Fluorescent silver nanoclusters stabilized by DNA scaffolds.

ChemComm View Article Online

FEATURE ARTICLE

Published on 05 June 2014. Downloaded by Université Laval on 14/07/2014 03:32:37.

Cite this: DOI: 10.1039/c4cc02981j

View Journal

Fluorescent silver nanoclusters stabilized by DNA scaffolds Zhiqin Yuan, Ying-Chieh Chen, Hung-Wen Li* and Huan-Tsung Chang*

Received 22nd April 2014, Accepted 28th May 2014 DOI: 10.1039/c4cc02981j

Fluorescent silver nanoclusters, in particular DNA stabilized (templated) silver nanoclusters, have attracted much attention because of their molecule-like optical properties, strong fluorescence and good biocompatibility. In this feature article, we summarize the DNA stabilized silver nanoclusters from the viewpoints of synthesis, optical properties, as well as recent applications in biological detection and

www.rsc.org/chemcomm

imaging.

1. Introduction Metal nanoclusters (NCs) are small atom assemblies (e.g., Au, Ag, Cu, and Pt) that are less than 2 nm in size and consist of several to hundreds of atoms.1–5 They bridge the gap between individual atoms and large nanocrystals and display moleculelike properties.6 Because the size of NCs is comparable to the Fermi wavelength of electrons, they show discrete electronic energy levels and unique optical and/or chemical properties different from their corresponding large nanocrystals (with sizes greater than 2 nm).7,8 Metal NCs exhibit strong light absorption through electronic transitions between moleculelike energy levels and usually result in the appearance of fluorescence. The properties of metal NCs generally depend on their sizes, structures, oxidation states and surface ligands.9 Compared with cadmium chalcogenide semiconducting quantum Department of Chemistry, National Taiwan University, 1, Section 4, Roosevelt Road, Taipei, 10617, Taiwan. E-mail: [email protected]; Fax: +886-2-3366-1171; Tel: +886-2-3366-1171

dots (QDs) and transition-metal-ions-doped QDs, metal NCs show better biocompatibility.10 On account of their unique optical and/ or chemical properties, metal NCs have extensive applications, such as chemo/bio-sensing, drug/DNA release and catalysis.11–16 Silver nanoclusters (Ag NCs) display bright fluorescence in solution and have gained wide research interest in the past decade.17–21 A key challenge in Ag NCs synthesis/characterization lies in the fact that Ag NCs are usually sensitive to ambient conditions, and can be oxidized in the presence of oxygen, due to their low oxidation potential (less than 0.4 eV).22 Although the oxidation largely influences the fluorescence of Ag NCs, the oxidized Ag still exists on the surface of Ag NCs, mainly due to the strong interactions of Ag+ with Ag NCs and DNA.23,24 In addition, the tendency to aggregate limits the applications of Ag NCs. Therefore, synthesis of stable, water-soluble, and monodispersed Ag NCs is essential to take Ag NCs research to the next level. Towards this goal, considerable efforts have been dedicated to the synthesis of water-soluble Ag NCs using thiolate- or polyelectrolyte-based scaffolds. For instance, seven-atom Ag NCs

Zhiqin Yuan is currently a postdoctoral fellow in the Department of Chemistry, National Taiwan University. He obtained his PhD from College of Chemistry and Chemical Engineering, Hunan University, in 2013 with Dr Yan He and Dr Edward S. Yeung. His research interests are focused on synthesis, formation mechanism investigation, and analytical application of metal nanoclusters. Zhiqin Yuan

This journal is © The Royal Society of Chemistry 2014

Ying-Chieh Chen received his BS degree from the Department of Chemistry, National Taiwan University in 2013. He is currently a MS student at the Department of Chemistry, National Taiwan University, under the supervision of Professor Huan-Tsung Chang. He is interested in the preparation and application of DNA stabilized silver nanoclusters. Ying-Chieh Chen

Chem. Commun.

View Article Online


Feature Article

ChemComm

were prepared using mercaptosuccinic acid or 2,3-dimercaptosuccinic acid as a stabilizing ligand.25,26 Red-emitting Ag NCs were synthesized using poly(methacrylic acid) as a template under UV irradiation.27 Using hyperbranched polyethyleneimines as scaffolds, highly stable Ag NCs over pH, salt, thiols and temperature ranges were synthesized under mild conditions.28 Despite the successful synthesis of fluorescent Ag NCs, these methods are usually limited to preparation of Ag NCs with small quantum yields (QYs) and/or limited waterdispersibility. In addition, it is difficult to tune the fluorescence properties (QY and emission wavelength) effectively by simply varying the species and concentration of the ligands. The optical properties of Ag NCs vary not only with their stoichiometry, charge and geometry, but also with their interactions with ligands,19 offering the potential for the creation of Ag NCs with various emission wavelengths by varying the encapsulation scaffolds. In other words, choosing appropriate scaffold structures different in size, conformation and/or functional group has been shown to lead to Ag NCs with tunable emission. Oligonucleotides show great potential in nanotechnology because of their small sizes and their ability to assemble into distinct nanostructures.29 The specificity of Watson–Crick base pairing allows the self-assembly of DNA into different nanostructures in two and three dimensions. Strong interactions of metal cations with bases as well as phosphate groups of DNA allow the design and fabrication of various DNA-based nanostructures and nanosensors. For example, mercury ions (Hg2+) have strong affinity to thymine (T) base; T–Hg2+–T coordination with a high binding constant allows the assembly of singlestranded DNA (ssDNA) into a double-stranded (dsDNA) or DNA hairpin structure.30 In contrast to Hg2+, Ag+ possess a preferred high affinity to cytosine base (C) over adenine (A), guanine (G) and T bases,31 with a binding constant of the C–Ag+–C base pair comparable to that of the T–Hg2+–T base pair. These observed strong binding affinities between the metal cations and nucleotide base or phosphate groups have been used in synthesizing DNA functionalized metallic nanomaterials.32,33 In consideration of the versatility of DNAs and their strong nucleosidecentered Ag+ binding characteristics, DNA scaffolds promise the preparation of highly fluorescent Ag NCs. After chemical

reduction of DNA–Ag+ complexes with sodium borohydride (NaBH4), emission-tunable DNA–Ag NCs are produced with high QYs.34 Synthesis as well as optical properties of DNA–Ag NCs are affected by the sequences or secondary structures of DNA scaffolds that show different binding affinities to Ag NCs.11,35,36 Although the fluorescence mechanism has not been completely understood, they have been used to prepare optical probes for various target analytes including ions, biothiols, small molecules, and biomacromolecules (e.g., DNAs, RNAs, proteins), even tumor cells, which can alter the binding affinity between Ag NCs and DNA.19,20 In this feature article, we summarize the DNA–Ag NCs from the viewpoints of synthesis, optical properties, as well as recent applications in biological detection and imaging.

2. Synthesis of DNA–Ag NCs The strong interaction between DNA and Ag+ was evident in gel electrophoresis.37 Binding of Ag+ to DNA induces a conformational change in DNA and causes a mobility decrease during the electrophoresis processes. Silver ions show strong affinity to DNA scaffolds by binding to their heterocyclic bases rather than to the phosphate or sugar groups. Ono et al. reported that the existence of one C–Ag+–C base pair in duplex DNA increases the melting temperature of 8 1C, consistent with the high stability of the C–Ag+–C base pair.31 In addition, density functional theory (DFT) calculations showed that binding of Ag+ to N3 of C has the lowest binding energy over other DNA bases,38 again supporting the strong interaction between Ag+ and C base. Because of the strong binding affinity between Ag+ and C, C-rich DNAs with inside C–C mismatching pairs have been developed as molecular Ag+ sensors,39–41 and to design some special DNA structures.42 Therefore, strong binding affinity to Ag+, as well as the flexibility and variety make it possible to create Ag NCs with DNA scaffolds. Typically, a solution mixture of DNA and Ag+ is firstly incubated for appropriate time at low temperature to form DNA–Ag+ complexes, followed by the reduction of NaBH4, as shown in Fig. 1.34 The synthesis of Ag

Hung-Wen Li is currently an Associate Professor of the Department of Chemistry, National Taiwan University. He received his PhD from the Department of Chemistry, University of California, Berkeley, in 2000 with Dr Herbert L. Strauss. His major interest is in understanding important biological processes at the singlemolecule level. Hung-Wen Li

Chem. Commun.

Huan-Tsung Chang is currently a Distinguished Professor of the Department of Chemistry, National Taiwan University. He is a fellow of the Royal Society of Chemistry. He obtained his PhD from the Department of Chemistry, Iowa State University, in 1994 with Dr Edward S. Yeung. His current research interests include nanotechnology, green chemistry, biosensors, and mass spectrometry. Huan-Tsung Chang


View Article Online

ChemComm

Feature Article


Fig. 1 Schematic diagram of the preparation of DNA–Ag NCs. Reprinted from ref. 34 with the permission from the American Chemical Society.

NCs with DNA scaffolds is relatively simple, without the formation of large nanoparticles. 2.1

ssDNA scaffolds

Dickson et al. synthesized DNA–Ag NCs from Ag+ using a 12-base scaffold of 5 0 -AGGTCGCCGCCC-3 0 in 2004.34 They found that Ag+ preferentially favors association with the heterocyclic bases over the phosphate groups. In addition, NMR spectra showed that C base experiences the largest chemical shifts upon interacting with Ag NCs. The stoichiometry of Ag per DNA strand varies from one to four, leading to different electronic transitions observed in the fluorescence spectra. Using oligonucleotide C12 as a template, DNA–Ag NCs displaying various fluorescence and absorption spectra were synthesized.43 Mass spectra showed that the oligonucleotide forms multiple species with 2–7 Ag atoms. Using a DNA template, bright DNA–Ag NCs in phosphate buffer solution with nearinfrared (NIR) emission were synthesized.44 By choosing DNA templates with various sequences, five types of fluorescent DNA–Ag NCs were synthesized with maximum emission wavelengths ranging from 485 to 705 nm.45 To investigate how DNA sequence and length affect the fluorescent properties of DNA–Ag NCs, five Ag NCs were synthesized through the NaBH4-mediated reduction of Ag+ in the presence of various DNA scaffolds as shown in Fig. 2.46 Mass spectrometry of DNA–Ag NCs showed that 2–6 Ag atoms were present in these DNA scaffolds, revealing that the sequence and length of DNA scaffolds could play an important role in determining the size of Ag NCs. Fluorescence intensity and wavelengths of the prepared DNA–Ag NCs are different. In addition to the size, the DNA conformation and the oxidation state of Ag NCs accounted for the difference. It is generally accepted that the affinity between Ag+ and DNA bases is related to the conformation of DNA scaffolds. Therefore, the secondary structure of DNA scaffolds would show a significant effect on the structure and optical properties of DNA–Ag NCs. Several different secondary structures (such as hairpin, i-motif and G-quadruplex) of ssDNAs have been used to synthesize DNA–Ag NCs. Gwinn et al. found that DNA–Ag NCs can be prepared using C-loop containing hairpin DNA scaffolds.47 DNA–Ag NCs possessing both the C-loop and the G-loop showed bright fluorescence, while those having the A-loop and the T-loop exhibited weak or no emission under


Fig. 2 Fluorescence emission spectra of the five distinct DNA–Ag NCs, and the corresponding DNA sequences used in this study are listed as follows (TAr: 5 0 -CCC(TTCC)nTT(CCAA)nCCC-3 0 , n = 1, 2, 5, 6; AAr1: 5 0 -CCCAACCTTCCAACCC-3 0 ). Inset image shows the corresponding images of these DNA–Ag NCs (from 1–5: TAr1–Ag NCs, AAr1–Ag NCs, TAr2–Ag NCs, TAr5–Ag NCs, and TAr6–Ag NCs). Reprinted from ref. 46 with the permission from the Royal Society of Chemistry.

excitation at visible wavelengths. They further introduced a C-loop structure into a self-assembled DNA nanotube to yield fluorescent Ag NCs.48 The resultant Ag NCs on hairpins protruding from the DNA nanotube showed nearly identical fluorescence spectra. In addition to the loop sequence and length, the stem sequence also affects the synthesis of Ag NCs. Using a hairpin DNA structure, stem-directed growth of Ag NCs with high brightness was demonstrated.49 The i-motif is a special form of C-rich DNA, which is formed through the intercalated C–C+ base pairs and is one of the known nucleic acid structures involving systematic base intercalation.50 Petty et al. successfully synthesized Ag NCs with i-motif DNA.51 Two i-motif-forming oligonucleotide (TA2C4)4 and (C4A2)3C4 stabilized Ag NCs show red and green emissions, which are favored in slightly acidic and basic solutions, respectively. By using inter/intramolecular i-motif DNA, Li et al. successfully prepared fluorescent DNA–Ag NCs with an emission wavelength range over green to NIR.52 Another example of specific ssDNA structures is the G-quadruplex, which is a higher-ordered DNA conformation based on the Hoogsteen hydrogen bonding among four guanine bases with a nearly square planar structure.53 Using a specific G-quadruplex DNA sequence (AS1411), Wang et al. synthesized dual-emissive DNA–Ag NCs, demonstrating that AS1411 retains its G-quadruplex structure in the complex of Ag NCs.54 Owing to the great stability of the intermolecular G-quadruplex structure, red-emissive DNA–Ag NCs show high thermo-stability.52 2.2

dsDNA scaffolds

Duplex DNA relative to ssDNA has a more rigid structure and well-defined conformation, offering the possibility to design specific binding sites of Ag NCs. However, the fully complementary dsDNA can’t provide enough space to accommodate the binding of Ag NCs. Defects in dsDNA are required to form

Chem. Commun.

View Article Online


Feature Article

dsDNA–Ag NCs; DNA scaffolds with C–C mismatches are particularly interesting due to stable C–Ag+–C coordination. Using an inner C6-loop-containing dsDNA scaffold, Wang et al. successfully synthesized Ag NCs.55 Through the formation of a duplex DNA structure with a DNA having the sickle-cell anemia gene sequence, the upstanding C6-loop provided a binding site for the generation of yellow-emissive Ag NCs. Using specific terminal sequences, Ag NCs functionalized DNA nanowires or hydrogels with better thermo-stability were constructed.56,57 Base mismatch is one of the common defects among DNA damage, with disease implication. Base mismatch on dsDNA scaffolds can provide the binding site for Ag+, which facilitates the creation of Ag NCs using dsDNA scaffolds. Through the introduction of a single mismatched base pair at the G–C position, Qu et al. synthesized fluorescent Ag NCs with dsDNA.58 The fluorescence intensity of Ag NCs decreases upon interaction with mismatched DNA. A more apparent fluorescence decrease occurs when the DNA strand contains T or A at the mismatch position, in comparison to a smaller decrease for a G or C mismatch. Another common DNA defect is the abasic (AP, apurinic/ apyrimidinic) site, which can occur spontaneously at a substantial rate by DNA glycosylases during the removal of damaged or incorrect bases from DNA.59 The presence of AP sites is correlated with cellular viability and genomic integrity because it leads to mutations in DNA replication. Using dsDNA containing an AP site as a scaffold, fluorescent Ag NCs were successfully synthesized.60 The study suggested that the size of produced Ag NCs is not affected by increasing the Ag+ concentration, and the emission is strongly dependent on the basestacking direction of DNA scaffolds.61 2.3

DNA origami

DNA origami has specific two- and three-dimensional shapes through nanoscale folding of DNA.62 The advance of DNA origami technology allows the design and construction of nanometer-sized DNA structures. With accurate cavities or gaps, this special DNA nanostructure promises the synthesis of nanomaterials with narrow size distribution and controllable site specificity. With a careful design, site-specific synthesis and in situ immobilization of Ag NCs on a triangular DNA origami scaffold by the Tollens reaction was achieved as shown in Fig. 3.63 By linking the sugar motif into DNA, this approach does not require the conventional-used reductant (NaBH4) that can reduce disulfide bonds and potentially affect the function

Fig. 3 Schematic representation of the site-specific immobilization of fluorescent Ag NCs on a triangular DNA origami scaffold. Reprinted from ref. 63 with the permission from the Wiley-VCH.

Chem. Commun.

ChemComm

of proteins. The as-prepared Ag NCs have bright blue emission, excellent photostability and narrow size distribution. 2.4

Template conversion

In addition to direct synthesis, DNA–Ag NCs can also be prepared through template conversion, as reported by Dickson et al.64 The weakly fluorescent Ag NCs were first prepared using polyacrylic acid (PA) as a template. Upon addition of ssDNA, the prepared Ag NCs rapidly transferred from PA to DNA binding, leading to enhanced fluorescence intensity as a result of the formation of DNA–Ag NCs. Solution pH, buffer conditions and temperature affected the transfer efficiency.

3. Optical properties As the size reduced close to the Fermi wavelength of an electron, DNA–Ag NCs behave as ‘‘artificial atoms’’ and show discrete energy levels, usually accompanied by fluorescence emission. Like some conventional fluorophores (e.g., organic dyes),65 DNA–Ag NCs demonstrate outstanding optical properties including a wide emission range and large Stokes shift. With the rapid development of synthetic strategies, DNA–Ag NCs have fascinated the scientific community, evident by numerous studies in the literature.11,20,35,36,66–68 However, detailed photophysical mechanisms of DNA–Ag NCs are unclear. Fundamental understanding of the photophysical properties of DNA–Ag NCs shall be useful for the preparation of even higher quality of Ag NCs and for future applications. 3.1

Fluorescence origination

There are many different models regarding the nature of emission of the DNA–Ag NCs, but all existing models have some limitations. The fluorescence origination of DNA–Ag NCs is usually considered through intraband (sp–sp) electron transition in Ag NCs (visible excitation) and charge transfer between DNA base and Ag NCs (UV excitation). Because of the short fluorescence lifetime of most DNA–Ag NCs, the emitting states of DNA–Ag NCs were suggested to be singlet instead of triplet. However, comprehensive models to explain the fluorescence origination are still needed, mainly due to the complexity of DNA–Ag NC systems. Based on free-electron model calculation, Zheng et al. suggested that the fluorescence of few-atom Au NCs arises from intraband (sp–sp) band rather than interband (sp–d) band transitions.9 The energy level spacing of sp bands becomes smaller and smaller with the increase of gold atom numbers, which is consistent with the observed emission wavelengths of Au NCs undergoing red shifts upon increasing gold atom numbers.1 This size-dependent emission wavelength trend is also observed in DNA–Ag NCs, suggesting that the fluorescence of DNA–Ag NCs may as well originate from sp–sp band electron transition.45 However, observation that DNA–Ag NCs with the same Ag atom numbers can also emit fluorescence with different wavelengths (from blue to NIR) seems to suggest that additional emission mechanisms exist.19 In addition, most of the DNA–Ag NCs can be excited with UV light


View Article Online


ChemComm

(260–270 nm), regardless of the location of their visible or NIR excitation peaks.69 These observations imply that the fluorescence origination of DNA–Ag NCs could not be attributed to the sp–sp band electron transition alone. To understand the fluorescence origination of DNA–Ag NCs, the binding energy of the neutral Ag NC complex with four different DNA bases and the absorption spectra of Ag NCs–base complexes were studied by DFT methods.70 The DFT calculations indicate that the strongest binding occurs between Ag NCs and the C base at the N3 position. The calculations also show that the energies of some Ag NCs–base complexes are lower than those of isolated Ag NCs or bases. Meanwhile, a rather large charge transfer is found from the Ag atom to the cytosine bases in C–Ag–C complexes. These DFT findings suggest that the oligocytosine scaffold is involved in the fluorescent process of Ag NCs. Wang et al. also calculated the interaction between normal and modified DNA bases and Ag NCs.71 Four kinds of DNA monomers (dA, dT, dG, and dC) were used as scaffolds to prepare Ag NCs with a major species of nine Ag atoms (Ag9 NCs). Only dC-protected Ag9 NCs show a strong red emission at 591 nm upon exciting at 519 nm, consistent with the time-dependent DFT prediction of emission at 590 nm, as shown in Fig. 4. These results suggest that C base is involved in the modulation of the fluorescence property of DNA–Ag NCs. Gwinn et al. recently characterized the charge and geometry of DNA scaffold stabilized Ag15 NCs, through the combination of mass spectroscopy, polarized light microscopy and DFT calculations.72 The rod-shaped geometry of DNA–Ag15 NCs consisting of roughly equal neutral Ag atoms and Ag+ was suggested. They also expected that various DNA scaffold stabilized similar rod-shaped DNA–Ag NCs could produce similar

Feature Article

fluorescence, and the DNA strand/base induced fluorescence variation is related to the differential rod lengths of Ag NCs. In addition to the DFT calculations, extended X-ray absorption fine structure analysis was performed by Neidig et al. to gain a better understanding of the molecular-level structural basis of emission.73 Their study presented the direct structural evidence of Ag–Ag and Ag–DNA bonds. They also demonstrated that the silver atom number, and Ag–Ag and Ag–DNA bonding likely act in a coupled manner to modulate the fluorescence properties of DNA–Ag NCs. 3.2

Fluorescence modulation

The fluorescence properties of DNA–Ag NCs can be modulated by changing the sequence, length, and secondary structure of DNA scaffolds, as well as environmental parameters (such as temperature, pH and ionic strength, etc.). Therefore, these parameters have to be considered carefully when DNA–Ag NCs are applied for biological analysis. Our previous study systematically investigated how the DNA sequence and length affect the fluorescence of DNA–Ag NCs among twelve different DNA scaffolds.46 The presence of the cytosine 3-mers (CCC) at the 5 0 and 3 0 ends of DNA scaffolds helps to stabilize the DNA–Ag NCs, while three inside C–C pairs and two T–A base pairs within the scaffold destabilize the formation of terminal C–Ag–C bonding. In addition, the increasing DNA length leads to the red-shift of maximum emission wavelengths of DNA–Ag NCs, likely due to the increasing Ag atom numbers.46,47 Martinez et al. showed that longer DNA scaffolds tend to increase the brightness and improve the fluorescence stability of DNA–Ag NCs,74 with similar results observed in C-loop DNA stabilized Ag NCs.75 When varying the C base numbers from 3 to 12 in the hairpin loop, Gwinn et al. found that Ag NCs could form in all

Fig. 4 Optimal ground-state (A) and excited-state (B) geometries of the dC–Ag9 complex, only a benzoyl-protected cytosine base in proximity to the Ag9 cluster is shown. (C) Molecular orbitals and electronic contributions of the relevant excited states, and (D) fluorescence spectra (black: experiment; gray: simulation) of the dC–Ag9 complex. Reprinted from ref. 71 with the permission from the Wiley-VCH.


Chem. Commun.

View Article Online


Feature Article

C-loops except the shortest-sized C-loop.47 The fluorescence intensity of the resulted DNA–Ag NCs increased and reached a maximum when there are 7 cytosine bases in the loop, with no additional enhancement after that. In addition to the length, the flanking bases nearby the Ag NCs binding site in DNA scaffolds also contribute to the fluorescence properties of DNA–Ag NCs. For example, Shao et al. found that the Ag NCs have brighter fluorescence if bases at both flanking ends of the AP site are G.60 No visible emission of DNA–Ag NCs could be observed if one or two of the flanking ends are not G bases. Secondary structures of DNA scaffolds also play an important role since the binding affinities between Ag NCs and DNA templates greatly depend on the secondary structures, with the observed binding affinity in the decreasing order of: coiled C-rich ssDNA 4 i-motif 4 DNA duplex 4 G quadruplex.52 The secondary structure of DNA not only affects the stability but also the emission wavelength of DNA–Ag NCs. For example, the i-motif DNA scaffold generates green-emissive DNA–Ag NCs, while C-rich ssDNA produces red-emissive DNA–Ag NCs. Compared with the DNA duplex and G-quadruplex-stabilized Ag NCs, C-rich ssDNA or i-motif-stabilized Ag NCs show higher thermo-stability and longer shelf-life. The synthetic conditions also affect the property of DNA–Ag NCs. For example, using C12 as the same scaffold, both green and red emissive Ag NCs were prepared under different reaction conditions.43,44,66 The changes in the molar ratio of Ag+ to DNA, reactant concentration, reaction pH, or buffer all lead to

Table 1

ChemComm

the variation of fluorescence properties. For instance, greenemissive T12–Ag NCs were prepared only at pH 11.0.76 The oxidation level of Ag NCs can also modulate the fluorescence properties. Petty et al. found that freshly prepared C12–Ag NCs show three emission bands at 490, 520, and 665 nm, respectively.43 With the addition of six more equivalents of NaBH4, the blue and green emissions were completely quenched, while the red emission was greatly enhanced. This suggests the blue and green emission properties relate to the surface oxidation states of Ag NCs.43 Consistent with this, T12–Ag NCs show intense green emission only in the presence of oxygen.76 The oxidation-induced fluorescence change was also observed by Liu et al.77 UV radiation-induced fluorescence quenching was found to be mainly due to the photon-assisted surface oxidation with the correlation of the oxygen level. This bleaching can be recovered by adding NaBH4. The detailed molecular mechanisms of the red-emissive and green-emissive DNA–Ag NCs remain to be explored. Encapsulated within DNA, Ag NCs show high QYs and strong fluorescence. The maximum emission wavelengths can be tuned from the visible to NIR regions by simply varying the sequence and length of the DNA scaffolds, as shown in Table 1. Notwithstanding the lack of the general rule to guide the accurate synthesis of DNA–Ag NCs, some trends in the fluorescence properties of synthesized DNA–Ag NCs have emerged. First, C-rich DNA scaffolds facilitate the synthesis of DNA–Ag NCs because of the high affinity between cytosine bases and Ag+. Second, with the longer DNA length, the resulting DNA–Ag

Effects of DNA templates on the fluorescence properties of DNA–Ag NCs

DNA sequence (5 0 to 3 0 )

Length (nt)

Ag atom number

lex/lem (nm)

QY (%)

Lifetime (ns)

Ref.

CCCATATTCCCC ATATCCCCCCCCATAT CGCGCCCCCCCCCCCCCGCG TGACTAAAAACCCTTAATCCCC CGAACGCGCCCCCCCCCCCCCGAACGCG AGTCACCCCAACCTGCCCTACCACGGACT GGCAGGTTGGGGTGACTAAAAACCCTTAATCCCC AGTCCGTGGTAGGGCAGGTTGGGGTGACTAAAAACCCTTAATCCCC CCTCCTTCCTCCCTACGTGCT AGGTCGCCGCCC CCCCCCCCCCCC CCC(TTCC)2TT(CCAA)2CCC CCC(TTCC)5TT(CCAA)5CCC ATAGGCAGGGGGTATCCGT ACGGATAGGGGGTATCCGT TATCCGTCCCCCACGGATA TATCCGTCCCCCATAGGCA CCC(TTCC)6TT(CCAA)6CCC CCCACCCACCCTCCCA TGCCTTTTGGGGACGGATA CCCACCCACCCTCCCA CCCACCCACCCGCCCA CCCACCCACCCACCCG TATCCGTCCCCCCCCCACGGATA TTCCCACCCACCCCGGCCCGTT CACCGCTTTTGCCTTTTGGGGACGGATA GGCAGGTTGGGGTGACTAAAAACCCTTAATCCCC TTCCCCACCACCCAGGCCCCGTT

12 16 20 22 28 29 34 46 21 12 12 24 48 19 19 19 19 56 16 19 16 16 16 23 22 28 34 23

— — — — — — — — 1 1–4 2–3 4 5 o6 o6 o6 o6 6 10 10 10 10 or 11 12 13 14 15 15 16

590/660 570/635 560/615 460/550 560/618 530/600 595/650 640/700 510/585 560/638 650/700 540/608 540/620 509/573 545/615 582/646 572/648 540/644 750/810 486/566 750/810 712/774 860/918 560/620 571/635 599/670 601/677 529/645

18 26 42 2 16 10 64 52 34 — 17 61 25 — — — — 25 30 44 30 30 6 — 94 75 41 37

3.0 2.3 2.5 0.6/2.5 3.5 0.8/2.9 1.3/3.5 3.6 — — 2.6 2.7 2.6 — — — — 3.1 1.8 — 3 2.2 1.4 — — — — —

45 78 78 74 78 74 74 74 79 34 44 46 46 47 47 47 47 46 80 72 35 81 81 75 72 72 72 72

—: Unavailable.

Chem. Commun.


View Article Online

ChemComm

NCs show increasing QYs and stability. Third, the atom numbers of Ag NCs associated with DNA scaffolds affect the florescence of DNA–Ag NCs, and this effect becomes more apparent when the Ag atom number is less than six. These empirical trends provide general guidelines in the synthesis of new DNA–Ag NCs.


3.3

Two-photon absorption

Two-photon absorption (TPA) is a photophysical event where two photons are simultaneously absorbed by the same molecule.82,83 In comparison with conventional one-photon absorption (OPA), TPA accesses a given excited state using photons of half the energy, thus NIR light can be used as the excitation source, offering images of low background and high signal-tonoise (S/N) ratios. In view of these characteristics over OPA, TPA has been applied in many imaging applications.84–96 However, most TPA imaging systems require dyes with both high water solubility and high TPA cross-sections, which most existing commercial dyes do not meet. Ag NCs offer great potential for TPA applications. Dickson et al. found that the TPA crosssections of 660 and 680 nm emissive (maximum emission wavelength) DNA–Ag NCs are 35 000 and 34 000 GoeppertMayer (GM), respectively, when excited at 800 nm.97 They also indicated that the 615 and 710 nm emissive DNA–Ag NCs show high TPA cross-sections of 50 000 GM, which are comparable to those of water-soluble quantum dots (66 000 GM).98 In addition to high TPA cross-section, DNA–Ag NCs also exhibit high photostability when compared with commercial organic dyes, promising for long time intracellular dynamics observation.78 Large TPA cross-sections and high photostability make DNA–Ag NCs good candidates for cell imaging or other nonlinear optical investigations.

4. Applications In the past ten years, we have witnessed great developments in DNA-based techniques for the sensitive and selective detection of various analytes.99–102 In particular, fluorescence-based techniques received growing attention due to their high sensitivity.103,104 DNA–Ag NCs have emerged as new materials for the detection of various analytes, based on the analyte induced fluorescence changes. Through the specific interactions of DNA templates with analytes, their conformation changed, leading to changes in the fluorescence of DNA–Ag NCs. The change in fluorescence intensity is usually proportional to the concentration of analytes, allowing sensitive quantitation of the analytes. 4.1

Detection of inorganic ions

Heavy-metal ions, particularly Hg2+ and copper (Cu2+), cause threat to human health and the environment. For example, Hg2+ has strong binding affinity to DNA and can induce damage to brain and the nervous system.105 DNA–Ag NCs were used to detect Hg2+ that induced the efficient quenching of Ag NC’s fluorescence through its strong 5d10–4d10 interaction with Ag+.23 The presence of Hg2+ weakened the interaction between


Feature Article

the Ag NC and DNA template, resulting in the fluorescence quenching. Wang et al. demonstrated the detection of Hg2+ using C12–Ag NCs, with a limit of detection (LOD) of 5 nM and linearity from 5 nM to 1.5 mM.106 The fluorescence of C12–Ag NCs was quenched upon addition of Hg2+. A sensitive and selective probe for Hg2+ using 5 0 -CCCTTCCTTCCTTCCAACCAACCC-3 0 (DNATAr2) stabilized Ag NCs (DNATAr2–Ag NCs) was demonstrated.46 The DNATAr2–Ag NCs exhibited a QY of 61% at 607 nm and provide a LOD of 0.9 nM for Hg2+. The fluorescence quenching ratio ((IF0 IF)/IF0) showed a good linear correlation with Hg2+ concentration in the range of 2.5 to 50 nM. Oligonucleotide stabilized fluorescent Ag NCs have also been utilized for selective Hg2+ detection.107 Recently, ratiometric and visual Hg2+ detection was demonstrated by Liu et al. using dualemissive DNA–Ag NCs. This approach achieved a LOD of 4 nM for Hg2+.108 The unchanged lifetime and valence state of DNA–Ag NCs, as well as a linear Stern–Volmer plot suggested a static quenching mechanism for the fluorescence decrease.106,109 The quenching mechanism was further supported by the restoration of 80% of its original fluorescence intensity after adding 10 mM ethylenediaminetetraacetic acid (EDTA).109 Despite Cu2+ being an essential transition metal element for human health and serving as a critical cofactor for many enzymes,110,111 excess Cu2+ is toxic because it may promote the generation of reactive oxygen species.112 Gastrointestinal disturbance, as well as liver or kidney damage, even Alzheimer’s, Parkinson’s and amyotrophic lateral sclerosis diseases have been implicated from the high concentration of Cu2+.113–115 A turn-on strategy using DNA–Ag NCs was developed for the detection of Cu2+.68 The addition of Cu2+ to DNA–Ag NCs caused significant fluorescence enhancement (Fig. 5A), accompanied by slight changes in both absorption wavelength and absorbance. The circular dichroism (CD) spectra showed a more negative ellipticity after the introduction of Cu2+, revealing the formation of a more rigid DNA structure and better protection of Ag NCs from environmental quenching. This probe possessed high sensitivity (LOD 8 nM) and selectivity (at least 350-fold over other metal ions). We also developed an indirect method to detect Cu2+ using DNA–Cu/Ag NCs and 3-mercaptopropionic acid (MPA) as shown in Fig. 5B, with a LOD of 2.7 nM.116 MPA weakens the association of DNA with Cu/Ag NCs, leading to fluorescence quenching. Addition of Cu2+ accelerates the oxidation of MPA to form a disulfide compound and results in the fluorescence recovery of DNA–Cu/Ag NCs. The fluorescence intensity increases upon increasing the Cu2+ concentration from 5 to 200 nM. This probe has a selective response to Cu2+ in the presence of high concentrations of other metal ions (Zn2+, Cd2+, Pb2+, Mg2+, Mn2+, Sr2+, Hg2+, Ni2+, Co2+, Ca2+, Ag+, Fe3+, Al3+, and Cr3+; each 50 mM). None of these metal ions can cause a conspicuous fluorescence enhancement as Cu2+ (0.5 mM) does. Using a turn-off strategy, Ye et al. detected Cu2+ with high sensitivity (LOD 10 nM), however, the quenching mechanism is not very clear yet.117 The sulfide anion (S2) is well known to be an environmental pollutant but also an important gaseous signal transmitter, making the sensitive and selective detection of S2 important.118–120 Use of 12-base oligonucleotides (50 -CCCTTAATCCCC-30 ) as scaffolds, red

Chem. Commun.

View Article Online


Feature Article

ChemComm

Fig. 5 Fluorescence emission spectra (A) of (a) DNA–Ag NCs and (b) DNA–Cu/Ag NCs. Inset: plot of time evolution of the formation of the (a) DNA–Ag NCs and (b) DNA–Cu/Ag NCs within the reaction time course of 0–2 h. Reprinted from ref. 68 with the permission from the Royal Society of Chemistry. Relative fluorescence emission spectra (B) of DNA–Cu/Ag NCs in the (a) absence of MPA and Cu2+, (b) presence of 2.5 mM MPA, and (c) presence of 2.5 mM MPA and 150 nM Cu2+. Reprinted from ref. 116 with the permission from the American Chemical Society.

emissive DNA–Au/Ag NCs were readily prepared in a citrate buffered system at pH 5.0. Unlike DNA–Ag NCs, the DNA–Au/Ag NCs emit at 630 nm when excited at 460 nm. When S2 solution was added to the DNA–Au/Ag NCs solution, the fluorescence of the DNA–Au/Ag NCs was quenched significantly due to the formation of Au2S and Ag2S.67 The addition of S2O82 is essential to minimize the interference from I. The LOD towards S2 ions with this method was calculated to be 0.83 nM, which is much lower than Au NCs based nanosensors.121 Relative to DNA–Ag NCs, the DNA–Au/ Ag NCs having a better stability against salts were applied for the detection of S2 in hot spring and seawater samples. 4.2

Detection of small organic molecules

Biothiols, including glutathione (GSH), cysteine (Cys) and homocysteine (Hcy), play important roles in biological systems.122 Abnormal alteration levels of these biothiols may indicate some features of pathological conditions, such as diabetes, Alzheimer’s and Parkinson’s diseases.123–125 Since the thiol group has strong affinity to Ag, many thiols have been exploited for the synthesis of Ag NCs. However, the thiol group can also lead to the destabilization of Ag NCs and result in the fluorescence quenching.126,127

Wang et al. found that the fluorescence of DNA–Ag NCs was strongly quenched upon addition of biothiols (e.g., Cys, GSH, and Hcy) through the formation of a coordination complex between biothiols and DNA–Ag NCs.128 The method is selective for the analytes in the presence of 19 different kinds of a-amino acids at 10-fold higher concentrations, allowing detection of the biothiols in human plasma samples. Qu et al. found that the fluorescence intensity variation of DNA–Ag NCs caused by biothiols was largely related to the length and sequence of DNA templates.129 Using different DNA templates, various fluorescence intensity responses to biothiols were observed. Adenosine-5 0 triphosphate (ATP) is an important biomarker for the determination of cell viability and cell metabolic activity. DNA–Ag NCs using an oligonucleotide (5 0 -TAACCCCTAACCCCT-3 0 ) as a template were used for sensing ATP.130 The DNA– Ag NCs possess interesting fluorescence properties as shown in Fig. 6; the intensity and emission wavelength are dependent on the pH value and ATP concentration. At pH 3.0 and 11.0, ATP shows greater effects on the fluorescence of DNA–Ag NCs. The emission wavelength at pH 3.0 shifts from 525 to 585 nm upon increasing ATP concentration from 10 to 50 mM. On the other

Fig. 6 Schematic representation of fluorescence properties of the DNA–Ag NCs at pH values of 3.0, 7.0, and 11.0 without (w/o) and with (w) ATP. Excitation wavelength is at 445 nm, and emission wavelengths at pH 7.0 and 11.0 are both at 510 nm. Emission wavelengths at pH 3.0 in the absence and presence of ATP are at 525 and 585 nm, respectively. Reprinted from ref. 130 with the permission from the Elsevier.

Chem. Commun.


View Article Online


ChemComm

Fig. 7 Schematic representation of the sensing procedure for analysis of cocaine based on aptamer functionalized Ag NCs. Reprinted from ref. 132 with the permission from the Elsevier.

hand, at pH 11.0 the fluorescence intensity (510 nm) increases upon increasing ATP concentration. The DNA–Ag NCs allowed detection of ATP over a concentration range of 0.1–10 mM, with a LOD of 33 nM. The DNA–Ag NCs were further validated with the determination of ATP concentrations in the lysate of MDA-MB-231 breast carcinoma cells. Alternatively, DNA–Ag NCs were prepared for turn-on detection of ATP, based on the formation of a hairpin conformation when the DNA (aptamer) interacted with two ATP molecules.131 The DNA template consists of a sequence for Ag NCs nucleation, an aptamer sequence, and a G-rich tail. The as-prepared DNA–Ag NCs have weak fluorescence. Addition of ATP leads to the formation of a hairpin DNA structure and promotes the proximity of the G-rich tail and Ag NCs, resulting in the fluorescence enhancement. Dong et al. synthesized DNA–Ag NCs for the detection of cocaine, based on strong interaction between cocaine and its binding aptamer.132 Upon binding to cocaine, two DNA fragments formed a stable structure that led to the formation of fluorescent Ag NCs, as shown in Fig. 7. This approach allowed detection of cocaine with a LOD of 0.1 mM. To improve sensitivity for cocaine (down to 2 nM), nicking endonuclease assisted signal amplification was applied.133 When there was cocaine, nicking endonuclease cut the substrate DNA into two short sequences, which assisted the generation of fluorescent Ag NCs. Guanosine 30 -diphosphate-50 di(tri)phosphate (ppGpp) is a signal molecule, which is generated by transferring a pyrophosphate from ATP to the 30 -OH of guanosine diphosphate (GDP) or guanosine triphosphate (GTP).134 Using Cu2+/Ag–DNA NCs as a turn-on probe for ppGpp detection, a LOD of 0.75 mM was achieved.135 The fluorescence of DNA–Ag NCs was firstly quenched by Cu2+ via electron or energy transfer though the strong affinity between Cu2+ and phosphates of DNA. Upon the addition of ppGpp, some Cu2+ were released from the DNA–Ag NCs to interact with the phosphate groups of ppGpp, resulting in the restoration of the fluorescence. 4.3

Detection of nucleic acids

Development of highly sensitive and selective detection methods for nucleic acids (e.g., DNA and RNA) is beneficial to pathogen


Feature Article

identification, clinical diagnosis, and forensic analysis.136,137 DNA scaffold stabilized Ag NCs may have optical response to a specific nucleic acid sequence, which motivated researchers to exploit applications of DNA–Ag NCs in nucleic acid sensing. Martinez et al. discovered that the fluorescence of DNA–Ag NCs can be enhanced when placed in proximity to appropriate DNA sequences.138 A significant increase (B500-fold) in red fluorescence intensity of DNA–Ag NCs was observed upon the hybridization of a G-rich DNA. The enhancement increased with the number of guanine in proximity to Ag NCs. This enhancement was reversible; dissociation of the DNA duplex at high temperature induced decreases in the fluorescence intensity, while re-formation of the DNA duplex enhanced fluorescence intensity. Compared with G-rich DNA, C-rich DNA caused irreversible and lower fluorescence enhancement, while T-rich DNA showed no enhancement of red fluorescence intensity but an apparent increase (B16-fold) of green fluorescence intensity. However, no enhancement in either red or green fluorescence intensity was detected with A-rich DNA. Since G has the lowest oxidation potential over other nucleotides, it may serve as a reducing agent to reduce the nearby Ag NCs and to enhance the red fluorescence.139 However, when five Gs of G-rich DNA were replaced with five 7-deazaguanines, a stronger electron donor than G, no significant fluorescence enhancement was observed. The fluorescence enhancement mechanism was further investigated using ultrafast spectroscopy.140 Addition of a complementary DNA with a G-rich tail induced a new excited state, mainly due to G induced polarization of Ag NCs. A recent study showed that the bright Ag NCs maintain most of their fluorescence when G-rich DNA was removed.141 These studies suggest that after the fluorescence enhancement of Ag NCs, the G-rich DNA is no longer needed for maintaining their fluorescence. This phenomenon provides feasibility for ‘‘light-up’’ DNA detection with DNA–Ag NCs. As a proof of concept, a nanocluster beacon (NCB) probe was employed for the detection of a specific DNA target.142 The two short linear DNA probes (a cluster nucleation probe and a G-rich probe) in the NCB system were brought into proximity through hybridization by the target DNA, resulting in a 76-fold increase in red fluorescence intensity. Similarly, a chameleon NCB probe was able to discriminate single-nucleotide mutation of Kras gene in clinical samples. The emission color of DNA–Ag NCs changed substantially, depending upon the relative position to an enhancer sequence. As a consequence, different colors were observed by the naked eye under UV light illumination after hybridization with various mutant DNA sequences. On the basis of the fact that the DNA duplex can lead to fluorescence enhancement of ssDNA stabilized Ag NCs, fluorescent, functional DNA–Ag NCs (FFDNA–Ag NCs) were prepared and employed for single nucleotide polymorphisms (SNP) analysis of fumarylacetoacetate hydrolase gene, as shown in Fig. 8.66 The designed DNA sequence consists of two functional regions: a nucleation sequence (C12) as the scaffold for Ag NCs and a specific recognition sequence (50 -CCAGATACTCACCGG-3 0 ) for targeting. Mass measurements demonstrated that each DNA strand contained three Ag atoms, while CD spectra of DNA strand revealed different structures between the free DNA

Chem. Commun.

View Article Online


Feature Article

ChemComm

Fig. 8 Schematic representation of the preparation of FFDNA–Ag NC probes and the detection of target DNA (DNApmt). Reprinted from ref. 66 with the permission from the Elsevier.

template and scaffold in the DNA–Ag NCs. The DNA–Ag NCs had stronger fluorescence in solutions containing 150 mM NaCl in the presence of perfect matched DNA, mainly because of the formation of a more ordered, folded structure. Under the optimal conditions, the fluorescence enhancement increased upon increasing the concentrations of the target DNA from 25 to 1000 nM, with a LOD of 14 nM. This approach was capable of distinguishing single nucleotide mutation on the targeted sequence. Wang et al. found that the inner C6-loop in dsDNA allows us to produce Ag NCs, and a mismatch nearby the C6-loop affects the fluorescence intensity of the dsDNA–Ag NCs.55 The fluorescence of Ag NCs was efficiently quenched upon the denaturation of duplex DNA structure, while recovered when dsDNA reformulated, allowing the development of an off–on switching probe through a DNA strand exchange reaction.143 Petty et al. observed spectral changes induced by DNA binding to DNA–Ag NCs.144 Upon association of the targeted recognition sequence, the absorption wavelength of the probe underwent a large red shift. The maximum absorption wavelength changed from 400 to 720 nm. Stoichiometric measurements revealed that absorption around 400 nm is mainly assigned to ssDNA (5 0 -C3AC3AC3TC3ACCCGCCGCTGGA-3 0 ) stabilized Ag7 NCs, while absorption at 720 nm originated from dsDNA protected Ag11 NCs (complementary sequence: 5 0 -TCCAGCGGCGGG-3 0 ). The hydrodynamic radius of the duplex DNA was 2.1 0.1 nm. While it was 3.6 nm for the Ag NCs with absorption at 720 nm, suggesting that the opening of the DNA host led to the exposure of the C3AC3AC3TC3A binding site to the near-infrared Ag NCs. Combining DNA–Ag NCs and graphene oxide (GO), Willner et al. demonstrated multiplex detection of DNA genes, including hepatitis B virus gene and immunodeficiency virus gene.145 DNA containing dual functional regions was used for the synthesis of Ag NCs and target binding. In addition to providing a targeted binding site, the recognition DNA tail also provided the moiety for adsorbing the hybrid nanostructures onto the GO surface. Subsequent fluorescence quenching of Ag NCs is likely due to the electron transfer or energy transfer between GO and DNA–Ag NCs. Upon the hybridization with targeted DNA, the rigid duplex

Chem. Commun.

DNA weakened the GO/DNA–Ag NCs association and thus the DNA–Ag NCs were desorbed from the GO surface, leading to increases in the fluorescence. Considering the high fluorescence quenching efficiency of GO, this approach had low background and provided high sensitivity (LOD of 0.5 nM). DNA–Ag NCs-based optical probes have also been developed for the detection of small RNAs, such as microRNA (miRNA).146–148 For example, Yang et al. designed red-emissive DNA–Ag NCs for the detection of miR-160, a plant miRNA involved in hormone signaling.149 The bright fluorescence of DNA–Ag NCs diminished in the presence of target miRNA, allowing discrimination of miR-160 from other endogenous miRNA (such as miR-163, miR-166, and miR-172). The fluorescence quenching is mainly attributed to the reduction of secondary structures, which in turn led to weaker protection of Ag NCs. When the sequence was rearranged to increase the stability of secondary structure, the redesigned DNA stabilized Ag NCs showed a dramatic increase in red emission.150 This approach allowed the detection of miR-172 at the concentration down to 82 nM. Combined with isothermal exponential amplification and DNA–Ag NCs, a highly sensitive detection approach was developed for miRNA, with a LOD at the attomolar (aM) level.151 In the presence of the amplification template, polymerases, and nicking enzymes, target miRNA (miR-141) led to the generation of a great amount of reporter DNA sequences for the synthesis of stronger fluorescent Ag NCs. This method provided a LOD of 2 aM for synthetic spike-in target miRNA under simple conditions (approximately 15 copies of a miRNA molecule in a volume of 10 mL) and allowed detection of spike-in target miRNA with the concentration down to 10 aM in cell lysates. 4.4

Detection of proteins

Proteins play important roles in various cell functions such as cell divisions, signaling and apoptosis.152,153 Important markers such as alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), platelet-derived growth factors (PDGFs), and prostatespecific antigen (PSA) have been revealed for hepatocellular carcinoma, lung, breast and prostate cancers.154–157 The concentrations of many important proteins are quite low (usually nM to sub-nM levels), making it an extreme challenge to detect them in


View Article Online


ChemComm

biological samples like blood that contains abundant proteins such as albumin. In addition to the antibody, aptamers (small DNAs and RNAs) with certain conformations can bind to proteins specifically.158–161 Aptamer conjugated nanomaterials such as Au nanoparticles and nanodots have been employed for the detection of adenosine, PDGFs and thrombin.162–166 Alternatively, aptamers have been used for the preparation of DNA–Ag NCs that allow sensitive and selective detection of proteins.167–169 To detect ssDNA binding protein (SSB), an aptamer that recognizes SSB was used to prepare DNA–Cu/Ag NCs.170 Relative to DNA–Ag NCs, DNA–Cu/Ag NCs provide stronger fluorescence (at least five folds) and thus better sensitivity. Through specific binding between SSB and the aptamer, the fluorescence of DNA–Cu/Ag NCs decreased as a result of the change in the DNA scaffold as shown in Fig. 9. Once the Cu/Ag NCs were not well protected by the DNA scaffold, they were exposed to quenchers such as oxygen with greater chance. This turn-off approach allowed detection of SSB, with a LOD of 0.2 nM. Martinez et al. reported an aptamer functionalized DNA–Ag NCs based thrombin probe.171 In the presence of thrombin, the fluorescence was dramatically quenched through the DNA conformation change, allowing detection of thrombin down to 1 nM. A similar strategy was applied for the detection of human telomerase, which is a RNA–protein complex and potential biomarker of tumour cells.172 In addition to the turn-off probes, Zhu et al. presented a binding-induced fluorescence turn-on probe for thrombin detection.173 The detection mechanism is based on the fact that red fluorescence of DNA–Ag NCs can be enhanced by G-rich DNA in proximity to Ag NCs. DNA consisting of the Apt15 sequence, the spacer sequence, the hybridized sequence, and a C12 sequence was used to prepare Ag NCs. The other DNA consists of the Apt29 sequence, the spacer sequence, the complementary sequence, and a G-rich sequence in the tail. Through specific binding of thrombin with Apt15 and Apt29 (two aptamers specific to thrombin) and DNA hybridization, the G-rich tail was close to Ag NCs, resulting in a significant fluorescence enhancement as shown in Fig. 10. This approach allowed detection of thrombin over a concentration range from 5 nM to 2 mM, with a LOD of 1 nM. Yang et al. prepared DNA–Ag NCs for the detection of the PDGF B-chain homodimer (PDGF-BB).174 One DNA consists of the aptamer sequence, the spacer, the hybridized sequence, named P1, while the other DNA contains a complementary sequence and an Ag NC nucleation sequence, named P2. PDGF-BB interacted with the DNA fragment through its specific interactions with the aptamer sequence of P1, resulting in the conformation change of P1 and hybridization between P1 and P2. As a result, the Ag NCs nucleation sequence became available for the synthesis of Ag NCs via the reduction of Ag+ by NaBH4. This approach provided a LOD of 0.37 nM for PDGF-BB. Through digestion of DNA in the DNA–Ag NCs, leading to decreases in the fluorescence intensity, the activity of deoxyribonuclease I (DNase I) was determined.175 The simple approach allowed detection of DNase I over a linear range of 0.013–60 mg mL1, with a LOD of 3 ng mL1. Practicality of this


Feature Article

Fig. 9 (A) Fluorescence response of the DNA–Cu/Ag NCs upon addition of SSB. Inset: linear range of the plot of (IF0 IF)/IF0 against the SSB concentration (0–50 nM). IF0 and IF are the fluorescence intensities of the DNA–Cu/Ag NCs in the absence and presence of SSB, respectively. (B) Selectivity of the DNA–Cu/Ag NCs probe toward SSB over other proteins. The concentrations of SSB and the rest of the proteins are 25 and 100 nM, respectively. Reprinted from ref. 170 with the permission from the Royal Society of Chemistry.

probe was validated by the analysis of DNase I in human serum and saliva samples. To further improve the sensitivity, a ratiometric fluorescence approach using DNA–Ag NCs was demonstrated.176 The DNA–Ag NCs acted as an acceptor, while tryptophan was a donor. The fluorescence of DNA–Ag NCs at 490 nm was apparent when excited at 280 nm, mainly through the efficient fluorescence resonance energy transfer between nearby tryptophan and Ag NCs. Subsequent introduction of S1 nuclease resulted in the decrease of DNA–Ag NCs emission at 490 nm and the recovery of the tryptophan emission at 355 nm. This approach provided a LOD of 0.14 U mL1 for S1 nuclease. DNA–Ag NCs were prepared and employed for evaluating the activity of acetylcholinesterase (AChE).177 AChE catalyzed the hydrolysis of acetylthiocholine to form thiocholine that

Chem. Commun.

View Article Online

Feature Article

ChemComm


sequences was used as a template for the preparation of Ag NCs.169 The functional Ag NCs were used for the detection of CCRF-CEM cells through flow cytometry and confocal microscopy. Using the AS1411 nucleolin antiproliferative aptamer as a template, DNA–Ag NCs were prepared for specific labelling of MCF-7 nuclei.168 A T5 spacer between AS1411 and the nucleation sequence is critical to produce high-emission Ag NCs. The specificity of AS1411–Ag NCs toward MCF-7 cells was validated over NIH-3T3 cells.

5. Conclusion and perspective

Fig. 10 Principle of binding-induced fluorescence turn-on assay for protein detection. Reprinted from ref. 173 with the permission from the American Chemical Society.

The DNA–Ag NCs are advantageous in their wide emission range from the visible to NIR region, high quantum yields, and good biocompatibility. Great successful examples of using DNA–Ag NCs for the analysis of biological and environmental samples have shown their potential for sensing and cell imaging. A number of DNA templates have been used for the preparation of DNA–Ag NCs for the sensing of ions, organic compounds, proteins, and DNA as listed in Table 2, with sensitivity and linear

Table 2

induced fluorescence quenching of DNA–Cu/Ag NCs, mainly because of DNA conformational changes as a result of the interaction of thiocholine with the Ag NCs. The activity of AChE was detected even at the 0.05 mU mL1 level and quantified in the range of 0.05 to 2.0 mU mL1. DNA–Ag NCs were also used for the determination of the activity of glutathione reductase, based on the turn-off fluorescence.178 In the presence of 2 0 -nicotinamide adenine dinucleotide 2 0 -phosphate reduced tetrasodium salt hydrate, glutathione reductase can catalyze the reduction of the oxidized GSH to reduced GSH that quenched the fluorescence of DNA–Ag NCs effectively. Based on the fact that H2O2 or quinone can induce fluorescence quenching of DNA–Ag NCs, probes were developed for the determination of the activity of enzymes that can generate H2O2 or quinone.179 The probe was validated in the glucose oxidase–glucose, choline oxidase–choline, and tyrosinase–tyrosine systems. 4.5

Cell imaging

Dickson et al. used avidin conjugated C24–Ag NCs to label the biotinylated fixed NIH-3T3 cell.180 The biotinylated fixed NIH-3T3 cell showed much higher fluorescence than the nonbiotinylated cells after incubation with 5 mM avidin conjugated C24–Ag NCs. When using penetratin conjugated C12–Ag NCs, stronger staining of nuclei compared to other organelles in NIH 3T3 cell was observed. Alternatively, an aptamer (Sgc8c) was used to functionalize Ag NCs for specific targeting of the surface and nuclei of CCRF-CEM tumour cells.167 Through specific interaction with the human protein tyrosine kinase 7 on the CCRF-CEM cell membrane, the functional Ag NCs internalized into the cells, and finally reached the nuclei. To enhance fluorescence intensity and photostability, a DNA consisting of a A6 spacer between aptamer and nucleation

Chem. Commun.

Summary of DNA–Ag NCs for representative analytes

Analytes 2+

Cu Cu2+ Cu2+ Hg2+ Hg2+ Hg2+ Hg2+ Hg2+ Hg2+ S2 H2O2 Glucose GSH Cys Hcy GSH Cys Thiocholine Cocaine ATP Cocaine Cholesterol Hydroquinone Bleomycin Ascorbic acid ATP Quinacrine DNA DNA DNA DNA DNA RNA RNA RNA RNA Protein Protein Protein Protein Protein

Strategy

LOD (nM)

Linear range (nM)

Ref.

Turn-on Turn-on Turn-off Turn-off Turn-off Turn-off Turn-off Turn-on Turn-on Turn-off Turn-off Turn-off Turn-off Turn-off Turn-off Turn-on Turn-on Turn-off Turn-on Turn-off Turn-on Turn-off Turn-off Turn-off Turn-on Turn-off Turn-off Turn-on Turn-on Turn-on Turn-off Turn-on Turn-off Turn-off Turn-on Turn-off Turn-off Turn-off Turn-on Turn-on Turn-off

8 2.7 10 5 0.9 4 3 10 0.033 0.83 50 1000 4 4 200 6.2 45 0.3 100 200 2 200 40 54 7 8 12.5 14 10 10 0.6 0.5 20 250 0.01 1.7 0.2 1 1 0.37 20

25–250 5–200 10–1000 5–1500 2.5–50 10–200 50–1000 10–300 0.1–200 3–9000 50–5000 1000–40 000 8–100 8–100 600–2000 25–200 100–1500 2–16 500–1 000 000 1000–1 000 000 2–50 000 200–250 000 80–3200 100–400 20–500 20–1000 12.5–1250 25–1000 10–1200 10–1000 1–100 5–1000 20–1500 250–1500 0.01–10 5–125 1–50 1–1500 5–2000 1–50 25–250

68 116 117 106 46 108 107 181 182 67 183 179 128 128 128 129 184 185 132 132 133 186 187 188 189 190 191 66 192 193 190 145 149 150 194 195 170 171 173 174 172


View Article Online


ChemComm

range. Most of them are turn-off sensing probes, based on the analyte induced changes in the DNA scaffolds. The fluorescence quenching is a result of great access of Ag NCs to quenchers such as oxygen. Unlike the turn-off sensing strategies, some turn-on probes have been demonstrated by introducing G-rich sequences close to Ag NCs. To make DNA–Ag NCs more powerful in sensing and imaging applications, several disadvantages remain to be overcome. Cost for preparation of DNA–Ag NCs is relatively high compared to the preparation of quantum dots, carbon nanodots and Au nanodots, mainly because a high concentration (usually mM) of DNA is required. To control the quality of DNA– Ag NCs, preparation is usually conducted on a small scale (o1 mL), making it difficult for commercialization. DNA–Ag NCs are usually unstable under critical conditions (e.g., high salt and high temperature), limiting their biological application. The stability of DNA–Ag NCs at pH values lower than 5.0 or higher than 8.0 is usually not great. Oxidation of Ag NCs is another concern. In addition, photostability of DNA–Ag NCs is not as great as that of carbon nanodots. Although emission tunable DNA–Ag NCs can be easily synthesized and modified based on existing DNA sequences, general rules for designing specific DNA strands for the preparation of DNA–Ag NCs are still unavailable. Understanding fundamental properties of DNA–Ag NCs requires molecule-level information on both the structure and the energy level of the DNA–Ag NCs. For example, mass analysis has been demonstrated to be useful to provide stoichiometric information of Ag atoms per DNA template, but there are still questions as to how the sequence controls the number and position of Ag atoms inside the DNA scaffold. Nuclear magnetic resonance and X-ray spectroscopies can provide more detailed structural information, but they need large amounts of DNA–Ag NCs. Electrochemistry may be useful to provide more detailed chemical information. However, it is difficult to provide useful information in the presence of DNA (large molecule). DFT calculations have provided some useful information about the structures and optical properties of DNA–Ag NCs.36 It is not an easy task to predict and to explain the optical properties of DNA–Ag NCs in the presence of a large DNA scaffold. Usually, several Ag NCs with different numbers and oxidation states of Ag atoms are coexistent, leading to broad emission profiles that make it more difficult for the calculation. In addition to the DNA scaffold, some small ligands may be adsorbed onto the surface of Ag NCs. The surface ligands may induce fluorescence quenching or enhancement through ligand to metal charge transfer or donation of delocalized electrons of the metal core.196 Based on the fact that DNA–Cu/Ag NCs and DNA–Au/Ag NCs relative to DNA–Ag NCs have stronger fluorescence intensity and stability against salts, respectively, multiple metal NCs using DNA templates are likely the possible candidates for brighter and stable Ag NCs. Since small ligands can be adsorbed onto the surfaces of Ag NCs and/or intercalated into the double stranded DNA scaffolds, they can be used to further improve the stability and fluorescence intensity of the DNA–Ag


Feature Article

NCs. High order and compacted DNA scaffolds can be designed to prepare more stable and stronger fluorescent DNA–Ag NCs. In addition, DNA with hydrophilic polymers/proteins can be used to prepare functional Ag NCs. It is also possible to further improve the stability of DNA–Ag NCs against salt and pH when they are prepared inside microgels or on the surfaces of other type of nanomaterials such as SiO2 and Al2O3. Once more stable and stronger fluorescent DNA–Ag NCs and multiple metal functional NCs are available, they will soon become popular sensing materials. Several DNA fragments containing various functions, including nucleation of Ag NCs, target binding, hybridization, and drug binding, can be used to prepare multiple functional DNA–Ag NCs. For example, functional Ag NCs can be used to target cancer cells and then inhibit their growth.

Acknowledgements We are grateful to the Ministry of Science and Technology of Taiwan for providing financial support for this study under contracts NSC 101-2113-M-002-002-MY3. Z. Yuan is grateful to the Ministry of Science and Technology of Taiwan for a postdoctoral fellowship under contracts NSC 102-2811-M-002-149.

Notes and references 1 J. Zheng, C. W. Zhang and R. M. Dickson, Phys. Rev. Lett., 2004, 93, 077402. 2 C.-C. Huang, Z. Yang, K.-H. Lee and H.-T. Chang, Angew. Chem., Int. Ed., 2007, 46, 6824. 3 J. Zheng and R. M. Dickson, J. Am. Chem. Soc., 2002, 124, 13982. 4 W. Wei, Y. Lu, W. Chen and S. Chen, J. Am. Chem. Soc., 2011, 133, 2060. 5 S.-I. Tanaka, J. Miyazaki, D. K. Tiwari, T. Jin and Y. Inouye, Angew. Chem., Int. Ed., 2011, 50, 431. 6 R. Jin, Y. Zhu and H. Qian, Chem. – Eur. J., 2011, 17, 6584. ¨ . Dag, J. Phys. Chem. B, 2000, 7 T. P. Bigioni, R. L. Whetten and O 104, 6983. 8 S. Link, A. Beeby, S. FitzGerald, M. A. El-Sayed, T. G. Schaaff and R. L. Whetten, J. Phys. Chem. B, 2002, 106, 3410. 9 J. Zheng, C. Zhou, M. X. Yu and J. B. Liu, Nanoscale, 2012, 4, 4073. 10 A. M. Derfus, W. C. W. Chan and S. N. Bhatia, Nano Lett., 2003, 4, 11. 11 Y.-C. Shiang, C.-C. Huang, W.-Y. Chen, P.-C. Chen and H.-T. Chang, J. Mater. Chem., 2012, 22, 12972. 12 L. Shang, S. Dong and G. U. Nienhaus, Nano Today, 2011, 6, 401. 13 J. Zheng, P. R. Nicovich and R. M. Dickson, Annu. Rev. Phys. Chem., 2007, 58, 409. 14 Y. Z. Lu and W. Chen, Chem. Soc. Rev., 2012, 41, 3594. 15 Z. Yuan, M. Peng, Y. He and E. S. Yeung, Chem. Commun., 2011, 47, 11981. ¨kkinen, U. Landman, A. S. Wo ¨rz, J.-M. Antonietti, 16 B. Yoon, H. Ha S. Abbet, K. Judai and U. Heiz, Science, 2005, 307, 403. 17 H. Xu and K. S. Suslick, Adv. Mater., 2010, 22, 1078. 18 I. Diez and R. H. A. Ras, Nanoscale, 2011, 3, 1963. 19 S. Choi, R. M. Dickson and J. Yu, Chem. Soc. Rev., 2012, 41, 1867. 20 B. Han and E. Wang, Anal. Bioanal. Chem., 2012, 402, 129. ´. Somoza, ChemBioChem, 2012, 13, 951. 21 A. Latorre and A 22 J. Sharma, R. C. Rocha, M. L. Phipps, H.-C. Yeh, K. A. Balatsky, D. M. Vu, A. P. Shreve, J. H. Werner and J. S. Martinez, Nanoscale, 2012, 4, 4107. 23 X. Yuan, T. J. Yeow, Q. Zhang, J. Y. Lee and J. Xie, Nanoscale, 2012, 4, 1968. 24 S. Choi, S. Park, K. Lee and J. Yu, Chem. Commun., 2013, 49, 10908. 25 Z. Wu, E. Lanni, W. Chen, M. E. Bier, D. Ly and R. Jin, J. Am. Chem. Soc., 2009, 131, 16672.

Chem. Commun.

View Article Online


Feature Article 26 T. Udaya Bhaskara Rao and T. Pradeep, Angew. Chem., Int. Ed., 2010, 49, 3925. 27 L. Shang and S. Dong, Chem. Commun., 2008, 1088. 28 Z. Yuan, N. Cai, Y. Du, Y. He and E. S. Yeung, Anal. Chem., 2014, 86, 419. 29 T. J. Bandy, A. Brewer, J. R. Burns, G. Marth, T. Nguyen and E. Stulz, Chem. Soc. Rev., 2011, 40, 138. 30 Y. Miyake, H. Togashi, M. Tashiro, H. Yamaguchi, S. Oda, M. Kudo, Y. Tanaka, Y. Kondo, R. Sawa, T. Fujimoto, T. Machinami and A. Ono, J. Am. Chem. Soc., 2006, 128, 2172. 31 A. Ono, S. Cao, H. Togashi, M. Tashiro, T. Fujimoto, T. Machinami, S. Oda, Y. Miyake, I. Okamoto and Y. Tanaka, Chem. Commun., 2008, 4825. 32 J. Richter, R. Seidel, R. Kirsch, M. Mertig, W. Pompe, J. Plaschke and H. K. Schackert, Adv. Mater., 2000, 12, 507. 33 C. F. Monson and A. T. Woolley, Nano Lett., 2003, 3, 359. 34 J. T. Petty, J. Zheng, N. V. Hud and R. M. Dickson, J. Am. Chem. Soc., 2004, 126, 5207. 35 J. T. Petty, S. P. Story, J.-C. Hsiang and R. M. Dickson, J. Phys. Chem. Lett., 2013, 4, 1148. 36 J. M. Obliosca, C. Liu and H.-C. Yeh, Nanoscale, 2013, 5, 8443. 37 Z. Hossain and F. Huq, J. Inorg. Biochem., 2002, 91, 398. 38 J. Wu, Y. Fu, Z. He, Y. Han, L. Zheng, J. Zhang and W. Li, J. Phys. Chem. B, 2012, 116, 1655. 39 K. S. Park, J. Y. Lee and H. G. Park, Chem. Commun., 2012, 48, 4549. 40 W. Y. Xie, W. T. Huang, N. B. Li and H. Q. Luo, Chem. Commun., 2012, 48, 82. 41 D.-Q. Feng, G. Liu, W. Zheng, J. Liu, T. Chen and D. Li, Chem. Commun., 2011, 47, 8557. 42 T. Ihara, T. Ishii, N. Araki, A. W. Wilson and A. Jyo, J. Am. Chem. Soc., 2009, 131, 3826. 43 C. M. Ritchie, K. R. Johnsen, J. R. Kiser, Y. Antoku, R. M. Dickson and J. T. Petty, J. Phys. Chem. C, 2007, 111, 175. 44 T. Vosch, Y. Antoku, J. C. Hsiang, C. I. Richards, J. I. Gonzalez and R. M. Dickson, Proc. Natl. Acad. Sci. U. S. A., 2007, 104, 12616. 45 C. I. Richards, S. Choi, J.-C. Hsiang, Y. Antoku, T. Vosch, A. Bongiorno, Y.-L. Tzeng and R. M. Dickson, J. Am. Chem. Soc., 2008, 130, 5038. 46 G.-Y. Lan, W.-Y. Chen and H.-T. Chang, RSC Adv., 2011, 1, 802. 47 E. G. Gwinn, P. O’Neill, A. J. Guerrero, D. Bouwmeester and D. K. Fygenson, Adv. Mater., 2008, 20, 279. 48 P. R. O’Neill, K. Young, D. Schiffels and D. K. Fygenson, Nano Lett., 2012, 12, 5464. 49 J. Li, X. Jia, D. Li, J. Ren, Y. Han, Y. Xia and E. Wang, Nanoscale, 2013, 5, 6131. ´ron and J.-L. Leroy, Curr. Opin. Struct. Biol., 2000, 10, 50 M. Gue 326. 51 B. Sengupta, K. Springer, J. G. Buckman, S. P. Story, O. H. Abe, Z. W. Hasan, Z. D. Prudowsky, S. E. Rudisill, N. N. Degtyareva and J. T. Petty, J. Phys. Chem. C, 2009, 113, 19518. 52 W. Li, L. Liu, Y. Fu, Y. Sun, J. Zhang and R. Zhang, Photochem. Photobiol. Sci., 2013, 12, 1864. 53 S. Burge, G. N. Parkinson, P. Hazel, A. K. Todd and S. Neidle, Nucleic Acids Res., 2006, 34, 5402. 54 J. Ai, W. Guo, B. Li, T. Li, D. Li and E. Wang, Talanta, 2012, 88, 450. 55 W. Guo, J. Yuan, Q. Dong and E. Wang, J. Am. Chem. Soc., 2010, 132, 932. 56 R. Orbach, W. Guo, F. Wang, O. Lioubashevski and I. Willner, Langmuir, 2013, 29, 13066. 57 W. Guo, R. Orbach, I. Mironi-Harpaz, D. Seliktar and I. Willner, Small, 2013, 9, 3748. 58 Z. Huang, F. Pu, D. Hu, C. Wang, J. Ren and X. Qu, Chem. – Eur. J., 2011, 17, 3774. 59 G. L. Dianov, K. M. Sleeth, I. I. Dianova and S. L. Allinson, Mutat. Res., Fundam. Mol. Mech. Mutagen., 2003, 531, 157. 60 K. Ma, Q. H. Cui, G. Y. Liu, F. Wu, S. J. Xu and Y. Shao, Nanotechnology, 2011, 22, 305502. 61 K. Ma, Y. Shao, Q. Cui, F. Wu, S. Xu and G. Liu, Langmuir, 2012, 28, 15313. ` and C. M. Niemeyer, Angew. Chem., Int. Ed., 2012, 51, 58. 62 B. Sacca 63 S. Pal, R. Varghese, Z. Deng, Z. Zhao, A. Kumar, H. Yan and Y. Liu, Angew. Chem., Int. Ed., 2011, 50, 4176. 64 J. Yu, S. Choi and R. M. Dickson, Angew. Chem., Int. Ed., 2009, 48, 318.

Chem. Commun.

ChemComm 65 B. N. G. Giepmans, S. R. Adams, M. H. Ellisman and R. Y. Tsien, Science, 2006, 312, 217. 66 G.-Y. Lan, W.-Y. Chen and H.-T. Chang, Biosens. Bioelectron., 2011, 26, 2431. 67 W.-Y. Chen, G.-Y. Lan and H.-T. Chang, Anal. Chem., 2011, 83, 9450. 68 G. Y. Lan, C. C. Huang and H. T. Chang, Chem. Commun., 2010, 46, 1257. 69 P. R. O’Neill, E. G. Gwinn and D. K. Fygenson, J. Phys. Chem. C, 2011, 115, 24061. 70 V. Soto-Verdugo, H. Metiu and E. Gwinn, J. Chem. Phys., 2010, 132, 195102. 71 X. Yang, L. Gan, L. Han, E. Wang and J. Wang, Angew. Chem., Int. Ed., 2013, 52, 2022. 72 D. Schultz, K. Gardner, S. S. R. Oemrawsingh, N. Markesˇevic´, K. Olsson, M. Debord, D. Bouwmeester and E. Gwinn, Adv. Mater., 2013, 25, 2797. 73 M. L. Neidig, J. Sharma, H.-C. Yeh, J. S. Martinez, S. D. Conradson and A. P. Shreve, J. Am. Chem. Soc., 2011, 133, 11837. 74 J. Sharma, H.-C. Yeh, H. Yoo, J. H. Werner and J. S. Martinez, Chem. Commun., 2010, 46, 3280. 75 P. R. O’Neill, L. R. Velazquez, D. G. Dunn, E. G. Gwinn and D. K. Fygenson, J. Phys. Chem. C, 2009, 113, 4229. 76 B. Sengupta, C. M. Ritchie, J. G. Buckman, K. R. Johnsen, P. M. Goodwin and J. T. Petty, J. Phys. Chem. C, 2008, 112, 18776. 77 K. Morishita, J. L. MacLean, B. W. Liu, H. Jiang and J. W. Liu, Nanoscale, 2013, 5, 2840. 78 S. Choi, J. Yu, S. A. Patel, Y.-L. Tzeng and R. M. Dickson, Photochem. Photobiol. Sci., 2011, 10, 109. 79 T.-T. Zhao, Q.-Y. Chen, C. Zeng, Y.-Q. Lan, J.-G. Cai, J. Liu and J. Gao, J. Mater. Chem. B, 2013, 1, 4678. 80 J. T. Petty, C. Fan, S. P. Story, B. Sengupta, A. St. John Iyer, Z. Prudowsky and R. M. Dickson, J. Phys. Chem. Lett., 2010, 1, 2524. 81 J. T. Petty, C. Fan, S. P. Story, B. Sengupta, M. Sartin, J.-C. Hsiang, J. W. Perry and R. M. Dickson, J. Phys. Chem. B, 2011, 115, 7996. 82 M. Goppert-Mayer, Ann. Phys., 1931, 9, 273. 83 W. Kaiser and C. G. B. Garrett, Phys. Rev. Lett., 1961, 7, 229. 84 F. Helmchen and W. Denk, Nat. Methods, 2005, 2, 932. 85 C. N. LaFratta, J. T. Fourkas, T. Baldacchini and R. A. Farrer, Angew. Chem., Int. Ed., 2007, 119, 6352. 86 S. Kawata and Y. Kawata, Chem. Rev., 2000, 100, 1777. 87 T.-C. Lin, S.-J. Chung, K.-S. Kim, X. Wang, G. He, J. Swiatkiewicz, H. Pudavar and P. Prasad, in Polymers for Photonics Applications II, ed. K.-S. Lee, Springer, Berlin, Heidelberg, 2003, vol. 161, pp. 157–193. 88 W. G. Fisher, W. P. Partridge, C. Dees and E. A. Wachter, Photochem. Photobiol., 1997, 66, 141. 89 G. C. R. Ellis-Davies, Nat. Methods, 2007, 4, 619. 90 W. Denk, J. H. Strickler and W. W. Webb, Science, 1990, 248, 73. 91 M. Wachowiak, W. Denk and R. W. Friedrich, Proc. Natl. Acad. Sci. U. S. A., 2004, 101, 9097. 92 M. Taki, J. L. Wolford and T. V. O’Halloran, J. Am. Chem. Soc., 2003, 126, 712. 93 Y. Yamaoka, M. Nambu and T. Takamatsu, Opt. Express, 2011, 19, 13365. 94 M. Pawlicki, H. A. Collins, R. G. Denning and H. L. Anderson, Angew. Chem., Int. Ed., 2009, 48, 3244. 95 J. Lukomska, I. Gryczynski, J. Malicka, S. Makowiec, J. R. Lakowicz and Z. Gryczynski, Biochem. Biophys. Res. Commun., 2005, 328, 78. 96 M. A. Albota, C. Xu and W. W. Webb, Appl. Opt., 1998, 37, 7352. 97 S. A. Patel, C. I. Richards, J.-C. Hsiang and R. M. Dickson, J. Am. Chem. Soc., 2008, 130, 11602. 98 D. R. Larson, W. R. Zipfel, R. M. Williams, S. W. Clark, M. P. Bruchez, F. W. Wise and W. W. Webb, Science, 2003, 300, 1434. 99 S. J. Tan, M. J. Campolongo, D. Luo and W. Cheng, Nat. Nanotechnol., 2011, 6, 268. 100 S. K. Silverman, Angew. Chem., Int. Ed., 2010, 49, 7180. 101 O. I. Wilner and I. Willner, Chem. Rev., 2012, 112, 2528. 102 Y. N. Teo and E. T. Kool, Chem. Rev., 2012, 112, 4221. 103 K. Wang, Z. Tang, C. J. Yang, Y. Kim, X. Fang, W. Li, Y. Wu, C. D. Medley, Z. Cao, J. Li, P. Colon, H. Lin and W. Tan, Angew. Chem., Int. Ed., 2009, 48, 856.


View Article Online


ChemComm 104 A. Rajendran, M. Endo and H. Sugiyama, Angew. Chem., Int. Ed., 2012, 51, 874. 105 P. Holmes, K. A. F. James and L. S. Levy, Sci. Total Environ., 2009, 408, 171. 106 W. Guo, J. Yuan and E. Wang, Chem. Commun., 2009, 3395. 107 R.-Z. Wang, D.-L. Zhou, H. Huang, M. Zhang, J.-J. Feng and A.-J. Wang, Microchim. Acta, 2013, 180, 1287. 108 J. L. MacLean, K. Morishita and J. Liu, Biosens. Bioelectron., 2013, 48, 82. 109 S. Li, W. Cao, A. Kumar, S. Jin, Y. Zhao, C. Zhang, G. Zou, P. C. Wang, F. Li and X.-J. Liang, New J. Chem., 2014, 38, 1546. 110 E. D. Harris, Neth. J. Nutr., 1992, 122, 636. 111 J. Plastino, E. L. Green, J. Sanders-Loehr and J. P. Klinman, Biochemistry, 1999, 38, 8204. 112 P. Chen and E. I. Solomon, J. Am. Chem. Soc., 2004, 126, 4991. 113 R. Ninomiya, N. Koizumi and K. Murata, Biol. Trace Elem. Res., 2002, 87, 95. 114 E. Gaggelli, H. Kozlowski, D. Valensin and G. Valensin, Chem. Rev., 2006, 106, 1995. 115 P. S. Donnelly, Z. Xiao and A. G. Wedd, Curr. Opin. Chem. Biol., 2007, 11, 128. 116 Y.-T. Su, G.-Y. Lan, W.-Y. Chen and H.-T. Chang, Anal. Chem., 2010, 82, 8566. 117 M. Zhang and B.-C. Ye, Analyst, 2011, 136, 5139. 118 E. Blackstone, M. Morrison and M. B. Roth, Science, 2005, 308, 518. 119 D. J. Lefer, Proc. Natl. Acad. Sci. U. S. A., 2007, 104, 17907. 120 G. Yang, L. Wu, B. Jiang, W. Yang, J. Qi, K. Cao, Q. Meng, A. K. Mustafa, W. Mu, S. Zhang, S. H. Snyder and R. Wang, Science, 2008, 322, 587. 121 Z. Yuan, M. Peng, L. Shi, Y. Du, N. Cai, Y. He, H.-T. Chang and E. S. Yeung, Nanoscale, 2013, 5, 4683. ¨der, J. Robin Harris and L. B. Poole, Trends 122 Z. A. Wood, E. Schro Biochem. Sci., 2003, 28, 32. 123 A. A. Mostafa, E. W. Randell, S. C. Vasdev, V. D. Gill, Y. Han, V. Gadag, A. A. Raouf and H. El Said, Mol. Cell. Biochem., 2007, 302, 35. 124 S. Seshadri, A. Beiser, J. Selhub, P. F. Jacques, I. H. Rosenberg, R. B. D’Agostino, P. W. F. Wilson and P. A. Wolf, N. Engl. J. Med., 2002, 346, 476. 125 H. L. Martin and P. Teismann, FASEB J., 2009, 23, 3263. 126 L. Shang and S. Dong, Biosens. Bioelectron., 2009, 24, 1569. 127 X. Yuan, Y. Tay, X. Dou, Z. Luo, D. T. Leong and J. Xie, Anal. Chem., 2013, 85, 1913. 128 B. Han and E. Wang, Biosens. Bioelectron., 2011, 26, 2585. 129 Z. Huang, F. Pu, Y. Lin, J. Ren and X. Qu, Chem. Commun., 2011, 47, 3487. 130 L. Jennifer Daneen, C. Jinshun, C. Ying-Chieh, C. Wei-Yu, C.-M. Oua and H.-T. Chang, Biosens. Bioelectron., 2014, 58, 266. 131 M. Zhang, S.-M. Guo, Y.-R. Li, P. Zuo and B.-C. Ye, Chem. Commun., 2012, 48, 5488. 132 Z. Zhou, Y. Du and S. Dong, Biosens. Bioelectron., 2011, 28, 33. 133 K. Zhang, K. Wang, X. Zhu, J. Zhang, L. Xu, B. Huang and M. Xie, Chem. Commun., 2014, 50, 180. 134 C. Condon, C. Squires and C. L. Squires, Microbiol. Rev., 1995, 59, 623. 135 P. Zhang, Y. Wang, Y. Chang, Z. H. Xiong and C. Z. Huang, Biosens. Bioelectron., 2013, 49, 433. 136 C. Debouck and P. N. Goodfellow, Nat. Genet., 1999, 21, 48. 137 S. Kim and A. Misra, Annu. Rev. Biomed. Eng., 2007, 9, 289. 138 H.-C. Yeh, J. Sharma, J. J. Han, J. S. Martinez and J. H. Werner, Nano Lett., 2010, 10, 3106. 139 C. A. M. Seidel, A. Schulz and M. H. M. Sauer, J. Phys. Chem., 1996, 100, 5541. 140 S. H. Yau, N. Abeyasinghe, M. Orr, L. Upton, O. Varnavski, J. H. Werner, H.-C. Yeh, J. Sharma, A. P. Shreve, J. S. Martinez and T. Goodson Iii, Nanoscale, 2012, 4, 4247. 141 S. Walczak, K. Morishita, M. Ahmed and J. Liu, Nanotechnology, 2014, 25, 155501. 142 H.-C. Yeh, J. Sharma, I.-M. Shih, D. M. Vu, J. S. Martinez and J. H. Werner, J. Am. Chem. Soc., 2012, 134, 11550. 143 W. Guo, J. Yuan and E. Wang, Chem. Commun., 2011, 47, 10930. 144 J. T. Petty, S. P. Story, S. Juarez, S. S. Votto, A. G. Herbst, N. N. Degtyareva and B. Sengupta, Anal. Chem., 2012, 84, 356.


Feature Article 145 X. Liu, F. Wang, R. Aizen, O. Yehezkeli and I. Willner, J. Am. Chem. Soc., 2013, 135, 11832. 146 G. A. Calin and C. M. Croce, Nat. Rev. Cancer, 2006, 6, 857. 147 N. Bushati and S. M. Cohen, Annu. Rev. Cell Dev. Biol., 2007, 23, 175. 148 N. Pencheva and S. F. Tavazoie, Nat. Cell Biol., 2013, 15, 546. 149 S. W. Yang and T. Vosch, Anal. Chem., 2011, 83, 6935. 150 P. Shah, A. Rørvig-Lund, S. B. Chaabane, P. W. Thulstrup, H. G. Kjaergaard, E. Fron, J. Hofkens, S. W. Yang and T. Vosch, ACS Nano, 2012, 6, 8803. 151 Y.-Q. Liu, M. Zhang, B.-C. Yin and B.-C. Ye, Anal. Chem., 2012, 84, 5165. 152 M. J. van Hemert, H. Y. Steensma and G. P. H. van Heusden, BioEssays, 2001, 23, 936. 153 S. Culurgioni and M. Mapelli, Cell. Mol. Life Sci., 2013, 70, 4039. 154 D. Li, T. Mallory and S. Satomura, Clin. Chim. Acta, 2001, 313, 15. 155 R. Molina, X. Filella, J. M. Auge, R. Fuentes, I. Bover, J. Rifa, V. Moreno, E. Canals, N. Vinolas, A. Marquez, E. Barreiro, J. Borras and P. Viladiuc, Tumor Biol., 2003, 24, 209. 156 M. Relf, S. LeJeune, P. A. E. Scott, S. Fox, K. Smith, R. Leek, A. Moghaddam, R. Whitehouse, R. Bicknell and A. L. Harris, Cancer Res., 1997, 57, 963. 157 A. Magklara, A. Scorilas, W. J. Catalona and E. P. Diamandis, Clin. Chem., 1999, 45, 1960. 158 M. Famulok and G. Mayer, Acc. Chem. Res., 2011, 44, 1349. 159 A. B. Iliuk, L. Hu and W. A. Tao, Anal. Chem., 2011, 83, 4440. 160 A. K. Deisingh, in RNA Towards Medicine, ed. V. Erdmann, J. Barciszewski and J. Brosius, Springer, Berlin, Heidelberg, 2006, vol. 173, pp. 341–357. 161 B. Strehlitz, N. Nikolaus and R. Stoltenburg, Sensors, 2008, 8, 4296. 162 J. Liu and Y. Lu, Nat. Protoc., 2006, 1, 246. 163 J. Liu and Y. Lu, J. Am. Chem. Soc., 2007, 129, 8634. 164 C.-C. Huang, C.-K. Chiang, Z.-H. Lin, K.-H. Lee and H.-T. Chang, Anal. Chem., 2008, 80, 1497. 165 C. C. Huang, S. H. Chiu, Y. F. Huang and H. T. Chang, Anal. Chem., 2007, 79, 4798. 166 T.-E. Lin, W.-H. Chen, Y.-C. Shiang, C.-C. Huang and H.-T. Chang, Biosens. Bioelectron., 2011, 29, 204. 167 Z. Sun, Y. Wang, Y. Wei, R. Liu, H. Zhu, Y. Cui, Y. Zhao and X. Gao, Chem. Commun., 2011, 47, 11960. 168 J. Li, X. Zhong, F. Cheng, J.-R. Zhang, L.-P. Jiang and J.-J. Zhu, Anal. Chem., 2012, 84, 4140. 169 J. Yin, X. He, K. Wang, Z. Qing, X. Wu, H. Shi and X. Yang, Nanoscale, 2012, 4, 110. 170 G.-Y. Lan, W.-Y. Chen and H.-T. Chang, Analyst, 2011, 136, 3623. 171 J. Sharma, H.-C. Yeh, H. Yoo, J. H. Werner and J. S. Martinez, Chem. Commun., 2011, 47, 2294. 172 Y. Wei, R. Liu, Z. Sun, Y. Wang, Y. Cui, Y. Zhao, Z. Cai and X. Gao, Analyst, 2013, 138, 1338. 173 J. Li, X. Zhong, H. Zhang, X. C. Le and J.-J. Zhu, Anal. Chem., 2012, 84, 5170. 174 J.-J. Liu, X.-R. Song, Y.-W. Wang, A.-X. Zheng, G.-N. Chen and H.-H. Yang, Anal. Chim. Acta, 2012, 749, 70. 175 Y. Dou and X. Yang, Anal. Chim. Acta, 2013, 784, 53. 176 Y. Xiao, F. Shu, K.-Y. Wong and Z. Liu, Anal. Chem., 2013, 85, 8493. 177 W. Li, W. Li, Y. Hu, Y. Xia, Q. Shen, Z. Nie, Y. Huang and S. Yao, Biosens. Bioelectron., 2013, 47, 345. 178 S. Zhu, X.-e. Zhao, W. Zhang, Z. Liu, W. Qi, S. Anjum and G. Xu, Anal. Chim. Acta, 2013, 786, 111. 179 X. Liu, F. Wang, A. Niazov-Elkan, W. Guo and I. Willner, Nano Lett., 2013, 13, 309. 180 J. Yu, S. Choi, C. I. Richards, Y. Antoku and R. M. Dickson, Photochem. Photobiol., 2008, 84, 1435. 181 L. Deng, Z. Zhou, J. Li, T. Li and S. Dong, Chem. Commun., 2011, 47, 11065. 182 G. Wang, G. Xu, Y. Zhu and X. Zhang, Chem. Commun., 2014, 50, 747. 183 L. Zhang, R.-P. Liang, S.-J. Xiao, J.-M. Bai, L.-L. Zheng, L. Zhan, X.-J. Zhao, J.-D. Qiu and C.-Z. Huang, Talanta, 2014, 118, 339. 184 G. Liu, D.-Q. Feng, X. Mu, W. Zheng, T. Chen, L. Qi and D. Li, J. Mater. Chem. B, 2013, 1, 2128. 185 Y. Zhang, Y. Cai, Z. Qi, L. Lu and Y. Qian, Anal. Chem., 2013, 85, 8455.

Chem. Commun.

View Article Online

Feature Article

191 J. Yuan, W. Guo and E. Wang, Anal. Chim. Acta, 2011, 706, 338. 192 G. Wang, Y. Zhu, L. Chen, L. Wang and X. Zhang, Analyst, 2014, 139, 165. 193 L. Zhang, J. Zhu, Z. Zhou, S. Guo, J. Li, S. Dong and E. Wang, Chem. Sci., 2013, 4, 4004. 194 M. Zhang, Y.-Q. Liu, C.-Y. Yu, B.-C. Yin and B.-C. Ye, Analyst, 2013, 138, 4812. 195 X. Xia, Y. Hao, S. Hu and J. Wang, Biosens. Bioelectron., 2014, 51, 36. 196 Z. Wu and R. Jin, Nano Lett., 2010, 10, 2568.


186 M. Duan, Y. Peng, L. Zhang, X. Wang, J. Ge, J. Jiang and R. Yu, Anal. Methods, 2013, 5, 2182. 187 X. Guo, L. Deng and J. Wang, RSC Adv., 2013, 3, 401. 188 Y. Chang, P. Zhang, Y. Yu, Y. Q. Du, W. Wang and C. Z. Huang, Anal. Methods, 2013, 5, 6200. 189 L.-P. Zhang, X.-X. Zhang, B. Hu, L.-M. Shen, X.-W. Chen and J.-H. Wang, Analyst, 2012, 137, 4974. 190 L. Zhang, J. Zhu, S. Guo, T. Li, J. Li and E. Wang, J. Am. Chem. Soc., 2013, 135, 2403.

ChemComm

Chem. Commun.


Phosphorothioate DNA Stabilized Fluorescent Gold and Silver Nanoclusters.

Towards understanding of poly-guanine activated fluorescent silver nanoclusters.

Label-free nucleic acids detection based on DNA templated silver nanoclusters fluorescent probe.

One-step synthesis and applications of fluorescent Cu nanoclusters stabilized by L-cysteine in aqueous solution.

Magic Numbers in DNA-Stabilized Fluorescent Silver Clusters Lead to Magic Colors.

Ultrafast coherence transfer in DNA-templated silver nanoclusters.

A visual physiological temperature sensor developed with gelatin-stabilized luminescent silver nanoclusters.

Direct laser writing of photostable fluorescent silver nanoclusters in polymer films.

A facile synthesis of fluorescent silver nanoclusters with human ferritin as a synthetic and interfacing ligand.

DNA-regulated silver nanoclusters for label-free ratiometric fluorescence detection of DNA.

Highly Sensitive Simultaneous Detection of Mercury and Copper Ions by Ultrasmall Fluorescent DNA-Ag Nanoclusters.

Sub-micron scale patterning of fluorescent silver nanoclusters using low-power laser.

A Novel Label-Free microRNA-155 Detection on the Basis of Fluorescent Silver Nanoclusters.

DNA fluorescence shift sensor: a rapid method for the detection of DNA hybridization using silver nanoclusters.

Conjugated polyelectrolyte-stabilized silver nanoparticles coupled with pyrene derivative for ultrasensitive fluorescent detection of iodide.

Ag nanoclusters in guanine-rich DNA hybridization.

Fluorescent carbon nanomaterials: "quantum dots" or nanoclusters?

Cytotoxicity of nucleus-targeting fluorescent gold nanoclusters.

A label-free fluorescent assay for free chlorine in drinking water based on protein-stabilized gold nanoclusters.

Formation of Silver Nanoclusters from a DNA Template Containing Ag(I)-Mediated Base Pairs.

Base motif recognition and design of DNA templates for fluorescent silver clusters by machine learning.

Hairpin DNA probes based on target-induced in situ generation of luminescent silver nanoclusters.

Hybridization chain reaction modulated DNA-hosted silver nanoclusters for fluorescent identification of single nucleotide polymorphisms in the let-7 miRNA family.

nanoclusters stabilized by pristine graphene nanosheets.