JOURNAL OF BACrERIOLOGY, Sept. 1992, p. 5798-5802

Vol. 174, No. 18

0021-9193/92/185798-05$02.00/0 Copyright X) 1992, American Society for Microbiology

DNA Gyrase, CS7.4, and the Cold Shock Response in Escherichia coli PAMELA G. JONES,1 REGIS KRAH,2 SHERRIE R. TAFURI,3 AND ALAN P. WOLFFE3* Laboratory of Molecular Genetics, National Institute of Child Health and Human Development, Laboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases,2 and Laboratory of Molecular Embryology, National Institute of Child Health and Human Development, Building 6, Room 131, 3 Bethesda, Maryland 20892 Received 16 April 1992/Accepted 16 July 1992

We identify the A subunit of DNA gyrase as a cold shock protein whose synthesis is sustained following transfer of exponentially growing cultures of Escherichia coli from 37 to 10°C. After a lag period in which its synthetic rate declines, synthesis of the A subunit of DNA gyrase increases relative to that of total protein. The duration of the lag period in synthesis and the synthetic rate of the A subunit appear dependent on the synthesis of a rapidly induced cold shock protein, CS7.4. The promoter of the gyrA gene contains specific binding sites for the CS7.4 protein, suggesting that CS7.4 acts at the transcriptional level to facilitate continued A-subunit synthesis. As synthesis of the B subunit of DNA gyrase is also sustained during cold shock, we suggest that an increase in the amount of DNA gyrase per cell might occur, which would potentially adapt the cells for growth at reduced temperatures (10°C).

restriction site to position 104 and an EcoRI restriction site to position 1002 of cspA (5). The resultant HindIII-EcoRI fragment was cloned into the polylinker of plasmid pBS (Stratagene). Strains containing pJ3 are ampicillin resistant and have a small-colony phenotype indicative of overproduction of CS7.4. The gyrA (pRM378) and gyrB (pJB11) overproducing plasmids were obtained from K. Rudd. Media and bacterial growth. The rich medium used was composed of defined MOPS (morpholinepropanesulfonic acid) medium (12) supplemented with 0.4% glucose, 20 amino acids, five vitamins, and four bases (22). The concentration of carrier methionine was 0.03 mM for labeling with [35S]methionine. Cells were grown aerobically in rotaryaction water bath shakers; growth -was monitored spectrophotometrically at an optical density of 420 nm. In cultures of MG1655/pJ3, ampicillin (100 ,ug) was included in the medium to maintain the plasmid. Radioactive labeling of cultures, two-dimensional gel electrophoresis and autoradiography. Exponentially growing cultures (25 ml) of E. coli were grown at 37°C to an optical density at 420 nm of 0.40 and then shifted to 10°C. A portion (1 ml) of each culture was labeled with [35S]methionine (5 Ci/mmol, 150 ,uCi/ml) either for 5 min prior to the temperature shift or for various times as indicated after the shift. Cells were pelleted and washed with cold unlabeled medium. Extracts were treated with a mixture of DNase and RNase before denaturation of the proteins by boiling in sodium dodecyl sulfate (SDS) (2%, wt/vol) and P-mercaptoethanol (0.3 M). O'Farrell two-dimensional polyacrylamide gels were run to examine protein synthesis (13, 20, 21). Kodak XAR-5 film was used to produce autogradiograms. The exposure time was 0.5 to 2 days. Expression and purification of CS7.4. The cspA gene (5) was cloned into the BamHI site of the pET-2 expression vector (15). The insert orientation and reading frame were verified by using double-stranded dideoxy sequencing and Sequenase (United States Biochemical). Expression from

The cold shock response in Escherichia coli follows an abrupt shift in growth temperature from 37 to 10°C (8). Cold shock causes the cessation of growth for 4 to 5 h, concomitant with a severe reduction in the number of proteins synthesized. During this lag period, the relative synthesis of several cold shock proteins increases. These proteins include CS7.4, NusA, RecA, H-NS, polynucleotide phosphorylase, translation initiation factors 2p and 2a, pyruvate dehydrogenase (lipoamide), and the dihydrolipoamide acetyltransferase of pyruvate dehydrogenase (5, 8, 9). The cold shock proteins demonstrate a 2- to 10-fold increase in synthetic rate towards the end of the lag period, with the exception of CS7.4, which shows a rapid 10-fold increase in synthesis (< 1 h) and a > 100-fold increase by the time growth resumes (5, 8). The molecular mechanisms responsible for the cold shock response have not been defined. However, it has been suggested that CS7.4 is a positive transcriptional regulator of cold shock protein synthesis (9). CS7.4 has a remarkable similarity to the DNA binding domain of a family of eukaryotic nucleic acid-binding proteins, known as the Y-box transcription factors (3, 5, 18, 19, 23, 24). In this report, we provide evidence consistent with CS7.4 functioning as a transcriptional activator of another newly identified cold shock protein: the A subunit of DNA gyrase. We suggest that a number of genes encoding cold shock proteins may be coordinately regulated by CS7.4.

MATERIALS AND METHODS Bacterial strains and plasmids. The host E. coli strains for this work were derivatives of E. coli K-12: MG1655 and W3110 (2, 16). A plasmid expressing CS7.4, called pJ3, was constructed by using polymerase chain reaction to add both a HindIII *

Corresponding author. 5798

VOL. 174, 1992

THE A SUBUNIT OF DNA GYRASE IS A COLD SHOCK PROTEIN

this vector produced a fusion protein containing 13 additional amino acids at the N terminus. To obtain the CS7.4 protein, the pET-2 constructs were transformed into the BL21 host, a lambda lysogen containing an inducible T7 polymerase (17). Individual colonies were picked and grown at 37°C in superbroth (32 g of tryptone, 20 g of yeast extract, 5 g of NaCl per liter) until the culture reached an A6. of 1. Isopropyl-3-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM, and the culture was incubated for an additional 2 to 3 h. The cells were harvested and resuspended in 500 lI of lysis buffer (200 mM Tris [pH 8.0], 250 mM NaCl, 5 mM EDTA, 5 mM ethylene glycol-bis-(P3-aminoethyl ether)-N,N,N',N'-tetraacetic acid [EGTA], 10% glycerol, 1 mM N-tosyl-1-phenylalaninechloromethyl ketone [TPCK], 1 mM Na-p-tosyl1-lysine chloromethyl ketone [TLCK], 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride [PMSF] per g of cells). Lysozyme was added (1 p,g/ml) to the resuspended pellet, and the mixture was incubated on ice for 30 min. After incubation, the suspension was sonicated to lyse the bacteria. The lysate was centrifuged at 10,000 x g for 10 min. The pellet was resuspended in guanidine buffer (6 M guanidine HCl, 20 mM HEPES [N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid] [pH 8.0], 40 mM KCl) and incubated on ice for 15 min. The supernatant was dialyzed against phosphate buffer (50 mM NaH2PO4-Na2HPO4 [pH 7.2], 5 mM EDTA, 5 mM EGTA, 1 mM DTT, 1 mM PMSF). After dialysis, the sample was clarified at 30,000 x g for 10 min and proteins (including CS7.4) were precipitated with 60% (NH4)2SO4. The mixture of proteins was resuspended in Tris buffer (20 mM Tris [pH 7.2], 5 mM EDTA, 5 mM EGTA, 1 mM DTT). The solution was run over a DEAE column that had been preequilibrated with Tris buffer. Under these conditions, the CS7.4 protein was not retained on the column and was collected in the flowthrough. The protein obtained by this method was >90% pure as visualized by Coomassie blue staining following SDS-polyacrylamide gel electrophoresis. Gel mobility shift assay for specific DNA binding. Gel mobility shift assays used CS7.4 and oligonucleotides corresponding to the native gyrA promoter and to mutations of the promoter in which various ATTGG sequences are altered. One strand of each duplex oligonucleotide is shown here with ATTGG sequences or mutations underlined: wild type (three sites) 5' TACCGGCGATlVTITCGGCATTCAII

£iCACTTCTACTCCGTAATTGGCAAGACAAACGAG

TATATCAGGC[ATTGG]ATGTGAATA A AGCGT3'; zero sites, 5'TACCGGCGATmTTTCGGCATTCGAIGACACT TCTACTCCGTAGiATAGCAAGACAAAC GAGTATAT CAGGCTGITCATGTGAATAAAGCGT3'; one site, identical to the zero site oligonucleotide except for the presence of the single ATTGG site marked with parentheses in the wild-type oligonucleotide. DNA binding assays were performed as previously described (18, 19). An excess of the cold shock protein was mixed with 1 ng of the various radiolabeled duplex oligonucleotides, in the presence of 1 jig of poly(dA-dT) in a 20-pl final volume of binding buffer (50 mM Tris HCl [pH 8.0], 75 mM NaCl, 3 mM MgCl2, 5% glycerol). DNA-protein complexes were then resolved on low-ionic-strength polyacrylamide gels. The gels contained 4% polyacrylamide (0.08% bisacrylamide), 10 mM HEPES (pH 8.0), 10 mM Tris (pH 8.0), 0.1 mM EDTA, and 6% glycerol. Gels were prerun at 10 mA for 30 min in electrophoresis buffer (10 mM HEPES [pH 8.0], 0.1 mM EDTA). Samples were electrophoresed for 3 h at 200 V.

5799

RESULTS Cold shock protein CS7.4 influences the cold shock response. CS7.4 shows the most dramatic increase in relative synthesis of all the cold shock proteins (8). Following the transfer of E. coli from 37 to 10°C, the synthesis of the vast majority of proteins rapidly declines (Fig. 1, compare panels A and B) while synthesis of CS7.4 (arrow labeled D) is visible in the first hour after cold shock (a 10-fold increase; panel B) and continues to increase over the following 3 h (an additional 5- to 10-fold increase; compare panels B and C). Other cold shock proteins show smaller and slower increases in relative synthesis. For example, proteins G55.0 (arrow labeled B) and G41.2 (arrow labeled C) show only fivefold increases in synthesis between the first and fifth hours following the cold shock (8). These autoradiograms also reveal that the synthetic rate of the protein indicated by the arrow labeled A (the A subunit of DNA gyrase, see below, not previously classified as a cold shock protein) increased relative to overall protein synthesis during the lag period, along with that of the other cold shock proteins. CS7.4 has been suggested to act as a transcriptional activator of the cold shock gene hns following cold shock (9). To examine whether CS7.4 might regulate other cold shock genes, we utilized a high-copy-number plasmid (pJ3) containing the cspA gene. Strains containing this plasmid overproduced CS7.4 approximately 5-fold relative to those without it under cold shock conditions (i.e., a 5-fold increase over the normal increase of approximately 100-fold following cold shock) (in Fig. 1, CS7.4 is indicated by the arrow marked D; compare panels D and E). Increasing the level of expression of CS7.4 accentuates the cold shock response. Quantitation of the results by phosphoimaging (Table 1) indicated a further four- to eightfold increase in synthesis of the cold shock proteins (G55.0, arrow marked B; G41.2, arrow marked C; and the A subunit of DNA gyrase, arrow marked A) relative to control proteins such as elongation factor Tu in the presence of the multicopy plasmid above that normally seen on cold shock. We conclude that CS7.4 can further facilitate the synthesis of at least three cold shock proteins following the shift of exponentially growing E. coli cells from 37 to 10°C. The A subunit of DNA gyrase is a cold shock protein. Two-dimensional gel electrophoresis reveals that the protein indicated by the arrow labeled A (Fig. 1) migrates identically to the A subunit of DNA gyrase (Fig. 2, arrows, compare panels A and A'). The rate of synthesis of the A subunit clearly increases from the first to the fifth hour of cold shock (Fig. 2, arrows, compare panels B and C). Overproduction of CS7.4 (Fig. 1 and 2, panels D and E) clearly augments the synthesis of the A subunit (Table 1). We therefore conclude that the A subunit of DNA gyrase is a cold shock protein and that its synthesis under cold shock conditions might be regulated by CS7.4. The cold shock protein CS7.4 binds specifically to the gyrA promoter. Cold shock protein CS7.4 was purified as described in Materials and Methods. The purified protein (Fig. 3A) was mixed at 2- and 10-fold molar excess over the oligonucleotide containing the gyrA promoter sequences in the presence of an excess of nonspecific competitor DNA (see Materials and Methods). Protein-DNA complexes formed in this mixture were resolved by nondenaturing gel electrophoresis (Fig. 3B). Three complexes are resolved in the protein-containing samples (Fig. 3B, 3 sites). The gyrA promoter contains three ATTGG sequences, known to be the recognition elements for the eukaryotic homologs of

5800

J. BACTERIOL.

JONES ET AL.

A. 370C

5 min

0-60 min

B. 370C -> 100C

240-300 min

C. 10°C

A?~- 11't

0.4-

41!

4w

0

D. 370C

--

100C

60-120 min

9

E. 370C-i100C+pJ3

60-120min

0

Co,

FIG. 1. Protein synthesis following transfer of E. coli from 37 to 10°C, and the effect of overproduction of cold shock protein CS7.4. Protein synthesis was assayed as described in Materials and Methods. Equal numbers of radiolabeled cells were processed for each gel. (A) Synthesis during a 5-min period at 37°C; (B) synthesis during the first hour after transfer from 37 to 10°C; (C) synthesis during the fifth hour after transfer from 37 to 10°C. Exposure times for these gels were for 2 days. For both panels D and E, protein synthesis is shown for the second hour of cold shock; however, the cells used for panel E overproduced CS7.4 because of the presence of a plasmid containing the gene for CS7.4 (pJ3). Exposure times for these gels was 0.5 days. Proteins discussed in the text are labeled with arrows: A, the A subunit of DNA gyrase; B, G55.0; C, G41.2 (see reference 8); D, CS7.4.

CS7.4, the Y-box proteins (3, 18). The ATTGG sequences spaced approximately two and three integral turns of DNA apart, which would be compatible with interaction between proteins bound at these sites on the same side of the double helix. Mutation of two of these sites results in the formation of a single protein-DNA complex (Fig. 3B, 1 site) and mutation of all three eliminates specific protein-DNA interactions (Fig. 3B, 0 site). We have previously shown that competition with ATTGG sequences eliminates C7.4 protein binding to an ATTGG-containing oligonucleotide, further establishing the specific nature of this interaction (19). We conclude that the cold shock protein CS7.4 binds specifically to the gyrA promoter. This conclusion is consistent with the suggestion that CS7.4 is a positive transcriptional regulator of cold shock genes (9). Synthesis of the B subunit of DNA gyrase is sustained under cold shock conditions. Two subunits of DNA gyrase, A and B, are normally present in approximately equal amounts within the cell (11). As synthesis of the A subunit is

TABLE 1. Influence of overproduction of CS7.4 on the cold shock response

are

Radioactivity' Protein

a (MG1655)

b (MG1655/pJ3)

Synthesis rate (b/a)a

0.90 198,683 219,124 5.6 3,558,855 634,566 5.4 8,473 1,558 1.1 39,884 34,673 6.7 15,969 2,363 7.9 41,551 5,225 G55.0 4.3 22,193 5,180 G41.2 a Quantitation of radioactivity ([35S]methionine) incorporated into the proteins indicated, by phosphorimaging (Molecular Dynamics). Radiolabeling of

Elongation factor Tu

CS7.4 GyrA PNP NusA

equal numbers of cells is quantitiated in the absence (a) or presence (b) of a plasmid (pJ3) containing the gene (cspA) for CS7.4, under cold shock conditions. These were as described for Fig. 1, panel D (absence of pJ3, a), or Fig. 1, panel E (presence of pJ3, b). The relative rates of synthesis (b/a) under these conditions are also shown.

5801

THE A SUBUNIT OF DNA GYRASE IS A COLD SHOCK PROTEIN

VOL. 174, 1992

A. 37]C 5 min

,001001-1

B. 370C

-

C. 10°C 240-300 min

100C 0-60 min

-.41".

::.

Avoila 1:

.w

4w -

a

w 1;-A* O"'.

.4,6.: -W,

A'. +

.

gyr

A

D. 370C

-

100C

60-120 min

E. 37°C-'100C+pJ3

60-120 min

r 4

1.4

I

.

FIG. 2. The A subunit of DNA gyrase is a cold shock protein. Expanded views of the region around the vicinity of the protein indicated by an arrow labeled A in Fig. 1 are shown. Panels and exposure times are as described in the legend to Fig. 1. An additional panel, A', is shown, in which the cells labeled at 37°C harbor a plasmid that contains the gene for the A subunit of DNA gyrase (gyrA). The position of the A subunit is indicated by an arrow; arrows indicate the identical protein in panels A to E.

sustained during cold shock, we next examined whether synthesis of the B subunit was affected by the temperature shift from 37 to 10°C. Synthesis of the B subunit (Fig. 4, labeled R) is also increased relative to the majority of proteins during cold shock (compare panels A and B). The positions of two other cold shock proteins, F84.0 (arrow marked S) and G74.0 (arrow marked T), are indicated for reference (see also reference 8). Thus, as both the A and B subunits are synthesized during cold shock, synthesis of functional DNA gyrase will occur.

not all genes whose activity is sustained during cold shock have binding sites for CS7.4. For example, gyrB does not

have a CS7.4 binding site (1); this is consistent with the observation that overproduction of CS7.4 does not enhance synthesis of the B subunit of DNA gyrase (Fig. 1, data not

B

A

I11 7 rt

i>

* "

I. l.1A-XIG:; Li-- f--

GYR A

Al lif All1(;(,

DISCUSSION Our results demonstrate that gyrA is a member of the cold shock regulon of E. coli. The rate of synthesis of the A subunit of DNA gyrase relative to the majority of nonshock proteins is enhanced during cold shock (Fig. 1 and 2). We have investigated the possible role of the cold shock protein CS7.4 in the synthesis of A subunit during cold shock. Overexpression of CS7.4 facilitates A-subunit synthesis at 10°C (Fig. 1 and 2). Consistent with a recent report that CS7.4 is a positive regulator of hns gene expression during the cold shock response (9), we have found that CS7.4 binds to DNA sequences within the gyrA promoter regulating a positive transcriptional response to cold shock (Fig. 3). Three binding sites for CS7.4 are found in the gyrA promoter; these have the sequence ATTGG, which is similar to that bound by the eukaryotic homologs of CS7.4, the Y-box proteins (3, 18, 19, 24). As the eukaryotic proteins stimulate transcription through interaction at identical elements, we propose that this represents a remarkable functional and structural conservation through evolution. Identical binding sites for CS7.4 are found in the promoters of several other cold shock genes, including hns (9), cspA (5), recA (7), nusA (6), and polynucleotide phosphorylase (14). Furthermore,

CL Cl) CM

1

2

3

4

5

6

7

8

9

9

NOW

twvw w

0 w 10

0 Site 1 Site 3 Sites FIG. 3. Purification of cold shock protein CS7.4 and interaction with the promoter of the gyrA gene. (A) Purified CS7.4 is shown after resolution on a 15% SDS-polyacrylamide gel and staining with Coomassie Blue. Molecular weight markers are ovalbumin, 43,000; carbonic anhydrase, 29,000; ,3-lactoglobulin, 18,400; lysozyme, 14,300; bovine trypsin inhibitor, 6,200; and insulin, 3,000. (B) Mobility shifts on 4% nondenaturing acrylamide gels using purified CS7.4 and the oligonucleotides described in Materials and Methods containing three ATTGG sites, one site, and zero sites as indicated. The position of the A1TGG sites in the gyrA promoter are indicated (open boxes), as in the start site of transcription (hooked arrow). Lanes 1, 4, and 7 contain no protein; lanes 2, 5, and 8 contain a 2-fold molar excess and lanes 3, 6, and 9 contain a 10-fold molar excess of CS7.4. Binding and electrophoresis conditions are as in Materials and Methods.

5802

~

J. BACTERIOL.

JONES ET AL.

REFERENCES 1. Adachi, T., K. Mizuuchi, R. Menzel, and M. Gellert. 1984. DNA sequence and transcription of the region upstream of the E. coli gyrB gene. Nucleic Acids Res. 12:6389-6396. 2. Bachmann, B. 1987. Derivatives and genotypes of some mutant

A. 370C 5 min. R

.W:

-10. *.

3.

B. 10C 240-300 min.

4.

5. A

6. T

7. 8.

synthesized during synthesis was assayed as described in Materials and Methods. (A) Synthesis during a 5-mmn period at 37'C; (B) synthesis during the fifth hour following transfer from 37 to 10'C. Proteins discussed in the text are indicated by arrows labeled R, the FIG. 4. The B subunit of DNA gyrase is also

cold shock. Protein

A, the A subunit of DNA gyrase; F84.0; T, G74.0 (see reference 8). The position of the B subunit of

B subunit of DNA gyrase;

DNA gyrase

was

ascertained

protein because of the gene (pJB111, obtained

5,

of strains overproducing the plasmid containing the gyrB Rudd).

the

by

10.

use

presence of from K.

9.

a

11. 12.

CS7.4

shown). enhancing transcription

under cold shock

general role in conditions through

13.

binding at the

ATTGG element found in several of

14.

We suggest that

common

these diverse promoters

might

have

(see also reference 9). It is nevertheproteins might be involved in tran-

possible that other scriptional stimulation, since CS7.4 has directly on transcriptional initiation by Sustained synthesis of the A and

less

a

not been shown to act

RNA

polymerase.

B subunits of DNA

15.

shock response is consistent with the biological mechanisms required for the recovery of growth at low temperatures. Increased amounts of functional enzyme ought to be generated by sustained synthesis of the subunits (Fig. 4); this may be necessary to compensate for reduced

16.

gyrase during the

cold

enzymatic activity at low temperature. It to maintain the level of bacterial DNA

is

clearly important

supercoiling because

of its

importance

in

many

regulated

17.

processes

such

18.

as

recombination, and replication (10, 11). Goldstein and Drlica (4) have shown that it takes several hours for the superhelicity of plasmids following temperature reduc-

transcription,

19.

a

tion from 37 to 170C to reach

equilibrium.

Such

a

lag period

would be consistent with the time taken for DNA gyrase

synthesis

to

be

increased following

changes in DNA due to changes contribute

to

cold shock. Transient

superhelicity following

temperature

helical twist of DNA the cold shock response. in

20.

the

also

shifts

21.

might

22. 23.

ACKNOWLEDGMENTS

We thank Martin Gellert for Mike Cashel for support.

and

preparing the manuscript.

a

critical We

are

reading of grateful

the

to

manuscript

Thuy

Vo

for

24.

derivatives of Escherichia coli K-12, p. 1190-1219. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Eschenichia coli and Salmonella typhimuium: cellular and molecular biology, vol. 2. American Society for Microbiology, Washington, D.C. Didier, D. K., J. Schiffenbauer, S. L. Woulfe, M. Zaceis, and B. D. Schwartz. 1988. Characterization of the cDNA encoding a protein binding to the major histocompatibility complex class II Y box. Proc. Natl. Acad. Sci. USA 85:283-287. Goldstein, J., and K. Drlica. 1984. Regulation of bacterial DNA supercoiling: plasmid linking numbers vary with growth temperature. Proc. Natl. Acad. Sci. USA 81:4046-4050. Goldstein, J., N. S. Poliitt, and M. Inouye. 1990. Major cold shock protein of Eschenchia coli. Proc. Natl. Acad. Sci. USA 87:283-287. Granston, A. E., D. L. Thompson, and D. I. Friedman. 1990. Identification of a second promoter for the metY-nusA-infB operon of Eschenichia coli. J. Bacteriol. 172:2336-2342. Horii, T., T. Ogawa, and H. Ogawa. 1980. Organization ofthe recA gene of Eschenchia coli. Proc. Natl. Acad. Sci. USA 77:313-317. Jones, P. G., R. A. Van Bogelen, and F. C. Neidhardt. 1987. Induction of proteins in response to low temperature in Escherichia coli. J. Bacteriol. 169:2092-2095. La Teana, A., A. Bandi, M. Falconi, R. Sprino, C. L. Pon, and C. 0. Gualerzi. 1991. Identification of a cold shock transcriptional enhancer of the Escherichia coli gene encoding nucleoid protein H-NS. Proc. Natl. Acad. Sci. USA 88:10907-10911. Menzel, R., and M. Gellert. 1983. Regulation of the genes for E. coli DNA gyrase: homeostatic control of DNA supercoiling. Cell 34:105-113. Menzel, R., and M. Gellert. 1987. Modulation of transcription by DNA supercoiling: a deletion analysis of the Escherichia coli gyrA and gyrB promoters. Proc. Natl. Acad. Sci. USA 84:4185-4189. Neidhardt, F. C., P. L. Bloch, and D. F. Smith. 1974. Culture medium for enterobacteria. J. Bacteriol. 119:736-747. O'Farrell, P. H. 1975. High resolution two-dimensional electrophoresis of proteins. J. Biol. Chem. 250:4007-4021. Regnier, P., M. Grunberg-Manago, and C. Portier. 1987. Nucleotide sequence of the Php gene of Escherichia coli encoding polynucleotide phosphorylase: homology of the primary structure of the protein with the RNA-binding domain of ribosomal protein S1. J. Biol. Chem. 262:63-68. Rosenberg, A. H., B. N. Lade, D.-S. Chui, S.-W. Lin, J. J. Dunn, and F. W. Studier. 1987. Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 56:125-135. Smith, M. W., and F. C. Neidhardt. 1983. Proteins induced by anaerobiosis in Escherichia coli. J. Bacteriol. 154:336-343. Studier, F. W., and B. A. Moffat. 1986. Use of bacteriophage T7 RNA polymerase to direct selective high level expression of cloned genes. J. Mol. Biol. 189:113-130. Tafuri, S. R., and A. P. Wolffe. 1990. Xenopus Y-box transcription factors: molecular cloning, functional analysis and developmental regulation. Proc. Natl. Acad. Sci. USA 87:9028-9032. Tafuri, S. R., and A. P. Wolffe. 1992. DNA binding, multimerization and transcription stimulation by the Xenopus Y box proteins in vitro. New Biol. 4:349-359. Van Bogelen, R. A., M. A. Acton, and F. C. Neidhardt. 1987. Induction of the heat shock regulon does not produce thermotolerance in Escherichia coli. Genes Dev. 1:525-531. Van Bogelen, R. A., and F. C. Neidhardt. 1990. Ribozymes as sensors of heat and cold shock in Escherichia coli. Proc. Natl. Acad. Sci. USA 87:5589-5593. Wanner, B. L., R. Kodaira, and F. C. Neidhardt. 1977. Physiological regulation of a decontrolled lac operon. J. Bacteriol. 130:212-222. Wistow, G. 1990. Cold shock and DNA binding. Nature (London) 344:823-824. Wolffe, A. P., S. Tafuri, M. Ranjan, and M. Familari. 1992. The Y-box factors: a family of nucleic acid binding proteins conserved from Escherichia coli to man. New Biol. 4:290-298.