Enzyme and Microbial Technology 57 (2014) 26–35

Contents lists available at ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt

Identification and characterization of an unusual glycosyltransferase-like enzyme with ␤-galactosidase activity from a soil metagenomic library Si-di Wang, Geng-shan Guo, Liang Li, Li-chuang Cao, Ling Tong, Guang-hui Ren, Yu-huan Liu ∗ School of Life Sciences, Sun Yat-sen University, Guangzhou 510275, People’s Republic of China

a r t i c l e

i n f o

Article history: Received 3 September 2013 Received in revised form 13 January 2014 Accepted 16 January 2014 Available online 24 January 2014 Keywords: ␤-Galactosidase Glycosyltransferase Metagenomic library Sequence-based classification Enzyme characterization

a b s t r a c t Glycosyltransferases and glycoside hydrolases are two diversified groups of carbohydrate-active enzymes (CAZymes) in existence, they serve to build and break down the glycosidic bonds, respectively, and both categories have formed many sequence-based families. In this study, a novel gene (glyt110) conferring ␤-galactosidase activity was obtained from a metagenomic library of Turpan Basin soil. Sequence analysis revealed that glyt110 encoded a protein of 369 amino acids that, rather than belonging to a family typically known for ␤-galactosidase activity, belonged to glycosyltransferase family 4. Because of this unusual sequence information, the novel gene glyt110 was subsequently expressed in Escherichia coli BL21(DE3), and the recombinant enzyme (Glyt110) was purified and characterized. Biochemical characterization revealed that the ␤-galactosidase activity of Glyt110 toward o-nitrophenyl-␤-d-galactopyranoside (ONPG) and lactose were identified to be 314 ± 18.3 and 32 ± 2.7 U/mg, correspondingly. In addition, Glyt110 can synthesize galacto-oligosaccharides (GOS) using lactose as substrate. A GOS yield of 47.2% (w/w) was achieved from 30% lactose solution at 50 ◦ C, pH 8.0 after 10 h reaction. However, Glyt110 was unable to glycosylate either N-acetylated saccharides or lactose and galactose using UDP-gal as sugar donor, and its glycosyltransferase activity needs further investigation. These results indicated that Glyt110 is an unusual enzyme with ␤-galactosidase activity but phylogenetically related to glycosyltransferase. Our findings may provide opportunities to improve the insight into the relationship between glycosyltransferases and glycoside hydrolases and the sequence-based classification. © 2014 Elsevier Inc. All rights reserved.

1. Introduction Glycoside hydrolases (GHs, EC 3.2.1.-) and glycosyltransferases (GTs, EC 2.4.x.y) are two omnipresent groups of enzymes in nature that responsible for the biosynthesis and selective cleavage of carbohydrates and glycoconjugates, respectively [1]. ␤-Galactosidase (EC 3.2.1.23) is a kind of exo-acting glycoside hydrolase which can catalyze both hydrolysis and transgalactosylation reaction in the presence of lactose. It firstly cleaves the ␤-1,4-d-glycosidic bond in lactose, which leads to the release of the galactosyl moiety into the reaction medium. When the acceptor is water, galactose is produced and the pathway is referred to as hydrolysis; otherwise, transferring the galactosyl moieties to other carbohydrates results in the formation of GOS, and the process is known as

∗ Corresponding author. Tel.: +86 20 84113712; fax: +86 20 84036215. E-mail address: [email protected] (Y.-h. Liu). 0141-0229/$ – see front matter © 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.enzmictec.2014.01.007

transgalactosylation [2]. On the other hand, glycosyltransferase catalyzes the transfer of sugar residues from activated sugar donors, which are most commonly in the form of nucleoside diphosphate sugars (e.g. UDP-, GDP-) onto saccharide or non-saccharide acceptors, forming glycosidic bonds [3]. Glycoside hydrolases and glycosyltransferases are widely distributed in various microorganisms, plants and animals, and both of them demonstrated tremendous structural and functional diversity [1,4]. To cope with their multiplicity and aid functional analysis, Henrissat and his colleagues initiated a family classification system based on amino acid sequence similarities for each category [5]. This classification system was able to integrate both structural and mechanistic features of different CAZymes, the catalytic apparatus are highly conserved and the stereochemistry of catalysis is the same within a family [1,5,6]. Currently, all glycoside hydrolases and glycosyltransferases have been classified according to their own classifications in the online Carbohydrate-Active enZymes Database (CAZyDB) (http://www.cazy.org) [7]. As the direct

S.-d. Wang et al. / Enzyme and Microbial Technology 57 (2014) 26–35

consequence of the sequencing of more and more genomes, the vast majority of these sequences (more than 90%) encode a protein whose function and specificity are not known and the proportion will increase in the future [7]. Moreover, compared to glycoside hydrolases, glycosyltransferases have often been proved exceedingly hard to characterize biochemically due to their extensive diversity in donor, acceptor and product category, which leads to an extremely low ratio of characterized glycosyltransferases [8,9]. Up to September 2013, there were 119,910 glycosyltransferase entries divided into 94 families, however, only 1936 of them have been characterized, the ratio was only 1.61% [7]. Although the sequence-based system allows logical grouping of sequences that encode a protein whose function and specificity are not known, it is unable to indicate the natural substrate or function of the enzyme. Conversely, some enzymes which can be grouped by sequence have been shown to possess promiscuous functions [10]. For example, Clostridium difficile toxin B, which contains a N-terminal glucosyltransferase catalytic domain and belongs to the glycosyltransferase type A family, also exhibits hydrolytic activity toward nucleotide-sugars [11]. In addition, some ␤-glucosidases, including GH1 family ␤-glucosidases and GH3 family ␤-glucosidases, have been known to possess significant ␤galactosidase activity [10,12]. Soil microorganisms are very diverse and can be an abundant resource of enzymes with novel properties [13]. Metagenome provides access to the collective genetic materials of all microorganisms in the studied environment samples (including microorganisms that have not been cultured thus far) and serves as an important tool in revealing novel genes and biological pathways [14,15]. Functional metagenomics composed of isolation of metagenomic DNA, construction of libraries and function-driven screening of the generated libraries is the only strategy for isolation of entirely novel and full-length enzymes [14,16]. In this study, a metagenomic library derived from Turpan Basin soil was constructed and subjected to function-driven screen. Here we describe an unusual enzyme (designated as Glyt110) obtained from this library. Although this enzyme was isolated on ␤-galactosidase screening plate, it was found to contain a glycosyltransferase conserved domain and grouped into glycosyltransferase family 4 (GT4). Because of this interesting placement of an enzyme with ␤-galactosidase activity into family GT4, this novel and unusual enzyme was heterologously expressed, purified and biochemically characterized. 2. Materials and methods

27

partially digested with Hind III, DNA fragments of approximately 2–10 kb were purified using the above-mentioned gel extraction kit and ligated into pUC19lacZ vector, which has been previously digested with Hind III and dephosphorylated with calf intestine alkaline phosphatase (CIAP) (Takara, Dalian, China). The ligated products were purified and transformed into E. coli DH5␣ via electroporation. The transformants were plated onto LB agar plates containing 0.75 mM isopropyl-␤d-thiogalactopyranoside (IPTG), 0.01% X-Gal and 100 ␮g/mL ampicillin. The blue phenotypes were picked and subcultured to obtain pure isolates [18]. The positive clone was inoculated in 10 mL LB broth with ampicillin (100 ␮g/mL) and induced with 0.5 mM IPTG at 37 ◦ C for 8 h. Cells were harvested and resuspended in cold sodium phosphate buffer (100 mM, pH 7.0), and then disrupted by sonication. The crude lysate was centrifuged at 14,000 × g for 5 min at 4 ◦ C, and the supernatants were assayed for ␤-galactosidase activity using ONPG as substrate. Afterwards, supernatant capable of hydrolyzing ONPG was incubated with 30% (w/v) lactose at 40 ◦ C, 200 rpm for 6 h to further screen for transgalactosylation activity. The product of transgalactosylation was analyzed by thin layer chromatography (TLC). 2.4. Bioinformatic analysis The recombinant plasmid of positive clone was sequenced by Shanghai Invitrogen Biotechnology Co., Ltd. Open reading frames (ORFs) were identified using ORF FINDER program (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). A database homology search was performed with BLAST program (http://blast.ncbi.nlm.nih.gov) provided by National Center for Biotechnology Information (NCBI). Structure-based sequences alignment was performed by using CLUSTAL W (http://www.ebi.ac.uk/clustalw/) [19] and exported by ESPript (http://espript.ibcp.fr/ESPript/ESPript/) [20]. The superfamily and subfamily of Glyt110 was determined by searching the CAZyDB using dbCAN (http://csbl.bmb.uga.edu/dbCAN/annotate.php#) [21]. 2.5. Expression and preparation of the recombinant Glyt110 The gene glyt110 was amplified via PCR with the primers of glyt110(5 -CTGATATCGGATCCATGACCCGCTCGGTGCTGTTCT, in which the F BamH I site was shown in bold underlined letters) and glyt110-R (5 CCGTCGACAAGCTTTCATGCGGCGATCATACCCGTG, in which the Hind III site was shown in bold underlined letters). PCR reaction conditions were: 98 ◦ C, 10 s; 60 ◦ C, 15 s; 72 ◦ C, 90 s; repeated for 30 cycles. Amplified DNA was digested by BamH I-Hind III, and ligated with BamH I-Hind III treated expression vector pET-28a(+). The ligation product was transformed into E. coli BL21 (DE3) and the transformants were plated onto LB agar plates supplemented with 50 ␮g/mL kanamycin. After confirming by sequencing, the correct recombinant clone was inoculated in 100 mL of LB medium supplemented with kanamycin and grown to an OD600 of 0.8 at 37 ◦ C with agitation, and then the culture was added with 0.5 mM IPTG to induce the expression of the target gene. After cultivation continued at 25 ◦ C for 12 h with agitation, the cells were harvested at 14,000 × g for 2 min and stored at −20 ◦ C for later purification. All purification steps were performed using a His·Bind Purification Kit (Novagen, Madison, WI) by following the manufacturer’s instructions. Protein concentrations were determined according to the method of Bradford [22] using bovine serum albumin as standard. The purified enzyme solutions were employed for the enzyme activity assay. The molecular mass of Glyt110 was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions, using the protein molecular weight marker (Takara) as reference proteins. All protein bands were stained with Coomassie brilliant blue (CBB) R-250 for visualization.

2.1. Chemicals and reagents 2.6. Enzyme activity assay All chemicals were purchased from Sigma–Aldrich (St. Louis, USA) unless otherwise stated. Restriction enzymes, T4 DNA ligase and DNA polymerase were purchased from Fermentas (Burlington, Canada). Thin-layer chromatography plates were obtained from Merck (Darmstadt, Germany).

2.3. Metagenomic library construction and functional screening for ˇ-galactosidase gene

2.6.1. ˇ-Galactosidase activity assay ␤-Galactosidase activity of Glyt110 was determined using ONPG and lactose as the substrate [17]. The enzyme activity toward ONPG at 50 ◦ C was measured by following o-nitrophenol (ONP) release at 405 nm. The reaction mixture was composed of 10 ␮L of enzyme solution and 490 ␮L of ONPG solution (2.5 g/L in 100 mM sodium phosphate buffer, pH 7.0). After incubated at 50 ◦ C for 10 min, the reaction was terminated by adding 500 ␮L of 10% (w/v) sodium carbonate. One unit of enzyme activity toward ONPG (UONPG ) was defined as the amount of enzyme needed to produce 1 ␮mol of ONP per minute under the assay condition. When ␤-galactosidase activity was determined using its natural substrate lactose, 50 ␮L of enzyme solution was added to 450 ␮L of lactose solution (5 g/L in 100 mM sodium phosphate buffer, pH 7.0). After incubated at 50 ◦ C for 15 min, the reaction was stopped by boiling the sample for 5 min, and the concentration of glucose was determined using a Glucose (GO) Assay Kit (Sigma–Aldrich, Louis, USA). One unit of enzyme activity toward lactose (ULac ) was defined as the amount of enzyme required to release 1 ␮mol of glucose per minute under the assay condition.

For the construction of metagenomic library, soil sample from a cornfield in Turpan Basin (42◦ 56 N, 89◦ 11 E) was collected and stored at −80 ◦ C until the DNA extraction was performed. The total DNA was extracted using the direct method developed by Zhou et al. [17] with slight modification. The purified metagenomic DNA was purified using E.Z.N.A® Gel Extraction Kit (OMEGA, Norcross, USA) and

2.6.2. Glycosyltransferase activity assay To determine the glycosyltransferase activity of recombinant Glyt110, the activity assay was performed using UDP-gal as substrate [23]. The reaction mixture (500 ␮L) contained 100 mM sodium phosphate buffer (pH 7.5), 2 mM UDP-gal, 10 mM acceptor (GlcNAc, GalNAc, lactose or glucose) and 100 ␮L of enzyme

2.2. Bacterial strains and plasmids E. coli strains DH5␣ and BL21 (DE3) (Novagen, Madison, WI) were used as host strains for gene cloning and protein expression, respectively. pUC19lacZ (kindly donated by Petra Karasová-Lipovová) was employed to construct metagenomic library. pET-28a(+) (Novagen) was used to express the target protein. E. coli transformants were cultivated at 37 ◦ C in Luria–Bertani (LB) medium, appropriate antibiotics were added at final concentrations of 50 ␮g/mL (kanamycin) and 100 ␮g/mL (ampicillin).

28

S.-d. Wang et al. / Enzyme and Microbial Technology 57 (2014) 26–35

solution, the acceptor was omitted in the control reaction. After incubation at 40 ◦ C for 12 h, the reaction was quenched and extracted with 500 ␮L ethyl acetate, and then the consumption of UDP-gal and release of UDP were analyzed by high performance liquid chromatography (HPLC). The HPLC analysis was performed on Diamonsil C18 column (5 lm, 250 mm × 4.6 mm) using a methanol: phosphate buffer (100 mM, pH 6.0; 70:30, v/v), the solvent flow rate was 1 mL/min, the absorption was measured at 260 nm and the instrument used was an HP1100 HPLC system.

software Image J 1.40. Assays were performed in triplicate. GOS yield and lactose conversion were calculated using the following formulas [26]:

2.7. Effect of pH and temperature on enzyme activity and stability

Total sugars is the sum of all sugars (glucose, galactose, residual lactose, and GOS), and it is also equal to the initial lactose content.

GOS yield(%) =

GOS formed × 100 total sugrar

Lactose conversion(%) =

initial lactose content − residual lactose content initial lactose content

◦

The optimum pH of Glyt110 was determined using ONPG as substrate at 50 C. The following buffers were used: 100 mM sodium acetate (pH 5.0–6.0), 100 mM phosphate (pH 6.0–9.0), 100 mM glycine–sodium hydroxide (pH 9.0–10.0). Further study on the pH stability of the enzyme was carried out by incubating the enzyme solutions at 4 ◦ C for 0.5, 1, 2, 4, 6, 8, 10 and 12 h in the buffer system mentioned above in the absence of substrate. The optimum temperature for the enzyme was determined by varying the temperature from 35 to 65 ◦ C at pH 7.0. The thermostability was investigated by incubating the purified enzyme in phosphate buffer (100 mM, pH 7.0) at 40, 45, 50, 55 ◦ C for 0.5, 1, 2, 4, 6, 8, 10 and 12 h. Subsequently, the residual activity was assayed under standard conditions.

2.10.2. Mass spectrometry Qualitative analysis of individual carbohydrates was performed with High Resolution Electrospray Ionization Mass Spectromerty (HR-ESI-MS) via hybrid mass spectrometer LTQ Orbitrap Velos (Thermo Scientific, FL, USA). Mass spectra were performed in the positive mode, the working conditions for the ESI source were as follows: spray voltage, 3.5 kV; heated capillary temperature and voltage, 300 ◦ C and 20 V, respectively; sheath gas (N2 ), 30 arbitrary units; and auxiliary gas (N2 ), 5 arbitrary units. 2.11. Nucleotide sequence accession number

2.8. Determination of kinetic parameters Michaelis–Menten kinetic parameters for activity of purified enzyme were determined using ONPG ranging from 0.25–5 mM and lactose concentrations between 10 and 50 mM, respectively. Values of the maximum velocity (Vmax ) and half-saturation coefficient (Km ) were determined by plotting the substrate concentration vs. the initial velocity of each reaction and subjecting the data to nonlinear regression analysis.

2.9. Enzymatic synthesis of GOS using lactose as substrate The synthesis of GOS by Glyt110 was carried out in a 50 mL conical flask with ground-in glass at 50 ◦ C, 200 rpm. The reaction mixture (10 mL) containing purified enzyme (10 U, 0.4 mg/mL) and lactose monohydrate solution (100 mM sodium phosphate buffer, pH 8.0) was added to the above-mentioned conical flask. After the reaction, the mixture was incubated at 90 ◦ C for 10 min to inactivate the enzyme, and centrifuged at 12,000 × g for 5 min at room temperature, then the supernatant was collected and used for further analysis. The inactivated enzyme solution was used as the negative control. To investigate the factors influencing GOS yield, the reactions were studied at five initial lactose concentrations (w/v) (10%, 20%, 30%, 40%, and 50%), six different pH values (4.0, 5.0, 6.0, 7.0, 8.0, and 9.0), six different reaction temperatures (30, 35, 40, 45, 50, and 55 ◦ C). To evaluate the effect of reaction time on GOS synthesis, aliquots (0.5 mL) were withdrawn at regular time intervals (2, 4, 6, 8, 10, 12, and 24 h) and subsequently analyzed by TLC. The following buffers were used: 100 mM sodium acetate (pH 4.0–5.0), 100 mM phosphate (pH 6.0–8.0), 100 mM glycine–sodium hydroxide (pH 9.0).

2.10. Carbohydrate analysis of GOS product 2.10.1. TLC analysis Quantitative GOS analysis was determined by TLC combined with Image J (version 1.40, http://rsb.info.nih.gov/ij) [24,25], the syrups were diluted to 5% (w/v) with deionized water, then the diluents were analyzed by TLC on aluminum sheets coated with silica gel 60 (Merck, Darmstadt, Germany) using butanol–ethanol–water (5:3:2, v/v/v) as mobile phase. Detection was performed by spraying a solution containing 0.5% (v/w) 3,5-dihydroxytoluene and 20% (v/v) sulfuric acid and heating for 5 min at 120 ◦ C [24]. Afterwards, the different spots were quantitated by the

The nucleotide sequence of glyt110 has been deposited in GenBank database under the accession number KC493650.

3. Results 3.1. Construction of metagenomic library and screening for clones conferring ˇ-galactosidase activity Metagenomic DNA was directly isolated from the soil sample without previous enrichment. The yield of soil DNA was approximately 12 ␮g g−1 soil. Subsequently, a metagenomic library containing 700,000 clones was constructed. Random restriction analysis revealed that the average DNA insert size was approximately 3.9 kb, and thus the metagenomic library represented about 2666 MB (theoretically calculated) of soil microbial genomic DNA. To obtain novel genes associated with ␤-galactosidase activity from the plasmid library, an activity-based approach was chosen. The screen for genes conferring ␤-galactosidase activity was based on the ability of E. coli recombinant clones to exhibit blue color when grown on agar plate containing X-Gal. Producing of blue color resulted from the hydrolysis of X-Gal. In the course of screening, one clone showed blue phenotype on the agar plate was obtained. After reconfirmation by restriction enzyme digestion, the enzymatic activity toward ONPG was further tested and the result indicated that the blue clone was able to hydrolyze ONPG. 3.2. Sequence analysis and classification of Glyt110 The recombinant plasmid extracted from the positive clone was sequenced and analyzed. The gene glyt110 consisted of 1110 nucleotides, encoding a 369-amino-acid protein with a predicted molecular mass of 38.7 kDa. A BLAST search of CDD indicated

Table 1 Similarity between amino acid sequences of Glyt110 and its closest homologuesa Protein

Source

Accession no.

Identity

E value

CAZy Family

Glyt110 Hypothetical proteinb Glycosyltransferase Glycosyltransferase Glycosyltransferase Glycosyltransferase Glycosyltransferase Glycosyltransferase

Metagenome (this study) Kiloniella laminariae Alpha proteobacterium BAL199 Thalassospira profundimaris WP0211 Thalassospira xiamenensis M-5 Microvirga sp. WSM3557 Agrobacterium sp. 224MFTsu3.1 Agrobacterium tumefaciens

KC493650 WP 020590392 WP 007677244 WP 008890809 WP 007089938 WP 009494014 WP 020010922 WP 003521294

−/− 192/375 (51%) 199/362 (55%) 186/374 (50%) 183/370 (49%) 181/361 (50%) 176/368 (48%) 180/368 (49%)

– 2e−105 2e−103 2e−101 1e−100 7e−99 3e−97 5e−96

GT4 GT4 GT4 GT4 GT4 GT4 GT4 GT4

a The corresponding protein, source, and accession number are given for the seven closest homologues to Glyt110 identified by a BLAST search of the NCBI. The protein names and strain names of the microorganisms are given as originally designated by the authors. b Hypothetical protein WP 020590392 also contains a glycosyltransferase CDD.

S.-d. Wang et al. / Enzyme and Microbial Technology 57 (2014) 26–35

29

Fig. 1. Multiple sequence alignment of Glyt110 with its closest homologues. Except for Glyt110 (this study, KC493650), other protein sequences were retrieved from GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html). The accession numbers of the aligned sequences were from the following organisms: WP 020590392, Kiloniella laminariae, hypothetical protein; WP 007677244, Alpha proteobacterium BAL199, glycosyltransferase; WP 008890809, Thalassospira profundimaris WP0211, glycosyltransferase; WP 007089938, Thalassospira xiamenensis M-5, glycosyltransferase; WP 009494014, Microvirga sp. WSM3557, glycosyltransferase; WP 020010922, Agrobacterium sp. 224MFTsu3.1, glycosyltransferase; WP 003521294, Agrobacterium tumefaciens, glycosyltransferase. The alignment was performed using Clustal W and ESPript. The secondary structural elements are identified from simulative structure of Glyt110. The numbers flanking the sequences represent amino acid positions of each sequence. The ␣-helices, ␩-helices, ␤-sheets, and ␤-turns are denoted as, ␣, ␩, ␤ and TT, respectively. Similar sequences are indicated by box, and completely conserved residues are indicated by white lettering on a red background.

that Glyt110 contained a glycosyltransferases GTB type superfamily module [27]. Analysis of the deduced amino acid sequence revealed that Glyt110 exhibited highest similarities with the glycosyltransferases from different microorganisms (Table 1). All these homologues were obtained from fully sequenced genomes and none of them have been biochemically characterized. Multiple sequence alignment of Glyt110 and its seven closest homologues was performed. The alignment result showed that there existed several conserved residues (Fig. 1). For the classification and annotation of Glyt110 and its seven closest analogs, these sequences were submitted to the dbCAN, a web-based server for automated CAZymes by searching the CAZyDB. Result showed that Glyt110 and its seven closest analogs all belonged to family GT4. Family GT4 is the second largest

glycosyltransferase family and typical for bacterial genomes, it is usually considered as the most ancestral retaining family [3]. Currently, there are approximately 27,907 members in family GT4, and 24,872 of them are bacterial gene sequences. 3.3. Overexpression and purification of recombinant Glyt110 The complete glyt110 sequence from the positive clone was subcloned into pET-28a(+) vector and transformed into E. coli BL21(DE3). The correct transformant was induced with 0.5 mM IPTG at 25 ◦ C for 12 h. The predicted molecular mass of Glyt110 and the N-terminal fusion protein of pET-28a(+) were about 38.7 kDa and 5 kDa, respectively. Therefore, the total molecular weight of recombinant Glyt110 should be about 44 kDa. After purified by

30

S.-d. Wang et al. / Enzyme and Microbial Technology 57 (2014) 26–35

Ni-NTA chromatography, the target protein was detected by SDSPAGE. A same positional protein band near 44 kDa was observed in a Coomassie-stained SDS-PAGE (Fig. 2). This result was in accordance with the calculated molecular mass of the predicted amino acid sequence. The purified recombinant protein was further used for study on the main biochemical properties of Glyt110. 3.4. Enzyme activity assay As mentioned above, Glyt110 was isolated on an X-Galcontaining LB agar plate, and its hydrolytic activity toward ONPG (synthetic analog of lactose) has been confirmed preliminarily. Hence, it is assumed that Glyt110 may hydrolyze lactose. Subsequently, the purified recombinant target protein was quantitatively assayed for the hydrolysis of ONPG and lactose, the specific activities of Glyt110 toward the natural substrate lactose and the synthetic substrate ONPG were 32 ± 2.7 and 314 ± 18.3 U/mg, respectively. The kinetic parameters of them were presented in Table 2. Although Glyt110 exhibited ␤-galactosidase activity, amino acid sequence analysis revealed that Glyt110 possesses a glycosyltransferase conserved domain and was grouped into family GT4. There are 13 subfamilies in family GT4, based on the fact that Glyt110 can catalyze transgalactosidation reaction, so we attempted to analyze whether Glyt110 exhibit ␣-galactosyltransferase (EC 2.4.1.-) activity using UDP-gal as substrate. However, no consumption of UDP-gal and release of UDP were detected when using GlcNAc, GalNAc, lactose or glucose as the acceptor, indicating no transglycosylation took place in this case.

Fig. 2. SDS-PAGE analysis of recombinant Glyt110. Lane M, marker proteins; lane 1, crude lysate of E. coli cells with pET-28a(+) only (10 ␮l crude lysate was loaded); lane 2, unpurified crude lysate of E. coli cells with pET-28a(+)-glyt110 (10 ␮l crude lysate corresponding to 1 ␮g protein was loaded); lane 3, purified lysate of E. coli cells with pET-28a(+)-glyt110 (5 ␮l purified lysate corresponding to 2 ␮g protein was loaded).

Fig. 3. The pH and temperature on the activity and stability of Glyt110. (a) Effect of pH on the activity of Glyt110. (b) Effect of pH on the stability of Glyt110. Glyt110 was pre-incubated at 0 ◦ C for 0.5, 1, 2, 4, 6, 8, 10 and 12 h in various buffer of different pH levels, original activity of the enzyme (without incubation treatment) was defined as 100%. The pH values were: pH 5.0 (), pH 6.0 (), pH 7.0 (), pH 8.0 (), pH 9.0 () and pH 10.0 (). (c) Effect of temperature on the activity of Glyt110. (d) Effect of temperature on the stability of Glyt110. The temperatures used were: 40 ◦ C (), 45 ◦ C (), 50 ◦ C (), and 55 ◦ C (). Glyt110 was pre-incubated at various temperatures above for 0.5, 1, 2, 4, 6, 8, 10 and 12 h in phosphate buffer (100 mM, pH 7.0). Original activity of the enzyme (without incubation treatment) was defined as 100%. The value obtained at each optimum condition was defined as 100%, data was the average from triplicate experiments.

S.-d. Wang et al. / Enzyme and Microbial Technology 57 (2014) 26–35 Table 2 Determination of kinetic parameters of the recombinant Glyt110.a Substrate ONPG Lactose

Vmax (␮mol min−1 mg−1 )

Km (mM)

430.6 51.3

0.56 12.7

Kcat (s−1 ) 265.8 31.7

31

Table 3 Spectrum-simulation of oligosaccharides obtained by HR-ESI-MS. Kcat /Km (mM−1 S−1 ) 474.6 2.51

a Enzymatic reactions were carried out for 8 min at 50 ◦ C in 100 mM sodium phosphate buffer (pH 7.0).

m/z

Theo. mass

Delta (ppm)

RDB equiv.

Composition

527.15859 707.22214 869.27517 1031.32804

527.15826 707.22164 869.27447 1031.32729

0.63 0.7 0.81 0.73

2.5 2.5 3.5 4.5

C18 H32 O16 Na C24 H44 O22 Na C30 H54 O27 Na C36 H64 O32 Na

3.5. Characterization of recombinant Glyt110

in the process of mass spectrometry. Subsequently, the effects of initial lactose, temperature, pH and reaction time on GOS synthesis were further investigated.

The effects of pH and reaction temperature on enzymatic activity were investigated at a pH range from 5.0 to 10.0 and a temperature range from 35 to 65 ◦ C using ONPG as substrate. The optimum pH of Glyt110 was approximately 7.0 and more than 65% of its maximal activity was observed in the pH range of 6.5–7.5 (Fig. 3a). Furthermore, the enzyme was found to be extremely stable in the pH range of 7.0–10.0, and retained more than 75% of the activity after incubating for 12 h (Fig. 3b). Glyt110 exhibited the maximal activity at 50 ◦ C, and displayed more than 65% of its maximal activity in the temperature range of 40–55 ◦ C (Fig. 3c). To determine the thermostability of recombinant Glyt110, the enzyme was pre-incubated at temperatures ranging from 40–55 ◦ C and its residual activity was measured under standard assay conditions. Results suggested that recombinant Glyt110 showed good thermal stability at temperature up to 50 ◦ C, with almost unchanged activity after incubation for 12 h. In addition, after incubation at 55 ◦ C for 12 h, it still retained 51% of its maximal activity (Fig. 3d).

3.6.1. Effect of initial lactose concentration on GOS synthesis The effect of initial lactose concentration was studied in a percent range of 10–50% (w/v). As showed in Fig. 6a, the yield of GOS increased as the initial lactose concentration increased from 10% to 30%, the maximum GOS production was achieved with 30% lactose in the reaction system. However, further increase in lactose concentration led to a slight decrease of GOS production. It is worth noting that the GOS yields were kept above 44% when the lactose concentrations were in the range of 20–50%. Meanwhile, it was found that the highest lactose conversion (90.3%) was obtained when initial lactose concentration was 10%, and decreased progressively as the lactose concentration increased. When the initial lactose concentration increased to 50%, the lactose conversion has been reduced to 79.2%.

3.6. Enzymatic synthesis of GOS using lactose as substrate Since Glyt110 displayed hydrolytic activity toward lactose, it may be able to catalyze enzymatic transgalactosylation. Afterwards, Glyt110 was employed to produce GOS from lactose. A GOS yield of 47.2% (w/w) was achieved from 30% lactose solution at 50 ◦ C, pH 8.0 after 10 h reaction (Fig. 4). Analysis of these carbohydrates by HR-ESI-MS revealed the existence of four different oligosaccharides at different mass-to-charge ratio (m/z) values: trisaccharides (m/z 527.15859), tetrasaccharides (m/z 707.22214), pentasaccharides (m/z 869.27517) and hexasaccharides (m/z 1031.32804) (Fig. 5). All the oligosaccharides were appeared as either [M+Na]+ or [M+Na+H2 O]+ ions according to the spectrum-simulation result (Table 3), the H2 O may be incorporated

3.6.2. Effect of temperature and pH on GOS synthesis The effect of temperature on GOS synthesis was studied by varying the temperature from 30 to 55 ◦ C. As presented in Fig. 6b, it was found that the yield of GOS increased with an increasing temperature from 30 to 55 ◦ C and decreased slightly afterward. A maximum GOS yield was found to be 47.2% at 50 ◦ C and the reaction temperature showed a very limited effect on GOS production in the whole temperature range. The GOS yield was maintained above 42.7% in this range. Moreover, the change tendency of lactose conversion was in accordance with that of the GOS yield, it maintained an upward trend (74.1–85.8%) in the temperature range of 30–50 ◦ C, and decreased to 82.6% at 55 ◦ C. As shown in Fig. 6c, the maximum GOS yield was obtained at pH 8.0 and the pH value showed minimal effect on GOS production in a broad range from 6.0 to 9.0. Within this range, GOS yield and lactose conversion were held above 44% and 84%, respectively. It was obvious that low-level transgalactosylation and hydrolysis reaction proceeded at pH 4.0, the lactose conversion was only 15.3%, but it increased sharply to 85.2% at pH 6.0 with a corresponding GOS yield of 44.2%. 3.6.3. Effect of reaction time on GOS synthesis Fig. 6d exhibited the effect of reaction time on GOS synthesis. In the initial stage of 2–6 h, lactose was quickly utilized as the lactose conversion increased greatly from 65.8% to 80.5%, and the amounts of GOS, glucose and galactose increased in varying degrees (data not shown). The highest GOS yield of 47.2% was obtained after 10 h of reaction. As the reaction time extended beyond 10 h, the GOS yield decreased slowly, down to 45.9% and 41.5% at 12 h and 24 h, respectively. However, the lactose conversion was increased constantly during the whole process and reached the highest value (90.3%) at 24 h. 4. Discussion

Fig. 4. TLC analysis of the reaction product formed after 10 h reaction by recombinant Glyt110. The reaction was performed at 50 ◦ C, pH 8.0 with an initial lactose concentration of 30% (w/v). lane 1: lactose, galactose, glucose standard mixture; lane 2: negative control; lane 3: enzymatic synthesis reaction mixture.

It is widely accepted that up to 99% of the microbes present in environments are not readily culturable [14–16]. Metagenome includes the genomes from those uncultured microorganisms and

32

S.-d. Wang et al. / Enzyme and Microbial Technology 57 (2014) 26–35

Fig. 5. HR-ESI-MS spectrum of oligosaccharides synthesized using recombinant Glyt110 after 10 h reaction. The reaction was performed at 50 ◦ C, pH 8.0 with an initial lactose concentration of 30% (w/v). (a) m/z 527.15859 [Tri+Na]+ indicates trisaccharides; (b) m/z 707.22214 [Tetra+Na+H2 O]+ indicates tetrasaccharides; (c) m/z 869.27517 [Penta+Na+H2 O]+ indicates pentasaccharides; (d) m/z 1031.32804 [hexa+Na+H2 O]+ indicates hexasaccharides.

thus plays an important role in exploring the untapped genes in them [14–16]. In this study, the library screening routine was based on functional expression of genes that harbored in recombinants. Here we must state that our original intention was to isolate gene conferring ␤-galactosidase activity, so agar plates supplemented with X-Gal were used. To our surprise, a novel gene conferring ␤-galactosidase activity but showed highest sequence similarity to glycosyltransferase genes was obtained. This benefited from the activity-based screen approach, since this strategy permits the identification of known species of enzymes with novel characteristics or hitherto totally new enzymes [28–30]. However, as mentioned above, the vast majority of glycosyltransferases are unveiled by the sequencing of genomes, few metagenome-derived glycosyltransferases have been reported except the recent publication of Rabausch et al. [31], which proposed a new functional screening system for flavonoid-modifying glycosyltransferases based on high-performance thin-layer chromatography (HPTLC). Enzyme activity assay revealed that Glyt110 demonstrated the common characteristics of ␤-galactosidases from glycosyl hydrolases family. It was not only able to hydrolyze lactose, but also able to synthesize GOS from lactose. When it came to the assay of glycosyltransferase activity, no ready-made methods were available for the following two reasons: one is that there is no generally used substrate for in vitro activity assay of glycosyltransferases since they demonstrate extensive diversity in their donor, acceptor and reaction mode, the other is that little biochemical information can be available for reference because the closest analogs of Glyt110 are all uncharacterized glycosyltransferases unveiled by

the sequencing of genomes. As a result, it is difficult to determine what substrate Glyt110 may act upon and to characterize its precise function merely based on the sequence information. Although Glyt110 did not exhibit glycosyltransferase activity under the above-mentioned experimental conditions, we cannot draw the conclusion that Glyt110 lacks glycosyltransferase activity, because the sugar donor and acceptors we used may not be the appropriate substrates for it or it may not be an ␣-galactosyltransferase. Further investigations on the structure and the catalytic mechanism are of practical value and will provide detailed information for us to determine the glycosyltransferase property of Glyt110 through a more targeted approach. Biochemical characterization of the ␤-galactosidase properties of Glyt110 was performed, and a comparison of Glyt110 with several other microbial ␤-galactosidases reported in the past five years was shown in Table 4. The specific activity of Glyt110 toward ONPG was relatively high compared to other ␤-galactosidases, the majority of which displayed a UONPG below 300 U/mg. However, the activity of Glyt110 for lactose was far less than that for ONPG. Similar substrate specificity has been observed in ␤-galactosidases from Lactobacillus delbrueckii [32] and uncultured bacterium [33]. The optimum pH of Glyt110 was 7.0 and it exhibited more than 95% of its maximal activity in the pH 6.7–6.8 (the pH of natural milk). Moreover, Glyt110 was also considerably stable at this pH, which indicated that Glyt110 was more suitable for lactose hydrolysis in milk than other ␤-galactosidases with an acidic or alkaline optimum pH, such as ␤-galactosidase from Paecilomyces aerugineus (optimum pH is 2.5) [34] and ␤-galactosidase from

S.-d. Wang et al. / Enzyme and Microbial Technology 57 (2014) 26–35

33

Fig. 6. Qualitative analysis of the GOS yield (䊉) and lactose conversion () catalyzed by recombinant Glyt110. The conditions used in each group were: (a) varied initial lactose concentrations (10–50%, w/v), T = 50 ◦ C, pH = 8.0 and t = 10 h; (b) varied temperatures (30–55 ◦ C), initial lactose concentration = 30% (w/v), pH = 8.0 and t = 10 h; (c) varied pH values (pH 4.0–9.0), initial lactose concentration = 30% (w/v), T = 50 ◦ C, and t = 10 h; (d) varied reaction time (2–24 h), initial lactose concentration = 30% (w/v), T = 50 ◦ C and pH = 8.0. Bars indicate standard deviations.

uncultured bacterium (optimum pH is 8.0) [35]. The temperature profile of the enzymatic activity showed that Glyt110 exhibited highest activity at 50 ◦ C, which was similar to ␤-galactosidases from Bacillus licheniformis DSM 13 [36], Lactobacillus crispatus [37] and P. aerugineus [34]. The thermostability of Glyt110 was comparable to ␤-galactosidases from Arthrobacter psychrolactophilus [38], Paracoccus sp. 32d [39] and L. crispatus [37], with the half life of 60 min at 30 ◦ C, 90 min at 40 ◦ C and 9 min at 50 ◦ C, respectively. However, Glyt110 has lower optimum reaction temperature and thermostability than thermostable ␤-galactosidases from Caldicellulosiruptor saccharolyticus [40] and Bacillus stearothermophilus [41]. The half life times of the former at 65 ◦ C, 70 ◦ C, 75 ◦ C, and

80 ◦ C were 128, 48, 17, and 2 hours, respectively, with an optimal reaction temperature of 80 ◦ C. The latter showed highest activity at 70 ◦ C and the half-life time at 65 ◦ C and 70 ◦ C were 50 and 9 h, correspondingly. The GOS yield achieved by Glyt110 compared well with values reported for ␤-galactosidases from B. licheniformis DSM 13 [36], P. aerugineus [34], Aspergillus oryzae [42], Bifidobacterium longum BCRC 15 708 [26], Lactobacillus reuteri [43], Bacillus circulans [44], Talaromyces thermophilus CBS 23658 [45], Lactobacillus sakei Lb790 [46], Kluyveromyces lactis [47], with the GOS yields of 12%, 19.7%, 22%, 32.5%, 36%, 39%, 40%, 41% and 44%, respectively. Nevertheless, ␤-galactosidases from B. circulans [48], Sulfolobus solfataricus

Table 4 Biochemical characteristics of several reported ␤-galactosidases. Microbial source

Opt temp. (◦ C)

Opt pH

Half-life (min)

Specific activity of ONPG (U/mg)

Specific activity of lactose (U/mg)

Reference

Uncultured bacterium Alicyclobacillus acidocaldarius Bacillus megaterium Bacillus stearothermophilus Bacillus licheniformis DSM 13 Bacillus megaterium Caldicellulosiruptor saccharolyticus Deinococcus geothermalis Geobacillus stearothermophilus Halomonas sp. S62 Lactococcus lactis Lactobacillus crispatus Paracoccussp. 32d Paecilomyces aerugineus Lactobacillus delbrueckii Uncultured bacterium Uncultured bacterium

50 65 40 70 50 40 80 60 65 45 15–55 50 40 50 35–50 65 78

7.0 5.5 6.0–9.0 7.0 6.5 7.5∼8.0 6.0 6.5 6.5 7.0 6.0–7.5 5.5–6.5 7.5 2.5 5.0–5.5 8.0 6.8

720 (50 ◦ C) 6 (80 ◦ C) – 540 (70 ◦ C) ◦ 30 (65 C) 60 (50 ◦ C) 120 (80 ◦ C) 11 (70 ◦ C) – 2 (70 ◦ C) ◦ 120 (60 C) 9 (50 ◦ C) 90 (40 ◦ C) 30 (60 ◦ C) 24 (65 ◦ C) 60 (70 ◦ C) 30 (82 ◦ C)

314 ± 18.3 592 60 125 270 ± 0.9 59.9 211 38 ± 0.7 0.5 118.45 36 221 40.98 820 412 148.0 185

32 ± 2.7 – – – – – – 11 ± 0.6

This study [55] [56] [41] [36] [56] [40] [57] [58] [59] [60] [37] [39] [34] [32] [35] [33]

– – – – – 71 – 47.6

34

S.-d. Wang et al. / Enzyme and Microbial Technology 57 (2014) 26–35

[49] and Bifidobacterium bifidum NCIMB 41171 [50] produced the GOS yields of 49.4%, 50.9% and 54.8%, respectively, which were superior to our report. Overall, GOS yields were most commonly achieved in the range of 17.1–45% in most researches, while GOS yield exceeding 50% was rarely reported [51]. The effects of the four variables (initial lactose concentration, pH, temperature and reaction time) analysis were roughly in accordance with the previous observations. High initial lactose concentration is generally required for good yields [26,51,52], and it was applicable to Glyt110 as well. The main reason for this phenomenon is that high initial concentration of lactose could increase the availability of galactosyl moieties and decrease the availability of water molecules as acceptors simultaneously [51]. Furthermore, the effect of pH on GOS synthesis was remarkable. It is widely recognized that the optimum pH values for microbial enzymes lie on their sources, enzymes of the same source were found with similar optimal pH values for GOS synthesis [53]. Our results illustrated that pH 6.0–9.0 was suited for Glyt110 while acidic condition (pH 4.0) may resulted in catalyst deactivation. In addition, it is generally reported that relatively high reaction temperature may drastically affect the GOS yield [53,54], this is because high temperature can enhance the solubility of the lactose and speed the transgalactosylation reaction rate [54]. However, the effect of temperature in this study was not as remarkable as previous reports [26,36,50]. In this study, the GOS yield maintained at a high level (above 43%) at the temperature range of 30–50 ◦ C. This may partially attributed to the good stability of Glyt110 under 50 ◦ C. 5. Conclusions A metagenome-derived novel enzyme Glyt110, was screened out using an activity-based method from a Turpan Basin soil metagenomic library. The novel Glyt110 was phylogenetically related to glycosyltransferase but identified as having hydrolytic activity toward lactose and synthesis ability of GOS. In addition, the enzyme was found to be relatively stable in the pH range of 7.0–10.0 and at temperature up to 50 ◦ C over 12 h. All these characteristics suggest that Glyt110 may be a potential candidate for industrial production of GOS. Finally, further investigation on the catalytic mechanism and the structure of Glyt110 through X-ray crystallography and mutagenesis are considered to be significant, it will contribute not only to provide us more detailed information on this promising enzyme, but also may lead to a better understanding of the relationship between protein structure and function. This study reconfirms the value of metagenome in novel biocatalysts identification, highlights the utility of function-based screen in the identification of novel enzymes and augments our knowledge base of sequencebased classification. Acknowledgments We are grateful to professor Petra Karasova-Lipovova for the kindly donation of vector pUC19lacZ. This research was supported by National Natural Science Foundation of China (31170117); National marine research special funds for public welfare projects of China (201205020); Major Science & Technology Projects of Guangdong Province, China (2011A080403006) and Science & Technology Projects of Guangdong Provincial Oceanic and Fishery Bureau (A201301C04). References [1] Bourne Y, Henrissat B. Glycoside hydrolases and glycosyltransferases: families and functional modules. Curr Opin Struct Biol 2001;11:593–600.

[2] Vandamme EJ, Soetaert W. Biotechnical modification of carbohydrates. FEMS Microbiol Rev 1995;16:163–86. [3] Lairson LL, Henrissat B, Davies GJ, Withers SG. Glycosyltransferases: structures, functions, and mechanisms. Annu Rev Biochem 2008;77:521–55. [4] Henrissat B, Sulzenbacher G, Bourne Y. Glycosyltransferases, glycoside hydrolases: surprise, surprise! Curr Opin Struct Biol 2008;18:527–33. [5] Campbell JA, Davies GJ, Bulone V, Henrissat B. A classification of nucleotidediphospho-sugar glycosyltransferases based on amino acid sequence similarities. Biochem J 1997;326:929–39. [6] Henrissat B, Davies GJ. Glycoside hydrolases and glycosyltransferases: families, modules, and implications for genomics. Plant Physiol 2000;124: 1515–9. [7] Lombard V, GolacondaRamulu H, Drula E, Coutinho PM, Henrissat B. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res 2013, http://dx.doi.org/10.1093/nar/gkt1178. [8] Coutinho PM, Deleury E, Davies GJ, Henrissat B. An evolving hierarchical family classification for glycosyltransferases. J Mol Biol 2003;328:307–17. [9] Davies GJ, Henrissat B. Structural enzymology of carbohydrate-active enzymes: implications for the post-genomic era. Biochem Soc Trans 2002;30:291–7. [10] Shipkowski S, Brenchley JE. Characterization of an unusual cold-active betaglucosidase belonging to family 3 of the glycoside hydrolases from the psychrophilic isolate Paenibacillus sp. strain C7. Appl Environ Microbiol 2005;71:4225–32. [11] Reinert DJ, Jank T, Aktories K, Schulz GE. Structural basis for the function of Clostridium difficile toxin B. J Mol Biol 2005;351:973–81. [12] Bhatia Y, Mishra S, Bisaria VS. Microbial ␤-glucosidases: cloning, properties, and applications. Crit Rev Biotechnol 2002;22:375–407. [13] Daniel R. The soil metagenome—a rich resource for the discovery of novel natural products. Curr Opin Biotechnol 2004;15:199–204. [14] Simon C, Daniel R. Achievements and new knowledge unraveled by metagenomic approaches. Appl Microbiol Biotechnol 2009;85:265–76. [15] Iqbal HA, Feng Z, Brady SF. Biocatalysts and small molecule products from metagenomic studies. Curr Opin Chem Biol 2012;16:109–16. [16] Schmeisser C, Steele H, Streit WR. Metagenomics, biotechnology with nonculturable microbes. Appl Microbiol Biotechnol 2007;75:955–62. [17] Zhou J, Bruns MA, Tiedje JM. DNA recovery from soils of diverse composition. Appl Environ Microb 1996;62:316–22. [18] Karasová-Lipovová P, Strnad H, Spiwok V, Malá S, Králová B, Russell NJ. The cloning, purification and characterisation of a cold-active ␤-galactosidase from the psychrotolerant Antarctic bacterium Arthrobacter sp. C2-2. Enzyme Microb Technol 2003;33:836–44. [19] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673–80. [20] Gouet P, Courcelle E, Stuart DI, Metoz F. ESPript: analysis of multiple sequence alignments in PostScript. Bioinformatics 1999;15:305–8. [21] Yin Y, Mao X, Yang J, Chen X, Mao F, Xu Y. dbCAN: a web resource for automated carbohydrate-active enzyme annotation. Nucleic Acids Res 2012;40: W445–51. [22] Bradford MM. A rapid and sensitive for the quantitation of microgram quantitites of protein utilizing the principle of protein–dye binding. Anal Biochem 1976;72:248–54. [23] Liu XW, Xia C, Li L, Guan WY, Pettit N, Zhang HC, et al. Characterization and synthetic application of a novel beta1,3-galactosyltransferase from Escherichia coli O55:H7. Bioorg Med Chem 2009;17:4910–5. [24] Lu LL, Xiao M, Li ZY, Li YM, Wang FS. A novel transglycosylation ␤-galactosidase from Enterobacter cloacae B5. Process Biochem 2009;44:232–6. [25] Wang K, Lu Y, Liang WQ, Wang SD, Jiang Y, Huang R, et al. Enzymatic synthesis of galacto-oligosaccharides in an organic-aqueous biphasic system by a novel beta-galactosidase from a metagenomic library. J Agric Food Chem 2012;60:3940–6. [26] Hsu CA, Lee SL, Chou CC. Enzymatic production of galactooligosaccharides by beta-galactosidase from Bifidobacterium longum BCRC 15708. J Agric Food Chem 2007;55:2225–30. [27] Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, et al. CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Res 2011;39:D225–9. [28] Yeh YF, Chang SCY, Kuo HW, Tong CG, Yu SM, David Ho TH. A metagenomic approach for the identification and cloning of an endoglucanase from rice straw compost. Gene 2013;519:360–6. [29] Dougherty MJ, D’Haeseleer P, Hazen TC, Simmons BA, Adams PD, Hadi MZ. Glycoside hydrolases from a targeted compost metagenome, activity-screening and functional characterization. BMC Biotechnol 2012;12:38. [30] Nimchua T, Thongaram T, Uengwetwanit T, Pongpattanakitshote S, Eurwilaichitr L. Metagenomic analysis of novel lignocellulose-degrading enzymes from higher termite guts inhabiting microbes. J Microbiol Biotechnol 2012;22:462–9. [31] Rabausch U, Juergensen J, Ilmberger N, Bohnke S, Fischer S, Schubach B, et al. Functional screening of metagenome and genome libraries for detection of novel flavonoid-modifying enzymes. Appl Environ Microbiol 2013;79:4551–63. [32] Rhimi M, Aghajari N, Jaouadi B, Juy M, Boudebbouze S, Maguin E, et al. Exploring the acidotolerance of ␤-galactosidase from Lactobacillus delbrueckii subsp. bulgaricus: an attractive enzyme for lactose bioconversion. Res Microbiol 2009;160:775–84.

S.-d. Wang et al. / Enzyme and Microbial Technology 57 (2014) 26–35 [33] Zhang X, Li H, Li CJ, Ma T, Li G, Liu YH. Metagenomic approach for the isolation of a thermostable beta-galactosidase with high tolerance of galactose and glucose from soil samples of Turpan Basin. BMC Microbiol 2013;13:237. [34] Katrolia P, Yan QJ, Jia HY, Li YN, Jiang ZQ, Song CL. Molecular cloning and high-level expression of a ␤-galactosidase gene from Paecilomyces aerugineus in Pichia pastoris. J Mol Catal B Enzym 2011;69:112–9. [35] Gupta R, Govil T, Capalash N, Sharma P. Characterization of a glycoside hydrolase family 1 beta-galactosidase from hot spring metagenome with transglycosylation activity. Appl Biochem Biotechnol 2012;168:1681–93. [36] Juajun O, Nguyen TH, Maischberger T, Iqbal S, Haltrich D, Yamabhai M. Cloning, purification, and characterization of beta-galactosidase from Bacillus licheniformis DSM 13. Appl Microbiol Biotechnol 2011;89:645–54. [37] Nie C, Liu B, Zhang Y, Zhao G, Fan X, Ning X, et al. Production and secretion of Lactobacillus crispatus beta-galactosidase in Pichia pastoris. Protein Expr Purif 2013;92:88–93. [38] Nakagawa T, Ikehata R, Myoda T, Miyaji T, Tomizuka N. Overexpression and functional analysis of cold-active beta-galactosidase from Arthrobacter psychrolactophilus strain F2. Protein Expr Purif 2007;54:295–9. [39] Wierzbicka-Wo´s A, Cieslinski H, Wanarska M, Kozlowska-Tylingo K, Hildebrandt P, Kur J. A novel cold-active beta-d-galactosidase from the Paracoccus sp. 32d-gene cloning, purification and characterization. Microb Cell Fact 2011;10:108. [40] Park AR, Oh DK. Effects of galactose and glucose on the hydrolysis reaction of a thermostable beta-galactosidase from Caldicellulosiruptor saccharolyticus. Appl Microbiol Biotechnol 2011;85:1427–35. [41] Chen W, Chen H, Xia Y, Zhao J, Tian F, Zhang H. Production, purification, and characterization of a potential thermostable galactosidase for milk lactose hydrolysis from Bacillus stearothermophilus. J Dairy Sci 2008;91: 1751–8. [42] Matella NJ, Dolan KD, Lee YS. Comparison of galactooligosaccharide production in free-enzyme ultrafiltration and in immobilized-enzyme systems. J Food Sci 2006;71:363–8. [43] Splechtna B, Nguyen TH, Haltrich D. Comparison between discontinuous and continuous lactose conversion processes for the production of prebiotic galactooligosaccharides using ␤-galactosidase from Lactobacillus reuteri. J Agric Food Chem 2006;55:6772–7. [44] Palai T, Mitra S, Bhattacharya PK. Kinetics and design relation for enzymatic conversion of lactose into galacto-oligosaccharides using commercial grade beta-galactosidase. J Biosci Bioeng 2012;114:418–23. [45] Nakkharat P, Haltrich D. Lactose hydrolysis and formation of galactooligosaccharides by a novel immobilized ␤-galactosidase from the Thermophilic fungus Talaromyces thermophilus. Appl Biochem Biotechnol 2006;129–32:215–25. [46] Iqbal S, Nguyen TH, Nguyen HA, Nguyen TT, Maischberger T, Kittl R, et al. Characterization of a heterodimeric GH2 beta-galactosidase from Lactobacillus sakei

[47]

[48]

[49]

[50]

[51]

[52]

[53] [54] [55]

[56]

[57]

[58]

[59]

[60]

35

Lb790 and formation of prebiotic galacto-oligosaccharides. J Agric Food Chem 2011;59:3803–11. Rodriguez-Colinas B, de Abreu MA, Fernandez-Arrojo L, de Beer R, Poveda A, Jimenez-Barbero J, et al. Production of galacto-oligosaccharides by the betagalactosidase from Kluyveromyces lactis: comparative analysis of permeabilized cells versus soluble enzyme. J Agric Food Chem 2011;59:10477–84. Rodriguez-Colinas B, Poveda A, Jimenez-Barbero J, Ballesteros AO, Plou FJ. Galacto-oligosaccharide synthesis from lactose solution or skim milk using the beta-galactosidase from Bacillus circulans. J Agric Food Chem 2012;60:6391–8. Wu Y, Yuan S, Chen S, Wu D, Chen J, Wu J. Enhancing the production of galactooligosaccharides by mutagenesis of Sulfolobus solfataricus beta-galactosidase. Food Chem 2013;138:1588–95. Osman A, Tzortzis G, Rastall RA, Charalampopoulos D. BbgIV Is an Important Bifidobacterium beta-galactosidase for the synthesis of prebiotic galactooligosaccharides at high temperatures. J Agric Food Chem 2012;60:740–8. Park AR, Oh DK. Galacto-oligosaccharide production using microbial ˇgalactosidase: current state and perspectives. Appl Microbiol Biotechnol 2010;85:1279–86. Vera C, Guerrero C, Conejeros R, Illanes A. Synthesis of galacto-oligosaccharides by beta-galactosidase from Aspergillus oryzae using partially dissolved and supersaturated solution of lactose. Enzyme Microb Technol 2012;50:188–94. Gosling A, Stevens GW, Barber AR, Kentish SE, Gras S. Recent advances refining galactooligosaccharide production from lactose. Food Chem 2010;121:307–18. Otieno DO. Synthesis of ␤-galactooligosaccharides from lactose using microbial ␤-galactosidases. Compr Rev Food Sci Food Saf 2010;9:471–82. Di Lauro B, Strazzulli A, Perugino G, La Cara F, Bedini E, Corsaro MM. Isolation and characterization of a new family 42 beta-galactosidase from the thermoacidophilic bacterium Alicyclobacillus acidocaldarius: identification of the active site residues. Biochim Biophys Acta 2008;1784:292–301. Li Y, Wang H, Lu L, Li Z, Xu X, Xiao M. Purification and characterization of a novel beta-galactosidase with transglycosylation activity from Bacillus megaterium 2-37-4-1. Appl Biochem Biotechnol 2009;158:192–9. Lee JH, Kim YS, Yeom SJ, Oh DK. Characterization of a glycoside hydrolase family 42 beta-galactosidase from Deinococcus geothermalis. Biotechnol Lett 2011;33:577–83. Placier G, Watzlawick H, Rabiller C, Mattes R. Evolved beta-galactosidases from Geobacillus stearothermophilus with improved transgalactosylation yield for galacto-oligosaccharide production. Appl Environ Microbiol 2009;75:6312–21. Wang GX, Gao Y, Hu B, Lu XL, Liu XY, Jiao BH. A novel cold-adapted betagalactosidase isolated from Halomonas sp. S62: gene cloning, purification and enzymatic characterization. World J Microbiol Biotechnol 2013;29:1473–80. Vincent V, Aghajari N, Pollet N, Boisson A, Boudebbouze S, Haser R, et al. The acid tolerant and cold-active beta-galactosidase from Lactococcus lactis strain is an attractive biocatalyst for lactose hydrolysis. Anton Van Leeuw Int J G 2013;103:701–12.