Journal of Colloid and Interface Science 433 (2014) 183–188
Contents lists available at ScienceDirect
Journal of Colloid and Interface Science www.elsevier.com/locate/jcis
DNA fluorescence shift sensor: A rapid method for the detection of DNA hybridization using silver nanoclusters Shin Yong Lee 1, Nur Hidayah Hairul Bahara 1, Yee Siew Choong, Theam Soon Lim ⇑, Gee Jun Tye ⇑ Institute for Research in Molecular Medicine, Universiti Sains Malaysia, 11800 Minden, Penang, Malaysia
a r t i c l e
i n f o
Article history: Received 6 June 2014 Accepted 23 July 2014 Available online 31 July 2014 Keywords: Silver nanocluster (AgNC) Fluorescence shift DNA detection DNA hybridization
a b s t r a c t DNA-templated silver nanoclusters (AgNC) are a class of subnanometer sized fluorophores with good photostability and brightness. It has been applied as a diagnostic tool mainly for deoxyribonucleic acid (DNA) detection. Integration of DNA oligomers to generate AgNCs is interesting as varying DNA sequences can result in different fluorescence spectra. This allows a simple fluorescence shifting effect to occur upon DNA hybridization with the hybridization efficiency being a pronominal factor for successful shifting. The ability to shift the fluorescence spectra as a result of hybridization overcomes the issue of background intensities in most fluorescent based assays. Here we describe an optimized method for the detection of single-stranded and double-stranded synthetic forkhead box P3 (FOXP3) target by hybridization with the DNA fluorescence shift sensor. The system forms a three-way junction by successful hybridization of AgNC, G-rich strand (G-rich) to the target DNA, which generated a shift in fluorescence spectra with a marked increase in fluorescence intensity. The DNA fluorescence shift sensor presents a rapid and specific alternative to conventional DNA detection. Ó 2014 Elsevier Inc. All rights reserved.
1. Introduction DNA detection and identification is of importance as it plays a central role in the application of genetics [1], molecular diagnostic [2] and drug treatments [3]. Two of the most prominent methods of DNA detection are based on hybridization and point mutation [4]. Hybridization based methods however, promises greater sensitivity and higher specificity in terms of complementary base pairing to the target probe [5–8]. Molecular beacons are fluorescent probes that are commonly used to detect DNA hybridization in homogenous solution. Other widely used labels are those that provide a radioactive, chemiluminescent or colorimetric signal. These techniques are sensitive and rely on the specific activity of the labeled oligonucleotide when bound to its target [9]. However, the applications of molecular beacons are challenging as long stretches of target complementary sequences are required, leading to formation of hairpin structures which hinders binding [10]. Although fluorescence assays are
⇑ Corresponding authors. Fax: +60 4 653 4803. E-mail addresses: [email protected] (S.Y. Lee), [email protected] (N.H. Hairul Bahara), [email protected] (Y.S. Choong), [email protected] (T.S. Lim), [email protected] (G.J. Tye). 1 Authors contributed equally. http://dx.doi.org/10.1016/j.jcis.2014.07.033 0021-9797/Ó 2014 Elsevier Inc. All rights reserved.
highly sought after, background intensities that may jeopardize the sensitivity of the assay [11]. A new class of fluorescent reporter system recently introduced for DNA detection is the AgNC. This concept hinges on silver ions having a high affinity to DNA molecules with preferential binding to cytosine nucleotides [12]. The nucleation mechanism of AgNC can be synthesized following two routes, either by chemical reduction using sodium borohydrate or by photoreduction using UV light. In the presence of silver nitrate salts, DNA with cytosine rich stretches allows binding of silver ions. Chemical reduction of AgNCs with sodium borohydrate results in the encapsulation of two to ten silver atoms by the DNA [5]. Unlike quantum dots (2–10 nm) [13] and nanoparticles, silver nanoclusters are relatively discrete and only up to 2 nm in size [14]. Albeit quantum dots are stable, bright and is adjustable for its emission, the size of this nanoparticle hinders some application as a fluorescent label. This provides AgNC an advantage over other fluorescence technique for intracellular DNA detection [15]. Facile synthesis of the cluster and high photostability enable long analysis period, making it superior to organic dyes that undergo rapid photo-bleaching [16]. In addition, silver nanocluster emissions can be tuned by varying the DNA length and sequence [17]. Nanoclusters are reported to be heat stable and are able to withstand high temperatures of up to 80 °C [17]. This provides an added advantage of implementing this nanocluster as a fluorescent probe
184
S.Y. Lee et al. / Journal of Colloid and Interface Science 433 (2014) 183–188
for DNA hybridization detection. The application of DNA hybridization is useful for the identification of the presence of certain genes of interest for identification or diagnosis. The diversity of the AgNC can be seen in an impinging application [18] ranging from molecular imaging [19], metal ion sensing [20], catalysis [21] and to DNA/RNA detection [22,23]. FOXP3 is an important marker for the identification of regulatory T-cells (Tregs) in combination with other markers such as CD4, CD25 and CD127 [24]. As FOXP3 is the master regulator of Tregs therefore up-regulation of this gene correlates with the polarization of naïve CD4+ T cells toward Tregs (both in human and mice) [25,26]. The detection of FOXP3 up-regulation would require the ability to distinguish translated and un-translated FOXP3 DNA in CD4+ T cells. Therefore, by selecting binding sites between 2 exons, we would be able to clearly distinguish between cells with upregulated FOXP3. In this study we utilized AgNC based DNA fluorescence shift sensor for the detection of FOXP3 target by DNA hybridization. The target sequence will form a three-way junction upon hybridization, resulting in a shift in excitation and emission with improved fluorescence intensity. We also studied the effects of temperature to improve hybridization kinetics to allow rapid hybridization. This method provides a rapid and specific sensor using DNA nanoclusters for DNA detection. 2. Material and methods 2.1. Synthesis of silver nanocluster (AgNC) Stock single-stranded DNA (ssDNA) silver nanocluster nucleation strand at 100 lM (CCCTTAATCCCCATACAGCTGCAGCTGCGA, bold sequences represents silver cluster formation site; underlined sequences represents target binding sites) was first dissolved to 15 lM in deionized water. The mixture was incubated at 95 °C for 5 min in MyCycler Thermal Cycler (Bio Rad, USA), followed by 70 °C for 1 h and cooled on ice. AgNO3 (Sigma Aldrich, St. Louis, MO, USA) was diluted in deionized water to obtain a concentration of 10 mM, and kept on ice in the dark for 15 min. After 15 min, freshly prepared NaBH4 (Sigma Aldrich, St. Louis, MO, USA) was added to the cooled nucleotides and mixed with vigorous shaking prior to overnight (o/n) room temperature (RT) incubation. The molar ratio of DNA, AgNO3 and NaBH4 was 1:12:12. Final concentrations were 15 lM of AgNC nucleation strand, 180 lM of AgNO3 and 180 lM of NaBH4 in water. All synthetic oligos used in this experiment were synthesized from Integrated DNA technologies, Inc., (IDT, Iowa) [27]. 2.2. Hybridization of AgNC to FOXP3 target Equimolar concentration of both ssDNA and dsDNA FOXP3 target (TCGCAGCTGCAGCTGCCCACACTGCCCCTAGTC, NM_014009.3, 386-419 synthesized by IDT), AgNC and G-rich (GACTAGGG GCAGTGTGGGTATGGGTGGGGTGGGGTGGGG, underlined sequences represents target binding sites, bold sequences represents G-rich sites) were added to a final volume of 100 lL with 20 mM pH 6.6 sodium phosphate buffer followed by vigorous shaking. A nonspecific DNA target (CTTCCTCAAGCACTGCCAGGCGGACCATCT) was used as a negative control. The mixture was incubated at 95 °C for 5 min with MyCycler Thermal Cycler (Bio Rad, USA) and left to cool to room temperature (RT) for 3 h or o/n [28]. 2.3. Fluorescence measurements and visualization Fluorescence measurements were obtained using a fluorescence plate reader (Cary Eclipse Fluorometer, Varian) after determining its
excitation via Multiskan Spectrum (Thermo Scientific, USA). The physical fluorescence was observed under UV illumination at 302 nm using a UV illuminator (Syngene, UK). The samples were documented using a digital camera. The data collected and statistical test (Student T-test) was analyzed using GraphPad Prism version 5.01 for Windows (GraphPad Software, La Jolla California USA). 2.4. Polyacrylamide gel electrophoresis (PAGE) Native polyacrylamide gel electrophoresis (PAGE) (15%) was performed with TBE buffer (44.5 mM Tris-base, 44.5 mM Boric Acid, 1 mM EDTA). Electrophoresis was conducted for 2 h at 110 V. The gel image was observed under UV illumination at 302 nm using a UV illuminator (Syngene, UK) before and after staining with ethidium bromide (EtBr). The gel image was documented with the UV illuminators camera. 3. Results 3.1. Changes in fluorescence color observed under UV illumination In this study, AgNC sequence and G-rich sequence was designed based on the single-nucleotide variation design in Yeh et al., 2012 against FOXP3 mRNA sequence [28]. The target region for FOXP3 detection was designed to anneal to the junction of exon 2 and 3 in order to specifically target the translated FOXP3. Fig. 1 illustrates the overall mechanism of the three-way junction binding for FOXP3 target detection. The differences in physical color of the hybridized samples are shown in Fig. 2. For samples that do not form the three-way junction (Tube 2 – AgNC with G-rich and Tube 3 – AgNC with dsDNA FOXP3) a yellow fluorescence under UV illumination was observed under UV illumination. Successful formation of the three-way junction by hybridization of AgNC, G-rich and target DNA, for both ssDNA (NCGTss – Tube 7) and dsDNA (NCGTds – Tube 4) appeared to fluoresce as an orange-red color under UV illumination. The color patterns were consistent for both 3 h and o/n hybridization. The G-rich with dsDNA FOXP3 (Tube 5) sample did not yield any fluorescence due to the absence of the AgNC. However, the AgNC with G-rich and non-specific DNA target sample (Tube 6) exhibited similar yellow fluorescence with Tube 1, 2 and 3. The yellow fluorescence exhibited is the result of the AgNC fluorescence as background. Therefore a clear distinction in color is observed with the successful hybridization of all three elements to form the threeway junction. 3.2. Formation of three-way junction The formation of the three-way junction was observed following the shift in fluorescence color produced (yellow to orange-red). In order to confirm the shift in fluorescence spectra is caused by successful hybridization, a PAGE analysis of the hybridized AgNC, G-rich, FOXP3 synthetic oligonucleotide and its controls were conducted (Fig. 3). The polyacrylamide gel electrophoresis (PAGE) results shows successful hybridization of AgNC, G-rich to target DNA strand (both ssDNA and dsDNA) with a distinctively higher band shift. In Fig. 3a, the red fluorescence band (lane 6 and 9) was observed at a higher band shift under UV illumination compared to the yellow fluorescence band observed at the lower end of the PAGE gel. The fluorescence was confirmed using a UV illuminator camera as seen in Fig. 3b. After staining with EtBr (Fig. 3c), the location of the red fluorescence band confirm the formation of the threeway junction complex due to its higher base stacking. The yellow fluorescence bands (lane 3, 4, 5 and 8) with a faster migration confirm that no formation of the complex occurred. A distinction in hybridization was observed as a band shift occurred in the gel lanes
S.Y. Lee et al. / Journal of Colloid and Interface Science 433 (2014) 183–188
185
Fig. 1. Illustration of the FOXP3 target hybridization to AgNC and G-rich. The AgNC was prepared by reducing silver nitrate with sodium borohydrate. The G-rich is the complementary DNA strand which a stretch of guanines. In the absence of target binding, the two strands (AgNC and G-rich) were unable to bind to one another thus no shift in fluorescence was produced. After 3 h or o/n hybridization, AgNC and G-rich strand bound specifically to the FOXP3 target. Binding of AgNC and G-rich to target sequence allows the overhanging region generated to come to close proximity producing a shift in fluorescence.
Fig. 2. Fluorescence color of hybridization samples under UV 365 nm light (a) 3 h hybridization samples (b) o/n hybridization samples. Tube 1 – AgNC only, Tube 2 – AgNC with G-rich, Tube 3 – AgNC with dsDNA FOXP3, Tube 4 – AgNC with G-rich and dsDNA FOXP3, Tube 5 – G-rich with dsDNA FOXP3, Tube 6 – AgNC with G-rich and non-specific DNA target, Tube 7 – AgNC with G-rich and ssDNA FOXP3.
containing AgNC, G-rich and target (both ssDNA and dsDNA) when compared to other controls, especially in lane 8 containing NCGTnon. The band shift observed was a red fluorescence band (Fig. 3a), which corroborates to the change of physical color to orange-red as in Tube 4 and 7 of Fig. 2. In control lanes where only a yellow band was observed, the bands were located further down the PAGE gel, indicating no formation of the three-way junction. In general,
double helix base complementary stacking travels slower during electrophoresis compared to ssDNA, thus a higher band shift would indicate the successful hybridization to form a three-way junction. However, lower band shift was seen, likely associated to partial annealing of the DNA strands at few bases. The similar band shift pattern of the non-specific DNA target controls indicates partial annealing to the AgNC. The PAGE gel was also observed after EtBr staining in order to further confirm formation of the three-way junction. The formation of a double helix after hybridization results in an increased intensity of the bands after staining with EtBr. In the presence of double helix complexes, EtBr dye binds and intercalate stronger within the compact base stacking [29]. Binding of the EtBr dye to the dsDNA causes a change to the overall density of the DNA hence resulting in a distortion [30] and increases the torsion stress [31] on the double helix. Therefore, we were also able to distinguish the presence of the hybridized complex by the band shift, fluorescence band color and dye intensity. We expected EtBr to bind ssDNA by secondary structure formation [32] causing the signal intensity to be lower due to the weaker interaction to ssDNA compared to dsDNA [33]. The band shift is slightly lower due to the formation of normal DNA base pairing. Therefore, the band shifts from the PAGE analysis indicates successful hybridization for both NCGTds and NCGTss with higher band shift patterns visible. This data corroborates the finding in Section 3.1 that the change in fluorescence is due to the formation of the three-way junction complex. 3.3. Method application To verify the shift in fluorescence, fluorescence emission spectrum was measured with fluorescence spectroscopy. The excitation
186
S.Y. Lee et al. / Journal of Colloid and Interface Science 433 (2014) 183–188
Fig. 3. Polyacrylamide gel electrophoresis (PAGE) for o/n hybridization. The samples were separated with 15% polyacrylamide gel in 1 TBE buffer. The nine samples represented ssDNA (lane 1), dsDNA (lane 2), AgNC only (lane 3), NCG (lane 4), NCT (lane 5), NCGTds (lane 6), GT (lane 7), NCGTnon (lane 8) and NCGTss (lane 9). The band shift (as shown in the figure with an arrow) was observed in lane 6 and 9 where the formation of the three-way junction occurred. Under UV excitation, (a) red fluorescence band was observed in lane 6 and 9. (b) The image was then recaptured using a UV illuminator camera that produces white band in fluorescing instances without EtBr staining. (c) To confirm that the hybridization occurs, EtBr staining was conducted and the image of the stained PAGE gel was recorded with the UV illuminator.
and emission spectra of the hybridized samples with o/n hybridization is shown in Fig. 4. The excitation wavelength of the AgNC was detected at 480 nm with an emission at 577 nm (mean) ± 5.57 (SD) and mean fluorescence intensity of 2.278 ± 0.99 (n = 3). The hybridization of G-rich and AgNC to dsDNA resulted in a shift in excitation and emission to 595 nm and 654 nm ± 1.15 respectively with a mean intensity of 53.696 ± 7.24 (n = 3). This shift was shown to be consistent for both ssDNA and dsDNA. The specific shift of emission wavelength for AgNC with G-rich and ssDNA or dsDNA from 577 nm to 654 nm allows a specific detection of the FOXP3 target. The color spectrum was consistent with the excitation and emission wavelength from the fluorescence scan [34]. The emission wavelength for 577 nm and 654 nm does corresponds to the color spectra of its wavelength which is within the yellow region for 577 nm and orange-red region for 654 nm as seen in
Fig. 2. This clear shift in excitation and emission with an increased intensity would result in accurate detection of the target. Fig. 4 shows the increased fluorescence intensity to 53.696 ± 7.24 when the AgNC and G-rich hybridizes to matching dsDNA. For the hybridization of ssDNA FOXP3 with AgNC and Grich (NCGTss), the mean intensity obtained is 80.307 ± 18.45 at 595 nm excitation. The background fluorescence from just the AgNC and non-specific DNA target provided a significant difference from the positive samples. This is a great advantage as the low background intensities will help to improve the detection system. In order to minimize the process time of the assay, we investigated the time required for the hybridization process to occur for detection of the target. Results for the comparative study between a rapid 3 h hybridization and o/n hybridization are shown in Fig. 4. Table 1 shows the readings for each sample at both sets of excitation and emission wavelengths for 3 h and o/n hybridization. The results indicated that 3 h hybridization is sufficient to yield the fluorescence shift for the three-way junction binding at 595 nm with the emission at 655 nm (mean) ± 2.00 (SD) (p < 0.05 compared to AgNC and NCGTnon). There is no significance difference for NCGTds for 3 h hybridization and NCGTds for o/n hybridization. Taking into consideration that 3 h and o/n incubation does not provide a major difference in readout and background readings, we would recommend that hybridization for 3 h is sufficient for analysis. This will allow a more rapid assay to be designed. The fluorescence readout for NCGTss was 71.37 ± 8.48 and 80.307 ± 18.45 for 3 h and o/n hybridization respectively. However, NCGTds generated lower readings for both 3 h and o/n hybridization with 66.835 ± 6.24 and 53.696 ± 7.24 respectively. Although NCGTss showed higher fluorescence intensity, the value obtained was not statistically significant (Table 1, p > 0.05) as compared to NCGTds. We attributed the decrease in intensity to partial unwinding of dsDNA complexes during the 95 °C incubation or re-annealing of the FOXP3 target strands. This would reduce the number of available target strands for hybridization with the AgNC and Grich. The NCGTnon, after heat treatment did not generate any shift in fluorescence. This is due to its inability to hybridize and form a duplex structure with the AgNC and G-rich strand owing to the specificity of DNA pairing [27]. This shift in fluorescence is attributed to the rigid binding of the complementary duplex base pairing to the G-rich that protects the AgNC from quenching [35]. The assay was capable of detecting a series of FOXP3 target DNA dilution as low as 0.625 lM using standard concentrations of AgNC and G-rich after 3 h of hybridization (Fig. 5). This shows that the limit of detection can be as low as 0.625 lM of FOXP3 target DNA. It is likely that the binding of G-rich and FOXP3 target to AgNC caused a change in the geometry shape of Ag+ ions that binds to the AgNC resulting in a shift in emission wavelength. Previous study used the density functional theory (DFT) method to calculate the geometry and electronic excitation spectra of the silver nanoclusters that were bound to DNA. They showed that a slight different in the geometrical shape resulted to strong shift in absorption band [36]. This differs from the original method of using the nanoclusters whereby only a single binding AgNC strand was used in order to obtain detection. The advantage of having this system is we would be able to allow for a ‘‘on’’ system only when all three strands of DNA come into contact making this method more specific [37–39]. However, the exact function of the G-rich sequence remains unclear and the mechanism of wavelength color shift is not yet fully understood. Interestingly, we noticed that the G-rich when in close proximity to the silver-binding site in the presence of the target would also cause a shift in excitation and emission wavelength with increased fluorescence intensity [40]. Initial hypothesis proposed that the fluorescence shift was due to the electron transfer from the G-rich to the AgNC [41]. However, later
187
S.Y. Lee et al. / Journal of Colloid and Interface Science 433 (2014) 183–188
Fig. 4. Fluorescence emission spectra for NC, NCGTds, NCGTss and NCGTnon with an excitation of (a) 480 nm for 3 h hybridization, (b) 595 nm for 3 h hybridization, (c) 480 nm for o/n hybridization and (d) 595 nm for o/n hybridization. A clear shift in excitation and emission can be seen for NCGTds and NCGTss at 595 nm for both 3 h and o/n hybridization. NC – AgNC only, NCGTds – AgNC, G-rich and dsDNA FOXP3, NCGTss – AgNC, G-rich and ssDNA FOXP3, NCGTnon – AgNC, G-rich and non-specific DNA target.
Table 1 The excitation and emission spectra for each probe and its intensity. Excitation/emission spectra
NC NCGTds NCGTss NCGTnon
Mean intensity (A.U) 480 nm/575 nm 3 h
480 nm/577 nm Overnight
595 nm/655 nm 3 h
595 nm/654 nm Overnight
2.007 ± 0.92 4.908 ± 0.84 5.229 ± 0.75 3.128 ± 0.61
2.278 ± 0.99 9.232 ± 1.87 10.814 ± 0.72 3.693 ± 0.78
0.824 ± 0.66 66.835 ± 6.24 71.37 ± 8.48 2.851 ± 0.82
1.169 ± 0.29 53.696 ± 7.24 80.307 ± 18.45 1.858 ± 0.87
studies proved that guanine was not responsible for the transfer of electron. The experiment used an analog of guanine with a stronger electron donor but results showed that it failed to activate the turning on effect [42]. Therefore the underlying mechanism of such phenomena with guanine rich bases is still not fully understood. Upon observation of the increase in fluorescence in relation
to proximity, we hypothesized that such phenomena may also be driven by the fact that the G-rich strand may function as a fluorophore harvester. As the silver binding site and the G-rich stretches are in close proximity, it is likely that resonance energy transfer could take place resulting in an increase and shift of fluorescence [43].
188
S.Y. Lee et al. / Journal of Colloid and Interface Science 433 (2014) 183–188
Fig. 5. Fluorescence emission spectra for target sensitivity hybridization at 595 nm for 3 h hybridization. A series of diluting concentration of FOXP3 target and its detection using 10 lM of AgNC and G-rich.
4. Conclusion The ability of the DNA fluorescence shift sensor to produce a shift in excitation, emission and fluorescence intensity allows for a rapid and easy detection system for DNA with little background interference. The FOXP3 target sequence was successfully detected by the shift in excitation and emission wavelengths of the AgNC. By designing the AgNC and G-rich sequence to target areas between 2 exons as shown here, it is possible that an mRNA detection system can be made. The AgNC and G-rich strands used in this system would also allow for detection with higher specificity, making it a rapid and specific system. Taking into consideration the advantages, the DNA fluorescence shift sensor can be an appealing alternative for DNA hybridization assays. Acknowledgments TSL would like to acknowledge Malaysian Ministry of Education through the Higher Institution Centre of Excellence (HICoE) Grant (Grant No: 311/CIPPM/44001005). GJT would like to acknowledge the Universiti Sains Malaysia Short Term Grant (Grant No: 304/CIPPM/6313052). We would also like to acknowledge Dr. Shahram Y. Kordasti of King’s College London who critically reviewed the manuscript. References [1] K.A. Frazer, D.G. Ballinger, D.R. Cox, D.A. Hinds, L.L. Stuve, R.A. Gibbs, J.W. Belmont, A. Boudreau, P. Hardenbol, S.M. Leal, Nature 449 (2007) 851.
[2] X. Cheng, G. Chen, W.R. Rodriguez, Anal. Bioanal. Chem. 393 (2009) 487. [3] M.J. Marton, J.L. DeRisi, H.A. Bennett, V.R. Iyer, M.R. Meyer, C.J. Roberts, R. Stoughton, J. Burchard, D. Slade, H. Dai, Nat. Med. 4 (1998) 1293. [4] Z.S. Wu, J.H. Jiang, G.L. Shen, R.Q. Yu, Hum. Mutat. 28 (2007) 630. [5] G.-Y. Lan, W.-Y. Chen, H.-T. Chang, RSC Adv. 1 (2011) 802. [6] F. Lucarelli, S. Tombelli, M. Minunni, G. Marrazza, M. Mascini, Anal. Chim. Acta 609 (2008) 139. [7] Y. Zhang, Y. Wang, H. Wang, J.-H. Jiang, G.-L. Shen, R.-Q. Yu, J. Li, Anal. Chem. 81 (2009) 1982. [8] W. Vercoutere, M. Akeson, Curr. Opin. Chem. Biol. 6 (2002) 816. [9] B. Liu, G.C. Bazan, Chem. Mater. 16 (2004) 4467. [10] J.F. Hopkins, S.A. Woodson, Nucl. Acids Res. 33 (2005) 5763. [11] M. Gao, G. Lewis, G.M. Turner, A. Soubret, V. Ntziachristos, Appl. Opt. 44 (2005) 5468. [12] C.I. Richards, S. Choi, J.-C. Hsiang, Y. Antoku, T. Vosch, A. Bongiorno, Y.-L. Tzeng, R.M. Dickson, J. Am. Chem. Soc. 130 (2008) 5038. [13] Y. Ghasemi, P. Peymani, S. Afifi, Acta Bio-Med.: Atenei Parmensis 80 (2009) 156. [14] H. Xu, K.S. Suslick, Adv. Mater. 22 (2010) 1078. [15] B. Han, E. Wang, Anal. Bioanal. Chem. 402 (2012) 129. [16] T. Vosch, Y. Antoku, J.-C. Hsiang, C.I. Richards, J.I. Gonzalez, R.M. Dickson, Proc. Natl. Acad. Sci. 104 (2007) 12616. [17] J. Sharma, R.C. Rocha, M.L. Phipps, H.C. Yeh, K.A. Balatsky, D.M. Vu, A.P. Shreve, J.H. Werner, J.S. Martinez, Nanoscale 4 (2012) 4107. [18] Z. Yuan, Y.-C. Chen, H.-W. Li, H.-T. Chang, Chem. Commun. (2014). [19] J. Ai, W. Guo, B. Li, T. Li, D. Li, E. Wang, Talanta 88 (2012) 450. [20] L. Shang, S. Dong, J. Mater. Chem. 18 (2008) 4636. [21] J. Belloni, Catal. Today 113 (2006) 141. [22] Y. Hsin-Chih, J. Sharma, J.J. Han, J.S. Martinez, J.H. Werner, in: IEEE International Conference on Nano/Micro Engineered and Molecular Systems (NEMS), 2011, p. 267. [23] S.W. Yang, T. Vosch, Anal. Chem. 83 (2011) 6935. [24] S. Klein, C.C. Kretz, P.H. Krammer, A. Kuhn, J. Invest. Dermatol. 130 (2010) 492. [25] E. Billerbeck, W.T. Barry, K. Mu, M. Dorner, C.M. Rice, A. Ploss, Blood (2011). [26] S. Hori, T. Nomura, S. Sakaguchi, Science 299 (2003) 1057. [27] H.C. Yeh, J. Sharma, J.J. Han, J.S. Martinez, J.H. Werner, Nano Lett. 10 (2010) 3106. [28] H.C. Yeh, J. Sharma, M. Shih Ie, D.M. Vu, J.S. Martinez, J.H. Werner, J. Am. Chem. Soc. 134 (2012) 11550. [29] L. Moran, M.-E. Mirault, A. Tissières, J. Lis, P. Schedl, S. Artavanis-Tsakonas, W.J. Gehring, Cell 17 (1979) 1. [30] D. Reha, M. Kabelác, F. Ryjácek, J. Šponer, J.E. Šponer, M. Elstner, S. Suhai, P. Hobza, J. Am. Chem. Soc. 125 (2003) 5581. [31] A. Celedon, D. Wirtz, S. Sun, J. Phys. Chem. B 114 (2010) 16929. [32] D. Bikard, C. Loot, Z. Baharoglu, D. Mazel, Microbiol. Mol. Biol. Rev. 74 (2010) 570. [33] P. Vardevanyan, A. Antonyan, M. Parsadanyan, H. Davtyan, A. Karapetyan, Exp. Mol. Med. 35 (2003) 527. [34] A. Latorre, Á. Somoza, ChemBioChem 13 (2012) 951. [35] A. Latorre, R. Lorca, Á. Somoza, J. Chem. 2013 (2013) 1. [36] R.R. Ramazanov, A.I. Kononov, J. Phys. Chem. C 117 (2013) 18681. [37] J.T. Petty, B. Sengupta, S.P. Story, N.N. Degtyareva, Anal. Chem. 83 (2011) 5957. [38] G.-Y. Lan, W.-Y. Chen, H.-T. Chang, Biosensors Bioelectron. 26 (2011) 2431. [39] P. Shah, A. Rørvig-Lund, S.B. Chaabane, P.W. Thulstrup, H.G. Kjaergaard, E. Fron, J. Hofkens, S.W. Yang, T. Vosch, ACS Nano 6 (2012) 8803. [40] J. Li, X. Zhong, H. Zhang, X.C. Le, J.-J. Zhu, Anal. Chem. 84 (2012) 5170. [41] I. Diez, R.H.A. Ras, Nanoscale 3 (2011) 1963. [42] J.M. Obliosca, C. Liu, R.A. Batson, M.C. Babin, J.H. Werner, H.-C. Yeh, Biosensors 3 (2013) 185. [43] S. Tyagi, S.A.E. Marras, F.R. Kramer, Nat. Biotech. 18 (2000) 1191.
Contents lists available at ScienceDirect
Journal of Colloid and Interface Science www.elsevier.com/locate/jcis
DNA fluorescence shift sensor: A rapid method for the detection of DNA hybridization using silver nanoclusters Shin Yong Lee 1, Nur Hidayah Hairul Bahara 1, Yee Siew Choong, Theam Soon Lim ⇑, Gee Jun Tye ⇑ Institute for Research in Molecular Medicine, Universiti Sains Malaysia, 11800 Minden, Penang, Malaysia
a r t i c l e
i n f o
Article history: Received 6 June 2014 Accepted 23 July 2014 Available online 31 July 2014 Keywords: Silver nanocluster (AgNC) Fluorescence shift DNA detection DNA hybridization
a b s t r a c t DNA-templated silver nanoclusters (AgNC) are a class of subnanometer sized fluorophores with good photostability and brightness. It has been applied as a diagnostic tool mainly for deoxyribonucleic acid (DNA) detection. Integration of DNA oligomers to generate AgNCs is interesting as varying DNA sequences can result in different fluorescence spectra. This allows a simple fluorescence shifting effect to occur upon DNA hybridization with the hybridization efficiency being a pronominal factor for successful shifting. The ability to shift the fluorescence spectra as a result of hybridization overcomes the issue of background intensities in most fluorescent based assays. Here we describe an optimized method for the detection of single-stranded and double-stranded synthetic forkhead box P3 (FOXP3) target by hybridization with the DNA fluorescence shift sensor. The system forms a three-way junction by successful hybridization of AgNC, G-rich strand (G-rich) to the target DNA, which generated a shift in fluorescence spectra with a marked increase in fluorescence intensity. The DNA fluorescence shift sensor presents a rapid and specific alternative to conventional DNA detection. Ó 2014 Elsevier Inc. All rights reserved.
1. Introduction DNA detection and identification is of importance as it plays a central role in the application of genetics [1], molecular diagnostic [2] and drug treatments [3]. Two of the most prominent methods of DNA detection are based on hybridization and point mutation [4]. Hybridization based methods however, promises greater sensitivity and higher specificity in terms of complementary base pairing to the target probe [5–8]. Molecular beacons are fluorescent probes that are commonly used to detect DNA hybridization in homogenous solution. Other widely used labels are those that provide a radioactive, chemiluminescent or colorimetric signal. These techniques are sensitive and rely on the specific activity of the labeled oligonucleotide when bound to its target [9]. However, the applications of molecular beacons are challenging as long stretches of target complementary sequences are required, leading to formation of hairpin structures which hinders binding [10]. Although fluorescence assays are
⇑ Corresponding authors. Fax: +60 4 653 4803. E-mail addresses: [email protected] (S.Y. Lee), [email protected] (N.H. Hairul Bahara), [email protected] (Y.S. Choong), [email protected] (T.S. Lim), [email protected] (G.J. Tye). 1 Authors contributed equally. http://dx.doi.org/10.1016/j.jcis.2014.07.033 0021-9797/Ó 2014 Elsevier Inc. All rights reserved.
highly sought after, background intensities that may jeopardize the sensitivity of the assay [11]. A new class of fluorescent reporter system recently introduced for DNA detection is the AgNC. This concept hinges on silver ions having a high affinity to DNA molecules with preferential binding to cytosine nucleotides [12]. The nucleation mechanism of AgNC can be synthesized following two routes, either by chemical reduction using sodium borohydrate or by photoreduction using UV light. In the presence of silver nitrate salts, DNA with cytosine rich stretches allows binding of silver ions. Chemical reduction of AgNCs with sodium borohydrate results in the encapsulation of two to ten silver atoms by the DNA [5]. Unlike quantum dots (2–10 nm) [13] and nanoparticles, silver nanoclusters are relatively discrete and only up to 2 nm in size [14]. Albeit quantum dots are stable, bright and is adjustable for its emission, the size of this nanoparticle hinders some application as a fluorescent label. This provides AgNC an advantage over other fluorescence technique for intracellular DNA detection [15]. Facile synthesis of the cluster and high photostability enable long analysis period, making it superior to organic dyes that undergo rapid photo-bleaching [16]. In addition, silver nanocluster emissions can be tuned by varying the DNA length and sequence [17]. Nanoclusters are reported to be heat stable and are able to withstand high temperatures of up to 80 °C [17]. This provides an added advantage of implementing this nanocluster as a fluorescent probe
184
S.Y. Lee et al. / Journal of Colloid and Interface Science 433 (2014) 183–188
for DNA hybridization detection. The application of DNA hybridization is useful for the identification of the presence of certain genes of interest for identification or diagnosis. The diversity of the AgNC can be seen in an impinging application [18] ranging from molecular imaging [19], metal ion sensing [20], catalysis [21] and to DNA/RNA detection [22,23]. FOXP3 is an important marker for the identification of regulatory T-cells (Tregs) in combination with other markers such as CD4, CD25 and CD127 [24]. As FOXP3 is the master regulator of Tregs therefore up-regulation of this gene correlates with the polarization of naïve CD4+ T cells toward Tregs (both in human and mice) [25,26]. The detection of FOXP3 up-regulation would require the ability to distinguish translated and un-translated FOXP3 DNA in CD4+ T cells. Therefore, by selecting binding sites between 2 exons, we would be able to clearly distinguish between cells with upregulated FOXP3. In this study we utilized AgNC based DNA fluorescence shift sensor for the detection of FOXP3 target by DNA hybridization. The target sequence will form a three-way junction upon hybridization, resulting in a shift in excitation and emission with improved fluorescence intensity. We also studied the effects of temperature to improve hybridization kinetics to allow rapid hybridization. This method provides a rapid and specific sensor using DNA nanoclusters for DNA detection. 2. Material and methods 2.1. Synthesis of silver nanocluster (AgNC) Stock single-stranded DNA (ssDNA) silver nanocluster nucleation strand at 100 lM (CCCTTAATCCCCATACAGCTGCAGCTGCGA, bold sequences represents silver cluster formation site; underlined sequences represents target binding sites) was first dissolved to 15 lM in deionized water. The mixture was incubated at 95 °C for 5 min in MyCycler Thermal Cycler (Bio Rad, USA), followed by 70 °C for 1 h and cooled on ice. AgNO3 (Sigma Aldrich, St. Louis, MO, USA) was diluted in deionized water to obtain a concentration of 10 mM, and kept on ice in the dark for 15 min. After 15 min, freshly prepared NaBH4 (Sigma Aldrich, St. Louis, MO, USA) was added to the cooled nucleotides and mixed with vigorous shaking prior to overnight (o/n) room temperature (RT) incubation. The molar ratio of DNA, AgNO3 and NaBH4 was 1:12:12. Final concentrations were 15 lM of AgNC nucleation strand, 180 lM of AgNO3 and 180 lM of NaBH4 in water. All synthetic oligos used in this experiment were synthesized from Integrated DNA technologies, Inc., (IDT, Iowa) [27]. 2.2. Hybridization of AgNC to FOXP3 target Equimolar concentration of both ssDNA and dsDNA FOXP3 target (TCGCAGCTGCAGCTGCCCACACTGCCCCTAGTC, NM_014009.3, 386-419 synthesized by IDT), AgNC and G-rich (GACTAGGG GCAGTGTGGGTATGGGTGGGGTGGGGTGGGG, underlined sequences represents target binding sites, bold sequences represents G-rich sites) were added to a final volume of 100 lL with 20 mM pH 6.6 sodium phosphate buffer followed by vigorous shaking. A nonspecific DNA target (CTTCCTCAAGCACTGCCAGGCGGACCATCT) was used as a negative control. The mixture was incubated at 95 °C for 5 min with MyCycler Thermal Cycler (Bio Rad, USA) and left to cool to room temperature (RT) for 3 h or o/n [28]. 2.3. Fluorescence measurements and visualization Fluorescence measurements were obtained using a fluorescence plate reader (Cary Eclipse Fluorometer, Varian) after determining its
excitation via Multiskan Spectrum (Thermo Scientific, USA). The physical fluorescence was observed under UV illumination at 302 nm using a UV illuminator (Syngene, UK). The samples were documented using a digital camera. The data collected and statistical test (Student T-test) was analyzed using GraphPad Prism version 5.01 for Windows (GraphPad Software, La Jolla California USA). 2.4. Polyacrylamide gel electrophoresis (PAGE) Native polyacrylamide gel electrophoresis (PAGE) (15%) was performed with TBE buffer (44.5 mM Tris-base, 44.5 mM Boric Acid, 1 mM EDTA). Electrophoresis was conducted for 2 h at 110 V. The gel image was observed under UV illumination at 302 nm using a UV illuminator (Syngene, UK) before and after staining with ethidium bromide (EtBr). The gel image was documented with the UV illuminators camera. 3. Results 3.1. Changes in fluorescence color observed under UV illumination In this study, AgNC sequence and G-rich sequence was designed based on the single-nucleotide variation design in Yeh et al., 2012 against FOXP3 mRNA sequence [28]. The target region for FOXP3 detection was designed to anneal to the junction of exon 2 and 3 in order to specifically target the translated FOXP3. Fig. 1 illustrates the overall mechanism of the three-way junction binding for FOXP3 target detection. The differences in physical color of the hybridized samples are shown in Fig. 2. For samples that do not form the three-way junction (Tube 2 – AgNC with G-rich and Tube 3 – AgNC with dsDNA FOXP3) a yellow fluorescence under UV illumination was observed under UV illumination. Successful formation of the three-way junction by hybridization of AgNC, G-rich and target DNA, for both ssDNA (NCGTss – Tube 7) and dsDNA (NCGTds – Tube 4) appeared to fluoresce as an orange-red color under UV illumination. The color patterns were consistent for both 3 h and o/n hybridization. The G-rich with dsDNA FOXP3 (Tube 5) sample did not yield any fluorescence due to the absence of the AgNC. However, the AgNC with G-rich and non-specific DNA target sample (Tube 6) exhibited similar yellow fluorescence with Tube 1, 2 and 3. The yellow fluorescence exhibited is the result of the AgNC fluorescence as background. Therefore a clear distinction in color is observed with the successful hybridization of all three elements to form the threeway junction. 3.2. Formation of three-way junction The formation of the three-way junction was observed following the shift in fluorescence color produced (yellow to orange-red). In order to confirm the shift in fluorescence spectra is caused by successful hybridization, a PAGE analysis of the hybridized AgNC, G-rich, FOXP3 synthetic oligonucleotide and its controls were conducted (Fig. 3). The polyacrylamide gel electrophoresis (PAGE) results shows successful hybridization of AgNC, G-rich to target DNA strand (both ssDNA and dsDNA) with a distinctively higher band shift. In Fig. 3a, the red fluorescence band (lane 6 and 9) was observed at a higher band shift under UV illumination compared to the yellow fluorescence band observed at the lower end of the PAGE gel. The fluorescence was confirmed using a UV illuminator camera as seen in Fig. 3b. After staining with EtBr (Fig. 3c), the location of the red fluorescence band confirm the formation of the threeway junction complex due to its higher base stacking. The yellow fluorescence bands (lane 3, 4, 5 and 8) with a faster migration confirm that no formation of the complex occurred. A distinction in hybridization was observed as a band shift occurred in the gel lanes
S.Y. Lee et al. / Journal of Colloid and Interface Science 433 (2014) 183–188
185
Fig. 1. Illustration of the FOXP3 target hybridization to AgNC and G-rich. The AgNC was prepared by reducing silver nitrate with sodium borohydrate. The G-rich is the complementary DNA strand which a stretch of guanines. In the absence of target binding, the two strands (AgNC and G-rich) were unable to bind to one another thus no shift in fluorescence was produced. After 3 h or o/n hybridization, AgNC and G-rich strand bound specifically to the FOXP3 target. Binding of AgNC and G-rich to target sequence allows the overhanging region generated to come to close proximity producing a shift in fluorescence.
Fig. 2. Fluorescence color of hybridization samples under UV 365 nm light (a) 3 h hybridization samples (b) o/n hybridization samples. Tube 1 – AgNC only, Tube 2 – AgNC with G-rich, Tube 3 – AgNC with dsDNA FOXP3, Tube 4 – AgNC with G-rich and dsDNA FOXP3, Tube 5 – G-rich with dsDNA FOXP3, Tube 6 – AgNC with G-rich and non-specific DNA target, Tube 7 – AgNC with G-rich and ssDNA FOXP3.
containing AgNC, G-rich and target (both ssDNA and dsDNA) when compared to other controls, especially in lane 8 containing NCGTnon. The band shift observed was a red fluorescence band (Fig. 3a), which corroborates to the change of physical color to orange-red as in Tube 4 and 7 of Fig. 2. In control lanes where only a yellow band was observed, the bands were located further down the PAGE gel, indicating no formation of the three-way junction. In general,
double helix base complementary stacking travels slower during electrophoresis compared to ssDNA, thus a higher band shift would indicate the successful hybridization to form a three-way junction. However, lower band shift was seen, likely associated to partial annealing of the DNA strands at few bases. The similar band shift pattern of the non-specific DNA target controls indicates partial annealing to the AgNC. The PAGE gel was also observed after EtBr staining in order to further confirm formation of the three-way junction. The formation of a double helix after hybridization results in an increased intensity of the bands after staining with EtBr. In the presence of double helix complexes, EtBr dye binds and intercalate stronger within the compact base stacking [29]. Binding of the EtBr dye to the dsDNA causes a change to the overall density of the DNA hence resulting in a distortion [30] and increases the torsion stress [31] on the double helix. Therefore, we were also able to distinguish the presence of the hybridized complex by the band shift, fluorescence band color and dye intensity. We expected EtBr to bind ssDNA by secondary structure formation [32] causing the signal intensity to be lower due to the weaker interaction to ssDNA compared to dsDNA [33]. The band shift is slightly lower due to the formation of normal DNA base pairing. Therefore, the band shifts from the PAGE analysis indicates successful hybridization for both NCGTds and NCGTss with higher band shift patterns visible. This data corroborates the finding in Section 3.1 that the change in fluorescence is due to the formation of the three-way junction complex. 3.3. Method application To verify the shift in fluorescence, fluorescence emission spectrum was measured with fluorescence spectroscopy. The excitation
186
S.Y. Lee et al. / Journal of Colloid and Interface Science 433 (2014) 183–188
Fig. 3. Polyacrylamide gel electrophoresis (PAGE) for o/n hybridization. The samples were separated with 15% polyacrylamide gel in 1 TBE buffer. The nine samples represented ssDNA (lane 1), dsDNA (lane 2), AgNC only (lane 3), NCG (lane 4), NCT (lane 5), NCGTds (lane 6), GT (lane 7), NCGTnon (lane 8) and NCGTss (lane 9). The band shift (as shown in the figure with an arrow) was observed in lane 6 and 9 where the formation of the three-way junction occurred. Under UV excitation, (a) red fluorescence band was observed in lane 6 and 9. (b) The image was then recaptured using a UV illuminator camera that produces white band in fluorescing instances without EtBr staining. (c) To confirm that the hybridization occurs, EtBr staining was conducted and the image of the stained PAGE gel was recorded with the UV illuminator.
and emission spectra of the hybridized samples with o/n hybridization is shown in Fig. 4. The excitation wavelength of the AgNC was detected at 480 nm with an emission at 577 nm (mean) ± 5.57 (SD) and mean fluorescence intensity of 2.278 ± 0.99 (n = 3). The hybridization of G-rich and AgNC to dsDNA resulted in a shift in excitation and emission to 595 nm and 654 nm ± 1.15 respectively with a mean intensity of 53.696 ± 7.24 (n = 3). This shift was shown to be consistent for both ssDNA and dsDNA. The specific shift of emission wavelength for AgNC with G-rich and ssDNA or dsDNA from 577 nm to 654 nm allows a specific detection of the FOXP3 target. The color spectrum was consistent with the excitation and emission wavelength from the fluorescence scan [34]. The emission wavelength for 577 nm and 654 nm does corresponds to the color spectra of its wavelength which is within the yellow region for 577 nm and orange-red region for 654 nm as seen in
Fig. 2. This clear shift in excitation and emission with an increased intensity would result in accurate detection of the target. Fig. 4 shows the increased fluorescence intensity to 53.696 ± 7.24 when the AgNC and G-rich hybridizes to matching dsDNA. For the hybridization of ssDNA FOXP3 with AgNC and Grich (NCGTss), the mean intensity obtained is 80.307 ± 18.45 at 595 nm excitation. The background fluorescence from just the AgNC and non-specific DNA target provided a significant difference from the positive samples. This is a great advantage as the low background intensities will help to improve the detection system. In order to minimize the process time of the assay, we investigated the time required for the hybridization process to occur for detection of the target. Results for the comparative study between a rapid 3 h hybridization and o/n hybridization are shown in Fig. 4. Table 1 shows the readings for each sample at both sets of excitation and emission wavelengths for 3 h and o/n hybridization. The results indicated that 3 h hybridization is sufficient to yield the fluorescence shift for the three-way junction binding at 595 nm with the emission at 655 nm (mean) ± 2.00 (SD) (p < 0.05 compared to AgNC and NCGTnon). There is no significance difference for NCGTds for 3 h hybridization and NCGTds for o/n hybridization. Taking into consideration that 3 h and o/n incubation does not provide a major difference in readout and background readings, we would recommend that hybridization for 3 h is sufficient for analysis. This will allow a more rapid assay to be designed. The fluorescence readout for NCGTss was 71.37 ± 8.48 and 80.307 ± 18.45 for 3 h and o/n hybridization respectively. However, NCGTds generated lower readings for both 3 h and o/n hybridization with 66.835 ± 6.24 and 53.696 ± 7.24 respectively. Although NCGTss showed higher fluorescence intensity, the value obtained was not statistically significant (Table 1, p > 0.05) as compared to NCGTds. We attributed the decrease in intensity to partial unwinding of dsDNA complexes during the 95 °C incubation or re-annealing of the FOXP3 target strands. This would reduce the number of available target strands for hybridization with the AgNC and Grich. The NCGTnon, after heat treatment did not generate any shift in fluorescence. This is due to its inability to hybridize and form a duplex structure with the AgNC and G-rich strand owing to the specificity of DNA pairing [27]. This shift in fluorescence is attributed to the rigid binding of the complementary duplex base pairing to the G-rich that protects the AgNC from quenching [35]. The assay was capable of detecting a series of FOXP3 target DNA dilution as low as 0.625 lM using standard concentrations of AgNC and G-rich after 3 h of hybridization (Fig. 5). This shows that the limit of detection can be as low as 0.625 lM of FOXP3 target DNA. It is likely that the binding of G-rich and FOXP3 target to AgNC caused a change in the geometry shape of Ag+ ions that binds to the AgNC resulting in a shift in emission wavelength. Previous study used the density functional theory (DFT) method to calculate the geometry and electronic excitation spectra of the silver nanoclusters that were bound to DNA. They showed that a slight different in the geometrical shape resulted to strong shift in absorption band [36]. This differs from the original method of using the nanoclusters whereby only a single binding AgNC strand was used in order to obtain detection. The advantage of having this system is we would be able to allow for a ‘‘on’’ system only when all three strands of DNA come into contact making this method more specific [37–39]. However, the exact function of the G-rich sequence remains unclear and the mechanism of wavelength color shift is not yet fully understood. Interestingly, we noticed that the G-rich when in close proximity to the silver-binding site in the presence of the target would also cause a shift in excitation and emission wavelength with increased fluorescence intensity [40]. Initial hypothesis proposed that the fluorescence shift was due to the electron transfer from the G-rich to the AgNC [41]. However, later
187
S.Y. Lee et al. / Journal of Colloid and Interface Science 433 (2014) 183–188
Fig. 4. Fluorescence emission spectra for NC, NCGTds, NCGTss and NCGTnon with an excitation of (a) 480 nm for 3 h hybridization, (b) 595 nm for 3 h hybridization, (c) 480 nm for o/n hybridization and (d) 595 nm for o/n hybridization. A clear shift in excitation and emission can be seen for NCGTds and NCGTss at 595 nm for both 3 h and o/n hybridization. NC – AgNC only, NCGTds – AgNC, G-rich and dsDNA FOXP3, NCGTss – AgNC, G-rich and ssDNA FOXP3, NCGTnon – AgNC, G-rich and non-specific DNA target.
Table 1 The excitation and emission spectra for each probe and its intensity. Excitation/emission spectra
NC NCGTds NCGTss NCGTnon
Mean intensity (A.U) 480 nm/575 nm 3 h
480 nm/577 nm Overnight
595 nm/655 nm 3 h
595 nm/654 nm Overnight
2.007 ± 0.92 4.908 ± 0.84 5.229 ± 0.75 3.128 ± 0.61
2.278 ± 0.99 9.232 ± 1.87 10.814 ± 0.72 3.693 ± 0.78
0.824 ± 0.66 66.835 ± 6.24 71.37 ± 8.48 2.851 ± 0.82
1.169 ± 0.29 53.696 ± 7.24 80.307 ± 18.45 1.858 ± 0.87
studies proved that guanine was not responsible for the transfer of electron. The experiment used an analog of guanine with a stronger electron donor but results showed that it failed to activate the turning on effect [42]. Therefore the underlying mechanism of such phenomena with guanine rich bases is still not fully understood. Upon observation of the increase in fluorescence in relation
to proximity, we hypothesized that such phenomena may also be driven by the fact that the G-rich strand may function as a fluorophore harvester. As the silver binding site and the G-rich stretches are in close proximity, it is likely that resonance energy transfer could take place resulting in an increase and shift of fluorescence [43].
188
S.Y. Lee et al. / Journal of Colloid and Interface Science 433 (2014) 183–188
Fig. 5. Fluorescence emission spectra for target sensitivity hybridization at 595 nm for 3 h hybridization. A series of diluting concentration of FOXP3 target and its detection using 10 lM of AgNC and G-rich.
4. Conclusion The ability of the DNA fluorescence shift sensor to produce a shift in excitation, emission and fluorescence intensity allows for a rapid and easy detection system for DNA with little background interference. The FOXP3 target sequence was successfully detected by the shift in excitation and emission wavelengths of the AgNC. By designing the AgNC and G-rich sequence to target areas between 2 exons as shown here, it is possible that an mRNA detection system can be made. The AgNC and G-rich strands used in this system would also allow for detection with higher specificity, making it a rapid and specific system. Taking into consideration the advantages, the DNA fluorescence shift sensor can be an appealing alternative for DNA hybridization assays. Acknowledgments TSL would like to acknowledge Malaysian Ministry of Education through the Higher Institution Centre of Excellence (HICoE) Grant (Grant No: 311/CIPPM/44001005). GJT would like to acknowledge the Universiti Sains Malaysia Short Term Grant (Grant No: 304/CIPPM/6313052). We would also like to acknowledge Dr. Shahram Y. Kordasti of King’s College London who critically reviewed the manuscript. References [1] K.A. Frazer, D.G. Ballinger, D.R. Cox, D.A. Hinds, L.L. Stuve, R.A. Gibbs, J.W. Belmont, A. Boudreau, P. Hardenbol, S.M. Leal, Nature 449 (2007) 851.
[2] X. Cheng, G. Chen, W.R. Rodriguez, Anal. Bioanal. Chem. 393 (2009) 487. [3] M.J. Marton, J.L. DeRisi, H.A. Bennett, V.R. Iyer, M.R. Meyer, C.J. Roberts, R. Stoughton, J. Burchard, D. Slade, H. Dai, Nat. Med. 4 (1998) 1293. [4] Z.S. Wu, J.H. Jiang, G.L. Shen, R.Q. Yu, Hum. Mutat. 28 (2007) 630. [5] G.-Y. Lan, W.-Y. Chen, H.-T. Chang, RSC Adv. 1 (2011) 802. [6] F. Lucarelli, S. Tombelli, M. Minunni, G. Marrazza, M. Mascini, Anal. Chim. Acta 609 (2008) 139. [7] Y. Zhang, Y. Wang, H. Wang, J.-H. Jiang, G.-L. Shen, R.-Q. Yu, J. Li, Anal. Chem. 81 (2009) 1982. [8] W. Vercoutere, M. Akeson, Curr. Opin. Chem. Biol. 6 (2002) 816. [9] B. Liu, G.C. Bazan, Chem. Mater. 16 (2004) 4467. [10] J.F. Hopkins, S.A. Woodson, Nucl. Acids Res. 33 (2005) 5763. [11] M. Gao, G. Lewis, G.M. Turner, A. Soubret, V. Ntziachristos, Appl. Opt. 44 (2005) 5468. [12] C.I. Richards, S. Choi, J.-C. Hsiang, Y. Antoku, T. Vosch, A. Bongiorno, Y.-L. Tzeng, R.M. Dickson, J. Am. Chem. Soc. 130 (2008) 5038. [13] Y. Ghasemi, P. Peymani, S. Afifi, Acta Bio-Med.: Atenei Parmensis 80 (2009) 156. [14] H. Xu, K.S. Suslick, Adv. Mater. 22 (2010) 1078. [15] B. Han, E. Wang, Anal. Bioanal. Chem. 402 (2012) 129. [16] T. Vosch, Y. Antoku, J.-C. Hsiang, C.I. Richards, J.I. Gonzalez, R.M. Dickson, Proc. Natl. Acad. Sci. 104 (2007) 12616. [17] J. Sharma, R.C. Rocha, M.L. Phipps, H.C. Yeh, K.A. Balatsky, D.M. Vu, A.P. Shreve, J.H. Werner, J.S. Martinez, Nanoscale 4 (2012) 4107. [18] Z. Yuan, Y.-C. Chen, H.-W. Li, H.-T. Chang, Chem. Commun. (2014). [19] J. Ai, W. Guo, B. Li, T. Li, D. Li, E. Wang, Talanta 88 (2012) 450. [20] L. Shang, S. Dong, J. Mater. Chem. 18 (2008) 4636. [21] J. Belloni, Catal. Today 113 (2006) 141. [22] Y. Hsin-Chih, J. Sharma, J.J. Han, J.S. Martinez, J.H. Werner, in: IEEE International Conference on Nano/Micro Engineered and Molecular Systems (NEMS), 2011, p. 267. [23] S.W. Yang, T. Vosch, Anal. Chem. 83 (2011) 6935. [24] S. Klein, C.C. Kretz, P.H. Krammer, A. Kuhn, J. Invest. Dermatol. 130 (2010) 492. [25] E. Billerbeck, W.T. Barry, K. Mu, M. Dorner, C.M. Rice, A. Ploss, Blood (2011). [26] S. Hori, T. Nomura, S. Sakaguchi, Science 299 (2003) 1057. [27] H.C. Yeh, J. Sharma, J.J. Han, J.S. Martinez, J.H. Werner, Nano Lett. 10 (2010) 3106. [28] H.C. Yeh, J. Sharma, M. Shih Ie, D.M. Vu, J.S. Martinez, J.H. Werner, J. Am. Chem. Soc. 134 (2012) 11550. [29] L. Moran, M.-E. Mirault, A. Tissières, J. Lis, P. Schedl, S. Artavanis-Tsakonas, W.J. Gehring, Cell 17 (1979) 1. [30] D. Reha, M. Kabelác, F. Ryjácek, J. Šponer, J.E. Šponer, M. Elstner, S. Suhai, P. Hobza, J. Am. Chem. Soc. 125 (2003) 5581. [31] A. Celedon, D. Wirtz, S. Sun, J. Phys. Chem. B 114 (2010) 16929. [32] D. Bikard, C. Loot, Z. Baharoglu, D. Mazel, Microbiol. Mol. Biol. Rev. 74 (2010) 570. [33] P. Vardevanyan, A. Antonyan, M. Parsadanyan, H. Davtyan, A. Karapetyan, Exp. Mol. Med. 35 (2003) 527. [34] A. Latorre, Á. Somoza, ChemBioChem 13 (2012) 951. [35] A. Latorre, R. Lorca, Á. Somoza, J. Chem. 2013 (2013) 1. [36] R.R. Ramazanov, A.I. Kononov, J. Phys. Chem. C 117 (2013) 18681. [37] J.T. Petty, B. Sengupta, S.P. Story, N.N. Degtyareva, Anal. Chem. 83 (2011) 5957. [38] G.-Y. Lan, W.-Y. Chen, H.-T. Chang, Biosensors Bioelectron. 26 (2011) 2431. [39] P. Shah, A. Rørvig-Lund, S.B. Chaabane, P.W. Thulstrup, H.G. Kjaergaard, E. Fron, J. Hofkens, S.W. Yang, T. Vosch, ACS Nano 6 (2012) 8803. [40] J. Li, X. Zhong, H. Zhang, X.C. Le, J.-J. Zhu, Anal. Chem. 84 (2012) 5170. [41] I. Diez, R.H.A. Ras, Nanoscale 3 (2011) 1963. [42] J.M. Obliosca, C. Liu, R.A. Batson, M.C. Babin, J.H. Werner, H.-C. Yeh, Biosensors 3 (2013) 185. [43] S. Tyagi, S.A.E. Marras, F.R. Kramer, Nat. Biotech. 18 (2000) 1191.
