Lett 351 (2014) 147–155
153
Amazon soil beta-glucosidases
Fig. 4. Biochemical characteristics of AmBGL17. (a) Substrate specificity. Relative enzyme activity was measured using 4-Nitrophenyl-b-D-glucopiranoside (pNPbG), 4-nitrophenyl-b-D-cellobioside (pNPbC), and 4-nitrophenyl b-D-xylopyranoside (pNPbX) as substrates; (b) relative enzyme activity over a range of different temperatures, at pH 6.0 (c) relative enzyme activity over a range of different pHs, at the optimum temperature (d) enzyme stability over time determined using pNPbG as substrate, at the optimum temperature and optimum pH. The assay was performed in triplicate, and bars represent the standard deviation.
(a)
(b)
(c)
(d)
Table 1. Biochemical characteristics of b-glucosidases identified in metagenome libraries from different environments Metagenome environment
Opt. pH
Opt. Temp °C
Specific Activity U/mg
Km * (mM)
Polluted soil China South China Sea Polluted soil China (Bgl1D) Polluted soil China (Bgl1E) Yak rumen (RuBG3A) Amazon soil (AmBGL17)
8.0 6.5 10.0 10.0 4.6 6.0
42 40 25 30 40 45
3.36 50.7 10.8 12.6 26 85
0.19 0.39 0.54 2.11 1.06 0.30
Kcat * s 5.28 NI 13.4 27.6 126.6 38.57
1
Kcat/Km s 1 mM 27.79 NI 24.81 13.08 119.44 128.56
1
Reference Jiang et al. (2009) Fang (2010) Jiang et al. (2011) Jiang et al. (2011) Bao et al. (2012) This work
*Enzyme kinetic parameters were determined using pNPbG as substrate. NI, no information available.
and Chondromyces apiculatus. These four microorganisms belong to the phylum Proteobacteria and genus Myxococcales. The identities between AmBGL18 and these putative b-glucosidases were, respectively, 69%, 67%, 66%, and 66%. Given the similarity between AmBGL18 and Proteobacteria, it is possible that AmBGL18 came from Proteobacteria. According to Pfam, AmBGL17 has conserved N and C terminal domains that place it in glycosyl hydrolase family 3 (GH3). As shown in Fig. 2a, the predicted AmBGL17 shared conserved amino acid residues with other putative b-glucosidases as well as with a known b-glucosidase from Thermotoga neapolitana that had its structure predicted by three-dimensional structure homology modeling (Thongpoo et al., 2013). The aspartate within the SDW motif is the conserved catalytic nucleophile in GH3 proteins. The histidine residue in KHF is believed to play an indirect role in catalysis by conformational stabilization or electronic interaction with catalytic moieties (Varghese et al., 1999). Additionally, AmBGL17 has another conserved domain at the C FEMS Microbiol Lett 351 (2014) 147–155
terminus, a fibronectin type III domain (Fn3). Although the functional importance of Fn3 is not completely understood, Fn3 domains have been described in different bacterial extracellular glycosyl hydrolases (Kataeva et al., 2002). Importantly, there is precedent for the presence of Fn3 domain in a b-glucosidase as seen in the Thermotoga neapolidana GH3 thermostable b-glucosidase 3B (Pozzo et al., 2010). According to Pfam, AmBGL18 has one glycosyl hydrolase family 1 (GH1) domain. The acid–base catalyst site was determined as being the glutamic acid (E) in the motif NEP and the nucleophilic glutamic acid (E) in the motif ENG (Bhatia et al., 2002). A multiple sequence alignment (Fig. 2b) revealed that the predicted AmBGL18 protein shares conserved amino acid residues with other putative b-glucosidases as well as with Thermus nonproteolyticus, a thermostable GH1 beta-glucosidase that has been characterized and had its crystal structure determined (Wang et al., 2003). Purified AmBGL17 was tested for multiple enzymatic activities using pNPbG, pNPbC, and pNPbX (Fig. 4a). ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
154
AmBGL17 had high activity toward pNPbG and had low activity toward pNPbX. However, at least under the conditions tested, AmBGL17 cannot be considered as having multiple activities, as the activities measured were small being < 10% of the activity with pNPbG. Experiments demonstrated that AmBGL17 has an optimum temperature of 45 C and a pH range of activity around pH 6.0 (Fig. 4b and 4c). Comparing this result with other b-glucosidases from metagenomic libraries (Table 1), AmBGL17 showed a slightly higher optimum temperature. Enzyme activity at high temperatures is an interesting feature, because at higher temperatures, the solubility of reactants and products is increased, and enzyme activity is higher. Furthermore, reaction velocity is improved due to low reaction viscosity, and risks of contamination are reduced (Harnpicharnchai et al., 2009). As shown in Table 1, b-glucosidases can have a wide range of optimum pHs. Interestingly, the optimum pH of AmBGL17 is similar to the pH of the Amazon soil used in this study (i.e. pH 5.5). The optimum temperature for AmBGL17 was 45 °C. As shown in Fig. 4b, AmBGL17 was still 80% active at 50 °C, but had a sharp drop in activity at 55 °C. AmBGL17 was tested for enzyme stability at two different temperatures (35 and 45 °C). At 35 °C, the enzyme resisted for 2 h with a relative activity above 70%, and after 6 h AmBGL17 relative activity was still above 50%. It should be noted that there are techniques to improve enzyme stability. Certain sugars (e.g. sucrose, trehalose, glucose, and lactose), polyols (e.g. glycerol, ethylene glycerol, xylitol, mannitol, sorbitol, and inositol), salts (e.g. magnesium), aminoacids (e.g. glycine and b-alanine), and surfactants (e.g. Emulgen 147, Tween 20, Cationic Q-86W, and Anionic Neopelex F-25) are known to act as enzyme stabilizers and can be added to enzyme preparations (Ooshima et al., 1986; Timasheff, 1998; Yadav & Prakash, 2009). The kinetic parameters of recombinant AmBGL17 were determined and are shown in Table 1. AmBGL17 has a Vmax of 116 mM s 1 and an affinity constant (Km) of 0.30 mM (0.017). As described in Table 1, the relatively low Km values for AmBGL17 enzymes show high enzyme affinity to the substrate compared to b-glucosidases from the South China sea (0.39 mM; Fang, 2010), a polluted soil in China (0.54 and 2.11 mM; Jiang et al., 2011) and the yak rumen (1.06 mM; Bao et al. 2012). The catalytic rate constant (kcat) was calculated for AmBGL17 and has a turnover number of 38.57 0.37 s 1. Compared to the kcat values for other metagenome b-glucosidases, the kcat for AmBGL17 is relatively high (Table 1). The catalytic efficiency (kcat/Km of 128.56 mM 1 s 1) of AmBGL17 is higher than the values calculated for other b-glucosidases shown in Table 1. In conclusion, soil microbiomes contain some of the highest levels of microbial diversity (Vos et al., 2013). We ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
J.C. Bergmann et al.
have described the construction of a metagenomic large insert library, and the functional screening of this library allowed the identification of two new b-glucosidases, AmBGL17 and AmBGL18, of the GH3 and GH1 families, respectively. AmBGL18 was functionally shown to be a b-glucosidase. Further, a complete biochemical characterization of AmBGL17 enzyme was performed. Given the growing emphasis on synthetic biology, it is likely that the biochemical diversity present in the metagenomes found in environments such as the Amazon soil may become an important source of ‘parts’ when new metabolic pathways are constructed or existing ones are modified with similar enzymes with different kinetic properties for increased pathway efficiency (de Castro et al., 2013).
Acknowledgements This work was supported by grants from FAP-DF, CNPq, CAPES, and Embrapa Macroprograma 2. Part of this work was conducted at the Joint BioEnergy Institute, supported by the Office of Science, Office of Biological and Environmental Research and the U.S. Department of Energy under Contract No. DE-AC02-05CH11231.
References Bao L, Huang Q, Chang L, Sun Q, Zhou J & Lu H (2012) Cloning and characterization of two b-Glucosidase/ Xylosidase enzymes from yak rumen metagenome. Appl Biochem Biotechnol 166: 72–86. Bhatia Y, Mishra S & Bisaria VS (2002) Microbial beta-glucosidases: cloning, properties, and applications. Crit Rev Biotechnol 22: 375–407. Cairns JRK & Esen A (2010) b-Glucosidases. Cell Mol Life Sci 67: 3389–3405. de Castro AP, da Silva MRSS, Quirino BF & Kruger RH (2013) Combining “Omics” strategies to analyze the biotechnological potential of complex microbial environments. Curr Protein Pept Sci 14: 447–458. Manuscript accepted for publication. Dekker RF (1986) Kinetic, inhibition, and stability properties of a commercial beta-D-glucosidase (cellobiase) preparation from Aspergillus niger and its suitability in the hydrolysis of lignocellulose. Biotechnol Bioeng 28: 1438–1442. Deshpande MV, Eriksson K-E & G€ oran Pettersson L (1984) An assay for selective determination of exo-1,4,-b-glucanases in a mixture of cellulolytic enzymes. Anal Biochem 138: 481–487. Eberhart B, Cross DF & Chase LR (1964) Beta-Glucosidase system of Neurospora crassa. I. Beta-Glucosidase and cellulase activities of mutant and wild-type strains. J Bacteriol 87: 761–770. Fang Z (2010) Cloning and characterization of a b-Glucosidase from marine microbial metagenome with excellent glucose tolerance. J Microbiol Biotechnol 20: 1351–1358.
FEMS Microbiol Lett 351 (2014) 147–155
155
Amazon soil beta-glucosidases
Hamelinck CN, van Hooijdonk G & Faaij APC (2005) Ethanol from lignocellulosic biomass: techno-economic performance in short-, middle- and long-term. Biomass Bioenergy 28: 384–410. Harnpicharnchai P, Champreda V, Sornlake W & Eurwilaichitr L (2009) A thermotolerant b-glucosidase isolated from an endophytic fungi, Periconia sp., with a possible use for biomass conversion to sugars. Protein Expr Purif 67: 61–69. Healy FG, Ray RM, Aldrich HC, Wilkie AC, Ingram LO & Shanmugam KT (1995) Direct isolation of functional genes encoding cellulases from the microbial consortia in a thermophilic, anaerobic digester maintained on lignocellulose. Appl Microbiol Biotechnol 43: 667–674. Henrissat B (1991) A classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem J 280(Pt 2): 309–316. Jiang C, Ma G, Li S, Hu T, Che Z, Shen P, Yan B & Wu B (2009) Characterization of a novel beta-glucosidase-like activity from a soul metagenome. J. Microbiol. 47: 542–548. Jiang C, Li SX, Luo FF et al. (2011) Biochemical characterization of two novel b-glucosidase genes by metagenome expression cloning. Bioresour Technol 102: 3272–3278. Johnson KA & Goody RS (2011) The original Michaelis Constant: translation of the 1913 Michaelis-Menten paper. Biochemistry (Mosc) 50: 8264–8269. Kataeva IA, Seidel RD 3rd, Shah A, West LT, Li X-L & Ljungdahl LG (2002) The fibronectin type 3-like repeat from the Clostridium thermocellum cellobiohydrolase CbhA promotes hydrolysis of cellulose by modifying its surface. Appl Environ Microbiol 68: 4292–4300. Lo¨ytynoja A & Goldman N (2010) webPRANK: a phylogeny-aware multiple sequence aligner with interactive alignment browser. BMC Bioinformatics 11: 579. Markowitz VM, Chen IM, Chu K et al. (2012) IMG/M: the integrated metagenome data management and comparative analysis system. Nucleic Acids Res 40: D123–D129. Ooshima H, Sakata M & Harano Y (1986) Enhancement of enzymatic hydrolysis of cellulose by surfactant. Biotechnol Bioeng 28: 1727–1734. Pozzo T, Pasten JL, Karlsson EN & Logan DT (2010) Structural and functional analyses of b-Glucosidase 3B from Thermotoga neapolitana: a thermostable three-domain representative of Glycoside Hydrolase 3. J Mol Biol 397: 724–739. Saitou N & Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406–425. Sakai S, Imachi H, Hanada S, Ohashi A, Harada H & Kamagata Y (2008) Methanocella paludicola gen. nov., sp. nov., a methane-producing archaeon, the first isolate of the lineage “Rice Cluster I”, and proposal of the new archaeal order Methanocellales ord. nov. Int J Syst Evol Microbiol 58: 929–936. Sekiguchi Y (2003) Anaerolinea thermophila gen. nov., sp. nov. and Caldilinea aerophila gen. nov., sp. nov., novel
FEMS Microbiol Lett 351 (2014) 147–155
filamentous thermophiles that represent a previously uncultured lineage of the domain Bacteria at the subphylum level. Int J Syst Evol Microbiol 53: 1843–1851. Smalla K, Cresswell N, Mendonca-Hagler LC, Wolters A & van Elsas JD (1993) Rapid DNA extraction protocol from soil for polymerase chain reaction-mediated amplification. J Appl Microbiol 74: 78–85. Tamura K, Peterson D, Peterson N, Stecher G, Nei M & Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–2739. The UniProt Consortium (2011) Reorganizing the protein space at the Universal Protein Resource (UniProt). Nucleic Acids Res 40: D71–D75. Thongpoo P, McKee LS, Ara ujo AC, Kongsaeree PT & Brumer H (2013) Identification of the acid/base catalyst of a glycoside hydrolase family 3 (GH3) b-glucosidase from Aspergillus niger ASKU28. Biochim Biophys Acta 1830: 2739–2749. Timasheff SN (1998) Control of protein stability and reactions by weakly interacting cosolvents: the simplicity of the complicated. Adv Protein Chem 51: 355–432. Varghese JN, Hrmova M & Fincher GB (1999) Three-dimensional structure of a barley b-D-glucan exohydrolase, a family 3 glycosyl hydrolase. Structure 7: 179–190. Vos M, Wolf AB, Jennings SJ & Kowalchuk GA (2013) Micro-scale determinants of bacterial diversity in soil. FEMS Microbiol Rev 37: 936–954. Wang Q, Trimbur D, Graham R, Warren RA & Withers SG (1995) Identification of the acid/base catalyst in Agrobacterium faecalis beta-glucosidase by kinetic analysis of mutants. Biochemistry (Mosc) 34: 14554–14562. Wang X, He X, Yang S, An X, Chang W & Liang D (2003) Structural basis for thermostability of B-glycosidase from the thermophilic eubacterium Thermus nonproteolyticus HG102. J Bacteriol 185: 4248–4255. Withers SG, Warren RAJ, Street IP, Rupitz K, Kempton JB & Aebersold R (1990) Unequivocal demonstration of the involvement of a glutamate residue as a nucleophile in the mechanism of a retaining glycosidase. J Am Chem Soc 112: 5887–5889. Yadav JK & Prakash V (2009) Thermal stability of alpha-amylase in aqueous cosolvent systems. J Biosci 34: 377–387. Yin Y, Mao X, Yang J, Chen X, Mao F & Xu Y (2012) dbCAN: a web resource for automated carbohydrate-active enzyme annotation. Nucleic Acids Res 40: W445–W451.
Supporting Information Additional Supporting Information may be found in the online version of this article: Fig. S1. Phylogenetic trees of b-glucosidases. Fig. S2. AmBGL18 b-glucosidase activity.
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Discovery of two novel b-glucosidases from an Amazon soil metagenomic library Jessica C. Bergmann1, Ohana Yonara A. Costa1, John M. Gladden2,3, Steven Singer2,4, Richard Heins2,3, Patrik D’haeseleer2,5, Blake A. Simmons2,3 & Betania F. Quirino1,6 lica de Brası´lia, Brası´lia, Brazil; 2Joint BioEnergy Institute, Emeryville, CA, USA; Genomic Sciences and Biotechnology Program, Universidade Cato Biological and Materials Science Center, Sandia National Laboratory, Livermore, CA, USA; 4Earth Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA, USA; 5Bioscience and Biotechnology Division, Lawrence Livermore National Laboratory, Livermore, CA, USA; and 6 Embrapa-Agroenergy, Brasılia, Brazil 1 3
Correspondence: Betania F. Quirino, Embrapa-Agroenergy, Parque Estacß~ao gica, s/n; 70.770-901 Brasılia, DF, Brazil. Biolo Tel.: +55 61 3448 7115; fax: +55 61 3274 3127; e-mails: betania. [email protected]; and bfq@uwalumni. com Received 20 August 2013; revised 7 November 2013; accepted 7 November 2013. Final version published online 16 December 2013.
Abstract An Amazon soil microbial community metagenomic fosmid library was functionally screened for b-glucosidase activity. Contig analysis of positive clones revealed the presence of two ORFs encoding novel b-glucosidases, AmBGL17 and AmBGL18, from the GH3 and GH1 families, respectively. Both AmBGL17 and AmBGL18 were functionally identified as b-glucosidases. The enzymatic activity of AmBGL17 was further characterized. AmBGL17 was tested with different substrates and showed highest activity on pNPbG substrate with an optimum temperature of 45 °C and an optimum pH of 6. AmBGL17 showed a Vmax of 116 mM s 1 and Km of 0.30 0.017 mM. This is the first report of b-glucosidases from an Amazon soil microbial community using a metagenomic approach.
DOI: 10.1111/1574-6968.12332
MICROBIOLOGY LETTERS
Editor: Juan Imperial Keywords beta-glucosidase; functional screen; GH1; GH3; metagenomic library.
Introduction The metabolic diversity of microbial communities, both the cultivable and uncultivable members, makes them a potentially rich source of novel enzymes for industrial applications, including biofuel production. One way to tap this microbial metabolic resource is to use a combination of functional screening of metagenomic libraries and high-throughput sequencing. Soil is a phylogenetically and functionally hyperdiverse environment (Vos et al., 2013). The forest floor of the Amazon is covered with organic matter of plant origin, which is degraded by microorganisms, enabling efficient recycling of nutrients. Given that up to 60% of plant biomass is cellulose (Hamelinck et al., 2005), it is expected that these microorganisms are able to express a number of cellulosedegrading enzymes, including b-glucosidases. b-glucosidases (b-D-glucoside glucohydrolase, EC 3.2. 1.21) are glycosyl hydrolases that break b-glucosidic bonds between carbohydrate residues in aryl-, amino-, or
FEMS Microbiol Lett 351 (2014) 147–155
alkyl-b-D-glucosides, cyanogenic glucosides, short-chain oligosaccharides, and disaccharides (Bhatia et al., 2002). These oligosaccharides are formed by the synergistic action of endoglucanases (EC 3.2.1.4) and exoglucanases (EC 3.2.1.91) that break the crystalline structure of cellulose. Together, endoglucanases, exoglucanases, and b-glucosidases make a potent system for cellulose degradation, in which b-glucosidases play a critical role (Bhatia et al., 2002). If b-glucosidases are not present in sufficient amounts, not enough glucose will be produced, and cellobiose will accumulate, impacting negatively on glucose formation because cellobiose is an inhibitor of endo- and exoglucanases (Dekker, 1986). b-glucosidases have several biotechnological applications that range from medical applications (i.e. in Gaucher’s disease), to detoxification of cassava cyanogenic glucosides, to aroma enhancement by release of aromatic aglycones in wine-making (Cairns & Esen, 2010). Another application is the use of b-glucosidases in plant biomass deconstruction. Each biotechnological application requires ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
148
b-glucosidases with different biochemical properties, and therefore, a broad range of these enzymes will need to be discovered and characterized. The aim of this study was to identify new b-glucosidases produced by a microbial community from Amazon forest soil. This is the first report of the isolation of b-glucosidases from an Amazon soil microbial community using a metagenomic approach.
Materials and methods Construction of soil metagenomic library
Four Amazon soil samples were collected in a preserved forest region near the city of Moju, Para State, Brazil. Total microbial community DNA was extracted using the protocol described by Smalla et al. (1993). Briefly, 5 mL of NaCl 5 M was added to a tube containing 2 g of soil and 3 g of glass beads (c. 200 lm). Tubes were vortexed three times for 90 s, and 180 lL of SDS 20% was added before tubes were incubated on ice. A total of 4 mL of phenol/chloroform solution (25 : 24 v/v) was then added to the tubes, and the mixture was centrifuged for 8 min at 3250 g at 4 °C. The supernatant was transferred to another tube and extracted with 4 mL of chlorophorm/ isoamyl alcohol (24 : 1 v/v). The tubes were centrifuged again as described above. The supernatant was transferred to another tube, and 500 lL of 5 M NaCl and 7 mL of 100% ethanol were added. Tubes were kept at 40 °C for 40 min and centrifuged for 10 min at 18 000 g. A pellet was formed and washed twice with 70% ethanol prior to resuspension in 200 lL TE 19. The DNA solution was divided into two tubes, and 0.1 g of cesium chloride was added to each tube and homogenized. Tubes were kept at room temperature for 1 h. After this, samples were centrifuged for 20 min at 1250 g. The supernatants were transferred into a tube, and 400 lL of ultrapure water and 300 lL of cold isopropanol were then added followed by centrifugation for 15 min at 10 000 g. The resulting pellet was washed once with cold isopropanol and twice with cold 70% ethanol and centrifuged again as described above. Each final pellet was resuspended in 50 lL of TE 19. High molecular weight DNA in the range of 30–50 kb was selected using pulsed-field gel electrophoresis (PFGE) and used for the construction of a fosmid metagenomic library in the pCC1FOSTM vector with E. coli strain EPI300-T1R as a host, according to the manufacturer’s instructions for CopyControlTM fosmid library kit (Epicentre Biotechnology). b-glucosidase activity function-based screening
Screening for b-glucosidase activity was performed by plating metagenomic library clones on Luria–Bertani (LB) ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
J.C. Bergmann et al.
agar supplemented with 12.5 µg mL 1 of chloramphenicol containing 0.05% (w/v) ferric citrate and 0.01% (w/v) esculin, according to Eberhart et al. (1964). Positive clones displayed a dark halo. Phenotype stability was tested extracting the fosmid from positive clones using the QIAprep Miniprep kit (Qiagen) and re-transforming into EPI300-T1R host cells (Epicentre Biotechnologies). b-glucosidase activity was confirmed using methylumbeliferil-b-D-glycoside (MUG), by overlaying colonies with 1% (w/v) agarose and 2 mM of MUG dissolved in potassium phosphate buffer (50 mM, pH 7.0). Activity was detected as fluorescence after exposure of colonies to UV light (Healy et al., 1995). Fosmid DNA analysis
Two positive clones were sequenced using Illumina technology. Annotation of putative GH-coding genes (CDS) was performed using the Integrated Microbial Genomes (IMG/MER) system (Markowitz et al., 2012). Protein translations of CDS were chosen to be expressed, and a BLAST was performed at UniProt (The UniProt Consortium, 2011). Eight of the best hits were chosen for alignment using WebPrank (L€ oytynoja & Goldman, 2010). Sequences of top BLASTN (NCBI) homolog hits were aligned with WebPrank, and a phylogenetic tree was constructed with MEGA 5.1 software (Tamura et al., 2011) using the neighbor-joining method (Saitou & Nei, 1987) with a bootstrap of 1000. In addition, we used dbCAN (Yin et al., 2012) to identify glycoside hydrolase (GH) families. The theoretical isoelectric point (pI) was predicted using the ExPASy website (http://web.expasy.org/cgi-bin/protparam/ protparam). PCR amplification and cloning
b-glucosidase genes were amplified by PCR using the EK/ LIC cloning kit (Novagen, Germany). For the amplification of the 2250 bp of AmBGL17, a forward primer (5′ GTAGAAGCAACCAAATCGC3′) and a reverse primer (5′ CAACTGCTTGAGAAGATTGG3′) were used. For the amplification of 1401 bp of AmBGL18, a forward primer (5′GTCCCGCCATGCTGCGCTTTCC3′) and a reverse primer (5′TCTGCGNGAGGATCCGGCG3′) were used. Amplification was performed using the following cycles: 1 cycle at 95 °C for 120 s, followed by 20 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 10 s, and extension at 72 °C for 20 s. PCR products were cloned into pCDF-2-EK/LIC, following the manufacturer’s instructions. The resulting plasmids were introduced into the RosettaGamiBTM strain for efficient expression of the enzymes. FEMS Microbiol Lett 351 (2014) 147–155
149
Amazon soil beta-glucosidases
Protein expression and purification
Crude extract was used to confirm the activity of the protein using 4-nitrophenyl-b-D-glucopiranoside (pNPbG) substrate. For this, the pET system 11th manual (Novagen, Darmstadt, Germany) protocol was followed starting from a single colony grown in 10 mL of TB (Terrific Broth) with 30 lg mL 1 of spectinomycin. After induction, flasks were incubated for 18 h at 30 °C. BugBuster Master Mix (Novagen) was used to lyse cells, following manufacturers’ instructions. Ten microliters of phenylmethylsulfonyl fluoride (pMSF) was added to the lysate. The lysate was tested for b-glucosidase activity with the pNPbG assay (described below). The original nucleotide sequence was codon-optimized for E. coli expression by GenScript (Piscataway, NJ) into the vector pCDF-1b and transformed into E. coli BL21 (DE3) Gold from Agilent Technologies (La Jolla, CA). One colony of the transformed bacteria was grown in 4 mL pre-inoculum in terrific broth (TB) containing spectinomycin (30 lg mL 1) overnight in a shaker at 37 °C and used to inoculate 400 mL of TB with spectinomycin. Incubation was at 37 °C and 200 r.p.m. until an OD600 of 0.6 was reached. Protein expression was induced with 200 lL of 1 M isopropyl-b-D-galactopyranoside (IPTG) and incubated for 18 h at 20 °C. Purification was performed using the Ni Sepharose 6 Fast Flow resin (GE Healthcare). Gels were stained with Coomasie blue, and protein quantification was based on band volume and intensity observed in gels using the ImageJ program (http:// rsbweb.nih.gov). Enzyme assays
pNPbG was used as a substrate for enzyme characterization. Standard enzymatic activity was measured by pNP assays according to Deshpande et al. (1984). Briefly, 10 lL of 50 mM pNPbG was added to 10 lL of the diluted purified enzyme in 80 lL of buffer (20 mM HEPES, 50 mM NaCl at pH 6.0). Reaction was stopped by adding 100 lL of 2% Na2CO3 (w/v), and absorbance was read at 405 nm on a SpectraMax M2 spectrophotometer (Molecular Devices). All reactions were performed in triplicate and incubated for 15 min in a thermocycler. Optimum temperature was determined incubating the pure enzyme at temperatures ranging from 20 to 70 °C at pH 6.0. The optimal pH was determined using 80 lL of buffer (10 mM NaOAc, 50 mM MES, and 50 mM HEPES) at eleven different pH ranging from 3.9 to 8.1. Substrate affinity was measured as described above; however, the substrates were 10 lL of 50 mM 4-nitrophenyl-b-D-cellobioside (pNPbC) or 50 mM 4nitrophenyl b-D-xylopyranoside (pNPbX). Enzyme stability FEMS Microbiol Lett 351 (2014) 147–155
was determined at optimum pH and in two different temperatures (the optimum temperature and at 35 °C), and residual activity was analyzed over an 8-h period using the pNPbG assay. Enzyme kinetic parameters were obtained by measuring the rate of hydrolysis of pNPbG using the Michaelis–Menten equation (Johnson & Goody, 2011). Enzymatic reactions were performed under standard conditions with 3 nM of AmBGL17 enzyme and pNPbG substrate ranging from 0.1 to 5 mM. Vmax, Km, and kcat were determined by the Hanes-Woolf plot method using linear regression analysis. Catalytic efficiency (kcat/Km) was also calculated. Accession numbers
AmBGL17 and AMBGL18 nucleotide sequences (i.e. not codon-optimized) were deposited at GenBank database under accession numbers KF433952 and KF433953, respectively. The ID at IMG/MER for fosmid f17 is AmsFos_DRAFT_100282 and for f18 is AmsFos_DRAFT_100264.
Results Soil metagenomic library construction and screening
A fosmid metagenomic library with c. 213 000 clones was successfully constructed. Approximately 97 500 clones were screened for b-glucosidase activity, and five positive clones were identified. Fosmid DNA was extracted and re-transformed back into E. coli to check for phenotype stability. b-glucosidase activity was reproducible in only two clones, which also showed activity when tested using a MUG cellobiose analogue. Sequence analysis
Positive clones for b-glucosidase activity, f17 and f18, were purified, barcoded, and sequenced. Fosmid f17 was almost completely sequenced, and two contigs were obtained, contig 1 with 21 088 bp and contig 2 with 23 227 bp. Fosmid f18 was completely sequenced yielding a single contig of 31 551 bp. For fosmid f17 (contigs 1 and 2), a total of 36 ORFs were identified using the Joint Genome Institute (JGI) annotation pipeline. Contig 1 had 14 ORFs, including one putative b-glucosidase that was chosen to be amplified and one putative a-1,2-mannosidase (Fig. 1a). The putative b-glucosidase was named AmBGL17, for Amazon b-Glucosidase 17. AmBGL17 is predicted to have a molecular mass of 81.7 kDa and a theoretical pI of 4.93. Alignment with similar proteins in the Pfam database and annotation using dbCAN (Yin ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
150
J.C. Bergmann et al.
(a)
(b)
Fig. 1. Schematic of fosmid DNA inserts from b-glucosidase positive clones. (a) Fosmid f17 contig 1 insert. This contig has 21 088 bp, and a total of 14 ORFs are present, two of which (shown in black) are putative carbohydrate-active enzymes: a beta-glucosidase-related glycosidase and a putative alpha-1,2-mannosidase. The ORF for the beta-glucosidase-related glycosidase (1590–3842 bp) was chosen to be investigated. (b) Fosmid f18 partial insert. A total of 30 ORFs were identified in f18, 18 of which are shown. Two of these shown in black are putative carbohydrate-active enzymes: beta-glucosidase/6-phospho-beta-glucosidase/beta-galactosidase and beta-galactosidase/beta-glucoronidase. The ORF for the beta-glucosidase/6-phospho-beta-glucosidase/beta-galactosidase (2206–3609 bp) was chosen to be investigated.
et al., 2012) showed that it belongs to the glycoside hydrolase 3 (GH3) protein family (Henrissat, 1991). Pfam matches indicate that the AmBGL17 protein structure has an N-terminal GH3 domain, a C terminal GH3 domain, and a fibronectin type III-like domain of 71 amino acid residues at the C terminal. For fosmid f18, a total of 30 ORFs were annotated. Analysis of f18 ORFs identified one encoding putative betaglucosidase/6-phospho-beta-glucosidase/beta-galactosidase and a putative beta-galactosidase/beta-glucuronidase (Fig. 1b). The putative beta-glucosidase/6-phospho-betaglucosidase/beta-galactosidase was named AmBGL18 and chosen to be expressed. AmBGL18 is predicted to have a molecular mass of 52.37 kDa and a theoretical pI of 5.12. Alignment with similar proteins in the Pfam database and annotation using dbCAN (Yin et al., 2012) showed that AmBGL18 has one glycosyl hydrolase family 1 (GH1) domain. ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Multiple alignment was performed with similar proteins, and a phylogenetic tree was constructed (Supporting Information, Fig. S1a). AmBGL17 is closely related to a b-glucosidase from a Methanocella paludicola, a putative beta-glucosidase from Caldilinea aerophila and a beta-glucosidase of an Anaerolinea thermophila. A phylogenetic tree was constructed for AmBGL18 (Fig. S1b) and showed a cluster with beta-glucosidases from Corallococcus coralloides, Myxococcus fulvus, Myxococcus xanthus, and Chondromyces apiculatus. Partial alignments of AmBGL17 and AmBGL18 with homologous proteins are shown in Fig. 2a and b, respectively. The AmBGL17 aligned with other b-glucosidases from the UniProt database shows two conserved regions, KHF and SDW characteristic of GH3 proteins. In AmBGL18, two conserved regions present in GH1 proteins, NEP and ENG, were identified (Withers et al., 1990; Wang et al., 1995). FEMS Microbiol Lett 351 (2014) 147–155
Amazon soil beta-glucosidases
151
(a)
(b)
Fig. 2. Partial alignment of b-glucosidases protein sequences. (a) A segment of the AmBGL7 protein aligned with b-glucosidases from different microorganisms. Conserved regions in all GH3 b-glucosidases are marked with asterisks (KHF and SDW). Sequences homologous to AmBGL17 were chosen from UniProt to be aligned except for the first sequence that was chosen from a published paper that had the structure defined: Thermotoga neapolitana (ABI29899.1), Dictyoglomus turgidum (YP_002352162.1), Mahella australiensis (YP_004462668.1), Thermobaculum terrenum (YP_003321925.1), Thermobacillus composti (YP_007211661.1), Alicyclobacillus acidocaldarius (YP_003183780.1), Caldilinea aerophila (YP_005440889.1), Anaerolinea thermophila (YP_004175122.1), Methanocella paludicola (YP_003356366.1). (b) A segment of the AmBGL8 protein aligned with b-glucosidases from different microorganisms. Conserved regions in all GH1 b-glucosidases are marked with asterisks (NEP and ENG). Sequences homologous to AmBGL18 were chosen from UniProt to be aligned except for the first sequence that was chosen from a published paper that had the structure determined: Thermus nonproteolyticus (AF225213), Caldilinea aerophila (YP_005440889.1), Cystobacter fuscus (F8CBN7), Stigmatella aurantiaca (YP_003954970.1), Sorangium cellulosum (YP_001614940.1), Myxococcus fulvus (YP_004665730.1), Myxococcus xanthus (YP_634677.1), Myxococcus sp. (J1SG72), Corallococcus coralloides (YP_005369946.1). Protein alignments was obtained with WebPrank and visualized with MEGA 5.1.
FEMS Microbiol Lett 351 (2014) 147–155
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
152
Enzyme expression, purification, and characterization
The ORF encoding the AmBGL17 putative b-glucosidase was expressed, and the enzyme purified and characterized. AmBGL18 was successfully expressed and shown to have b-glucosidase activity (Fig. S2). However, efforts to purify the protein were not successful, and therefore, its biochemical characterization was not performed. As shown in Fig. 3, a band of 81.7 kDa corresponding to AmBGL17 was obtained, and protein purity was assessed on SDSPAGE as > 90%. To determine substrate specificity of AmBGL17 recombinant enzymes, different substrates were tested (Fig. 4a), and highest activity was observed toward pNPbG for the enzyme. Optimum temperature (Fig. 4b) was tested using the pNPbG, and AmBGL17 had an optimum temperature of 45 °C. Optimum pH was determined toward pNPbG (Fig. 4c). AmBGL17 enzyme was most active in the range between 5.6 and 7.0, pH 6.0 being the optimum pH. Regarding enzyme stability, AmBGL17 showed a relative stability above 50% for 2 h at the optimum temperature of 45 °C and a relative stability above 70% at 35 °C. Enzyme kinetic parameters were determined (Table 1), and the values of standard deviations for AmBGL17 were Km 0.30 0.017 mM and Vmax 116 mM s 1. The value for kcat was calculated for
Fig. 3. SDS-PAGE analysis of purified AmBGL17. Lane 1, PageRulerTM Prestained Protein Ladder (Fermentas); Lane 2, AmBGL17 purified with the size of 81.7 kDa.
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
J.C. Bergmann et al.
AmBGL17 as being 38.57 0.37 s 1, and its catalytic efficiency (kcat/Km) was 128.56 mM 1 s 1.
Discussion The construction of a metagenomic library followed by a functional screen for a specific enzyme activity is one approach to potentially identify novel proteins. Although there are many Amazon soil microbial diversity studies, this is the first report of the construction of an Amazon soil microbial community metagenomic library that was functionally screened for enzymes with potential biotechnological application. In this work, two fosmid metagenomic clones that showed b-glucosidase activity in a functional screen were chosen for sequencing. Analysis of the fosmids’ sequences identified the presence of other putative glycosyl hydrolases, besides the putative b-glucosidases named AmBGL17 and AmBGL18. In fosmid f17, a putative alpha-1,2-mannosidase with 1055 amino acids was next to the putative b-glucosidase AmBGL17, but this ORF was in the opposite DNA strand (Fig. 1). In fosmid f18, a beta-galactosidase/beta-glucuronidase with 1053 aminoacids was adjacent and in the same direction and reading frame as the putative beta-glucosidase AmBGL18. This suggests that maybe both of these enzymes belong to an operon involved in carbohydrate hydrolysis, but further studies are needed to confirm this hypothesis. The phylogenetic tree of AmBGL17 (Fig. S1) showed that it clustered with putative b-glucosidases belonging to Methanocella paludicola, Caldilinea aerophila, and Anaerolinea thermophila. Methanocella paludicola is a methanogenic Archaea that is known for the emission of methane, being responsible for the final step of the anoxic degradation of organic substances (Sakai et al., 2008). Caldilinea aerophila and Anaerolinea thermophila are thermophilic bacteria of the phylum Chloroflexi and were first isolated from a sludge blanket reactor fed with soybean curd (Sekiguchi, 2003). There is no functional evidence for b-glucosidase activity for any of these three proteins that clustered with AmBGL17. Because AmBGL17 has been experimentally shown in this work to encode a protein with b-glucosidase activity, it is expected that these other related proteins have a similar function. Clustering of AmBGL17 in a clade that includes both Archaea and Bacteria may indicate that AmBGL17 comes from a deepbranching unknown microorganism or that horizontal gene transfer is the explanation for the presence of similar proteins in distantly related microorganisms. The phylogenetic tree constructed with AmBGL18 and homologous protein sequences (Fig. S1) showed that AmBGL18 clustered with b-glucosidases from Corallococcus coralloides, Myxococcus fulvus, Myxococcus xanthus, FEMS Microbiol Lett 351 (2014) 147–155
153
Amazon soil beta-glucosidases
Fig. 4. Biochemical characteristics of AmBGL17. (a) Substrate specificity. Relative enzyme activity was measured using 4-Nitrophenyl-b-D-glucopiranoside (pNPbG), 4-nitrophenyl-b-D-cellobioside (pNPbC), and 4-nitrophenyl b-D-xylopyranoside (pNPbX) as substrates; (b) relative enzyme activity over a range of different temperatures, at pH 6.0 (c) relative enzyme activity over a range of different pHs, at the optimum temperature (d) enzyme stability over time determined using pNPbG as substrate, at the optimum temperature and optimum pH. The assay was performed in triplicate, and bars represent the standard deviation.
(a)
(b)
(c)
(d)
Table 1. Biochemical characteristics of b-glucosidases identified in metagenome libraries from different environments Metagenome environment
Opt. pH
Opt. Temp °C
Specific Activity U/mg
Km * (mM)
Polluted soil China South China Sea Polluted soil China (Bgl1D) Polluted soil China (Bgl1E) Yak rumen (RuBG3A) Amazon soil (AmBGL17)
8.0 6.5 10.0 10.0 4.6 6.0
42 40 25 30 40 45
3.36 50.7 10.8 12.6 26 85
0.19 0.39 0.54 2.11 1.06 0.30
Kcat * s 5.28 NI 13.4 27.6 126.6 38.57
1
Kcat/Km s 1 mM 27.79 NI 24.81 13.08 119.44 128.56
1
Reference Jiang et al. (2009) Fang (2010) Jiang et al. (2011) Jiang et al. (2011) Bao et al. (2012) This work
*Enzyme kinetic parameters were determined using pNPbG as substrate. NI, no information available.
and Chondromyces apiculatus. These four microorganisms belong to the phylum Proteobacteria and genus Myxococcales. The identities between AmBGL18 and these putative b-glucosidases were, respectively, 69%, 67%, 66%, and 66%. Given the similarity between AmBGL18 and Proteobacteria, it is possible that AmBGL18 came from Proteobacteria. According to Pfam, AmBGL17 has conserved N and C terminal domains that place it in glycosyl hydrolase family 3 (GH3). As shown in Fig. 2a, the predicted AmBGL17 shared conserved amino acid residues with other putative b-glucosidases as well as with a known b-glucosidase from Thermotoga neapolitana that had its structure predicted by three-dimensional structure homology modeling (Thongpoo et al., 2013). The aspartate within the SDW motif is the conserved catalytic nucleophile in GH3 proteins. The histidine residue in KHF is believed to play an indirect role in catalysis by conformational stabilization or electronic interaction with catalytic moieties (Varghese et al., 1999). Additionally, AmBGL17 has another conserved domain at the C FEMS Microbiol Lett 351 (2014) 147–155
terminus, a fibronectin type III domain (Fn3). Although the functional importance of Fn3 is not completely understood, Fn3 domains have been described in different bacterial extracellular glycosyl hydrolases (Kataeva et al., 2002). Importantly, there is precedent for the presence of Fn3 domain in a b-glucosidase as seen in the Thermotoga neapolidana GH3 thermostable b-glucosidase 3B (Pozzo et al., 2010). According to Pfam, AmBGL18 has one glycosyl hydrolase family 1 (GH1) domain. The acid–base catalyst site was determined as being the glutamic acid (E) in the motif NEP and the nucleophilic glutamic acid (E) in the motif ENG (Bhatia et al., 2002). A multiple sequence alignment (Fig. 2b) revealed that the predicted AmBGL18 protein shares conserved amino acid residues with other putative b-glucosidases as well as with Thermus nonproteolyticus, a thermostable GH1 beta-glucosidase that has been characterized and had its crystal structure determined (Wang et al., 2003). Purified AmBGL17 was tested for multiple enzymatic activities using pNPbG, pNPbC, and pNPbX (Fig. 4a). ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
154
AmBGL17 had high activity toward pNPbG and had low activity toward pNPbX. However, at least under the conditions tested, AmBGL17 cannot be considered as having multiple activities, as the activities measured were small being < 10% of the activity with pNPbG. Experiments demonstrated that AmBGL17 has an optimum temperature of 45 C and a pH range of activity around pH 6.0 (Fig. 4b and 4c). Comparing this result with other b-glucosidases from metagenomic libraries (Table 1), AmBGL17 showed a slightly higher optimum temperature. Enzyme activity at high temperatures is an interesting feature, because at higher temperatures, the solubility of reactants and products is increased, and enzyme activity is higher. Furthermore, reaction velocity is improved due to low reaction viscosity, and risks of contamination are reduced (Harnpicharnchai et al., 2009). As shown in Table 1, b-glucosidases can have a wide range of optimum pHs. Interestingly, the optimum pH of AmBGL17 is similar to the pH of the Amazon soil used in this study (i.e. pH 5.5). The optimum temperature for AmBGL17 was 45 °C. As shown in Fig. 4b, AmBGL17 was still 80% active at 50 °C, but had a sharp drop in activity at 55 °C. AmBGL17 was tested for enzyme stability at two different temperatures (35 and 45 °C). At 35 °C, the enzyme resisted for 2 h with a relative activity above 70%, and after 6 h AmBGL17 relative activity was still above 50%. It should be noted that there are techniques to improve enzyme stability. Certain sugars (e.g. sucrose, trehalose, glucose, and lactose), polyols (e.g. glycerol, ethylene glycerol, xylitol, mannitol, sorbitol, and inositol), salts (e.g. magnesium), aminoacids (e.g. glycine and b-alanine), and surfactants (e.g. Emulgen 147, Tween 20, Cationic Q-86W, and Anionic Neopelex F-25) are known to act as enzyme stabilizers and can be added to enzyme preparations (Ooshima et al., 1986; Timasheff, 1998; Yadav & Prakash, 2009). The kinetic parameters of recombinant AmBGL17 were determined and are shown in Table 1. AmBGL17 has a Vmax of 116 mM s 1 and an affinity constant (Km) of 0.30 mM (0.017). As described in Table 1, the relatively low Km values for AmBGL17 enzymes show high enzyme affinity to the substrate compared to b-glucosidases from the South China sea (0.39 mM; Fang, 2010), a polluted soil in China (0.54 and 2.11 mM; Jiang et al., 2011) and the yak rumen (1.06 mM; Bao et al. 2012). The catalytic rate constant (kcat) was calculated for AmBGL17 and has a turnover number of 38.57 0.37 s 1. Compared to the kcat values for other metagenome b-glucosidases, the kcat for AmBGL17 is relatively high (Table 1). The catalytic efficiency (kcat/Km of 128.56 mM 1 s 1) of AmBGL17 is higher than the values calculated for other b-glucosidases shown in Table 1. In conclusion, soil microbiomes contain some of the highest levels of microbial diversity (Vos et al., 2013). We ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
J.C. Bergmann et al.
have described the construction of a metagenomic large insert library, and the functional screening of this library allowed the identification of two new b-glucosidases, AmBGL17 and AmBGL18, of the GH3 and GH1 families, respectively. AmBGL18 was functionally shown to be a b-glucosidase. Further, a complete biochemical characterization of AmBGL17 enzyme was performed. Given the growing emphasis on synthetic biology, it is likely that the biochemical diversity present in the metagenomes found in environments such as the Amazon soil may become an important source of ‘parts’ when new metabolic pathways are constructed or existing ones are modified with similar enzymes with different kinetic properties for increased pathway efficiency (de Castro et al., 2013).
Acknowledgements This work was supported by grants from FAP-DF, CNPq, CAPES, and Embrapa Macroprograma 2. Part of this work was conducted at the Joint BioEnergy Institute, supported by the Office of Science, Office of Biological and Environmental Research and the U.S. Department of Energy under Contract No. DE-AC02-05CH11231.
References Bao L, Huang Q, Chang L, Sun Q, Zhou J & Lu H (2012) Cloning and characterization of two b-Glucosidase/ Xylosidase enzymes from yak rumen metagenome. Appl Biochem Biotechnol 166: 72–86. Bhatia Y, Mishra S & Bisaria VS (2002) Microbial beta-glucosidases: cloning, properties, and applications. Crit Rev Biotechnol 22: 375–407. Cairns JRK & Esen A (2010) b-Glucosidases. Cell Mol Life Sci 67: 3389–3405. de Castro AP, da Silva MRSS, Quirino BF & Kruger RH (2013) Combining “Omics” strategies to analyze the biotechnological potential of complex microbial environments. Curr Protein Pept Sci 14: 447–458. Manuscript accepted for publication. Dekker RF (1986) Kinetic, inhibition, and stability properties of a commercial beta-D-glucosidase (cellobiase) preparation from Aspergillus niger and its suitability in the hydrolysis of lignocellulose. Biotechnol Bioeng 28: 1438–1442. Deshpande MV, Eriksson K-E & G€ oran Pettersson L (1984) An assay for selective determination of exo-1,4,-b-glucanases in a mixture of cellulolytic enzymes. Anal Biochem 138: 481–487. Eberhart B, Cross DF & Chase LR (1964) Beta-Glucosidase system of Neurospora crassa. I. Beta-Glucosidase and cellulase activities of mutant and wild-type strains. J Bacteriol 87: 761–770. Fang Z (2010) Cloning and characterization of a b-Glucosidase from marine microbial metagenome with excellent glucose tolerance. J Microbiol Biotechnol 20: 1351–1358.
FEMS Microbiol Lett 351 (2014) 147–155
155
Amazon soil beta-glucosidases
Hamelinck CN, van Hooijdonk G & Faaij APC (2005) Ethanol from lignocellulosic biomass: techno-economic performance in short-, middle- and long-term. Biomass Bioenergy 28: 384–410. Harnpicharnchai P, Champreda V, Sornlake W & Eurwilaichitr L (2009) A thermotolerant b-glucosidase isolated from an endophytic fungi, Periconia sp., with a possible use for biomass conversion to sugars. Protein Expr Purif 67: 61–69. Healy FG, Ray RM, Aldrich HC, Wilkie AC, Ingram LO & Shanmugam KT (1995) Direct isolation of functional genes encoding cellulases from the microbial consortia in a thermophilic, anaerobic digester maintained on lignocellulose. Appl Microbiol Biotechnol 43: 667–674. Henrissat B (1991) A classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem J 280(Pt 2): 309–316. Jiang C, Ma G, Li S, Hu T, Che Z, Shen P, Yan B & Wu B (2009) Characterization of a novel beta-glucosidase-like activity from a soul metagenome. J. Microbiol. 47: 542–548. Jiang C, Li SX, Luo FF et al. (2011) Biochemical characterization of two novel b-glucosidase genes by metagenome expression cloning. Bioresour Technol 102: 3272–3278. Johnson KA & Goody RS (2011) The original Michaelis Constant: translation of the 1913 Michaelis-Menten paper. Biochemistry (Mosc) 50: 8264–8269. Kataeva IA, Seidel RD 3rd, Shah A, West LT, Li X-L & Ljungdahl LG (2002) The fibronectin type 3-like repeat from the Clostridium thermocellum cellobiohydrolase CbhA promotes hydrolysis of cellulose by modifying its surface. Appl Environ Microbiol 68: 4292–4300. Lo¨ytynoja A & Goldman N (2010) webPRANK: a phylogeny-aware multiple sequence aligner with interactive alignment browser. BMC Bioinformatics 11: 579. Markowitz VM, Chen IM, Chu K et al. (2012) IMG/M: the integrated metagenome data management and comparative analysis system. Nucleic Acids Res 40: D123–D129. Ooshima H, Sakata M & Harano Y (1986) Enhancement of enzymatic hydrolysis of cellulose by surfactant. Biotechnol Bioeng 28: 1727–1734. Pozzo T, Pasten JL, Karlsson EN & Logan DT (2010) Structural and functional analyses of b-Glucosidase 3B from Thermotoga neapolitana: a thermostable three-domain representative of Glycoside Hydrolase 3. J Mol Biol 397: 724–739. Saitou N & Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406–425. Sakai S, Imachi H, Hanada S, Ohashi A, Harada H & Kamagata Y (2008) Methanocella paludicola gen. nov., sp. nov., a methane-producing archaeon, the first isolate of the lineage “Rice Cluster I”, and proposal of the new archaeal order Methanocellales ord. nov. Int J Syst Evol Microbiol 58: 929–936. Sekiguchi Y (2003) Anaerolinea thermophila gen. nov., sp. nov. and Caldilinea aerophila gen. nov., sp. nov., novel
FEMS Microbiol Lett 351 (2014) 147–155
filamentous thermophiles that represent a previously uncultured lineage of the domain Bacteria at the subphylum level. Int J Syst Evol Microbiol 53: 1843–1851. Smalla K, Cresswell N, Mendonca-Hagler LC, Wolters A & van Elsas JD (1993) Rapid DNA extraction protocol from soil for polymerase chain reaction-mediated amplification. J Appl Microbiol 74: 78–85. Tamura K, Peterson D, Peterson N, Stecher G, Nei M & Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–2739. The UniProt Consortium (2011) Reorganizing the protein space at the Universal Protein Resource (UniProt). Nucleic Acids Res 40: D71–D75. Thongpoo P, McKee LS, Ara ujo AC, Kongsaeree PT & Brumer H (2013) Identification of the acid/base catalyst of a glycoside hydrolase family 3 (GH3) b-glucosidase from Aspergillus niger ASKU28. Biochim Biophys Acta 1830: 2739–2749. Timasheff SN (1998) Control of protein stability and reactions by weakly interacting cosolvents: the simplicity of the complicated. Adv Protein Chem 51: 355–432. Varghese JN, Hrmova M & Fincher GB (1999) Three-dimensional structure of a barley b-D-glucan exohydrolase, a family 3 glycosyl hydrolase. Structure 7: 179–190. Vos M, Wolf AB, Jennings SJ & Kowalchuk GA (2013) Micro-scale determinants of bacterial diversity in soil. FEMS Microbiol Rev 37: 936–954. Wang Q, Trimbur D, Graham R, Warren RA & Withers SG (1995) Identification of the acid/base catalyst in Agrobacterium faecalis beta-glucosidase by kinetic analysis of mutants. Biochemistry (Mosc) 34: 14554–14562. Wang X, He X, Yang S, An X, Chang W & Liang D (2003) Structural basis for thermostability of B-glycosidase from the thermophilic eubacterium Thermus nonproteolyticus HG102. J Bacteriol 185: 4248–4255. Withers SG, Warren RAJ, Street IP, Rupitz K, Kempton JB & Aebersold R (1990) Unequivocal demonstration of the involvement of a glutamate residue as a nucleophile in the mechanism of a retaining glycosidase. J Am Chem Soc 112: 5887–5889. Yadav JK & Prakash V (2009) Thermal stability of alpha-amylase in aqueous cosolvent systems. J Biosci 34: 377–387. Yin Y, Mao X, Yang J, Chen X, Mao F & Xu Y (2012) dbCAN: a web resource for automated carbohydrate-active enzyme annotation. Nucleic Acids Res 40: W445–W451.
Supporting Information Additional Supporting Information may be found in the online version of this article: Fig. S1. Phylogenetic trees of b-glucosidases. Fig. S2. AmBGL18 b-glucosidase activity.
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
