Molecular Microbiology (1992) 6(12). 1617-1624

gyrB mutations which confer coumarin resistance also affect DNA supercoiling and ATP hydrolysis by Escherichia coii DNA gyrase Asuncidn Contreras^ and Anthony Maxwett* Department of Biochemistry, University of Leicester, Leicester LE1 7RH, UK. Summary Coumarins are inhibitors of the ATP hydroiysis and DNA supercoiling reactions catalysed by DNA gyrase. Their target is the B subunit of gyrase (GyrB), encoded by the gyrB gene. The exact mode and site of action of the drugs is unknown. We have identified four mutations conferring coumarin resistance to Escherichia coli: Arg-136 to Cys, His or Ser and Gly164 to Val. In vitro, the ATPase and supercoiling activities of the mutant GyrB proteins are reduced relative to the wild-type enzyme and show resistance to the coumarin antibiotics. Significant differences in the susceptibility of mutant GyrB proteins to inhibition by either chtorobiocin and novobiocin or coumermycin have been found, suggesting wider contacts between coumermycin and GyrB. We discuss the significance of Arg-136 and Gly-164 in relation to the notion that coumarin drugs act as competitive inhibitors of the ATPase reaction. Introduction DNA gyrase is the type II topoisomerase from bacteria which catalyses the introduction of negative supercoils into DNA using the free energy derived from ATP hydrolysis (for reviews, see Gellert, 1981; Wang, 1985; Reece and Maxwell, 1991). The en2yme from Escherichia coli consists of two proteins, A and B, of molecular masses 97 and 90 kDa respectively. The active enzyme is an A2B2 complex. The gyrase subunits are encoded by the gyrA and gyrB genes of E. coli, which have been cloned and sequenced (Swanberg and Wang, 1987; Yamagishi etal., 1986; Mizuuchi etal., 1984; Hallett efai, 1990). Mechanistic studies of gyrase have revealed the steps that are likely to be involved in the supercoiiing process

Received 12 February, 1992; revised and accepted 9 March, 1992. tPresent address: Unictad de Gen6tica Molecular, Hospital Ram6n y Cajal, Madrid 28034, Spain. 'For correspondence. Tel. (0533) 523464; Fax (0533)523369,

(reviewed by Maxwell and Gellert, 1986; Reece and Maxwell, 1991). The enzyme binds to DNA and forms a complex in which approximately 120 bp of DNA are wrapped around the protein. The wrapped DNA is cleaved in both strands by the formation of covalent bonds between the A proteins and the DNA. A segment of DNA is then passed through this double-stranded break which then may be resealed. This process leads to a change in linking number of the DNA of - 2 , i.e. the introduction of two negative superhelical turns. Catalytic supercoiling requires the hydroiysis of ATP and it is thought that two ATP molecules are hydrolysed per cycle of the supercoiling reaction (Sugino and Cozzarelli, 1980; Maxwell et ai. 1986; Maxwell and Gellert, 1986; Bates and Maxwell, 1989). In the presence of the nonhydrolysable ATP analogue ADPNP (5'-adenyiyl-li-7 imidodiphosphate). limited supercoiling by gyrase can be achieved (Sugino etai, 1978), suggesting that nucleotide binding can promote one round of supercoiling but that hydrolysis is required for enzyme turnover. In the absence of nucleotide, gyrase can relax negatively supercoiled DNA (Gellert e/a/., 1977; Sugino e/a/., 1977). DNA gyrase is the target of a number of antibacterial agents. The best known of these are the quinolone and coumarin groups of drugs, which have been shown to inhibit the DNA supercoiling reaction in vitro (Gellert efal., 1976; 1977; Sugino etai. 1977). Recently, two antibacterials, cinodine and microcin, which fall outside the quinolone and coumarin classes, have been reported to have DNA gyrase as their target (Osburne et ai. 1990; Vizan et ai, 1991). The quinolone drugs interfere with the DNA breakage-reunion aspects of the gyrase supercoiling reaction and are thought to act at the A subunit (reviewed by Reece and Maxwell, 1991). The coumarins (e.g. novobiocin. coumermycin A, and chlorobiocin. see Fig. 1) are antibiotics isolated from Streptomyces species (Hoeksema etai, 1955; Kawaguchi etai. 1965; Ninet et ai, 1972). E. CO//mutations conferring resistance to high concentrations of coumarins map at gyrB. formerly cou (Gellert et ai. 1976; Ryan, 1976; Orr et ai. 1979). Recently, mutations leading to novobiocin resistance in Haloferax (Holmes and Dyall-Smith, 1991) and to coumermycin resistance in E. coli (del Castillo et ai, 1991) have been identified at the amino acid level. Three independently isolated coumarin-resistance mutations

1618

A. Contreras and A. hAaxwell Fig. 1. Structures of coumahn drugs.

Novobiocin

have been found at Arg-136 in GyrB of E. coli. Coumarins have also been found to inhibit the ATPase reaction of gyrase in vitro and their target has been shown to be the B subunit (Mizuuchi et ai. 1978; Staudenbauer and Orr. 1981). It has been suggested from steady-state kinetic studies that they act as competitive inhibitors of the ATPase reaction (Sugino et ai. 1978; Sugino and Cozzarelii, 1980), but other work has raised doubts about this suggestion (Maxwell etai, 1985; Reece and Maxwell, 1991). Recently, the crystal structure of an AAterminal fragment of the DNA gyrase B protein complexed with ADPNP has been solved at 2.5 A resolution (Wigley efal, 1991). This fragment has been shown to hydrolyse ATP and bind coumarin drugs (J. A. Ali, A. P. Jackson, A. J. Howells and A. Maxwell, in preparation). The structure now raises the possibility of analysing the interaction between gyrase and coumarin drugs in some detail. As a first step towards this goal, we have identified amino acid residues in the gyrase B protein which are involved in coumarin resistance in E. coli, and analysed the effects of these substitutions on DNA gyrase activity both in vivo and in vitro.

Results Analysis of mutations conferring coumarin resistance Previous studies have shown that the W-terminal portion of the gyrase B protein Is responsible for its ATPase activity and contains the binding site of the coumarin drugs {Brown et ai, 1979; Adachi et ai. 1987; J. Ali ef ai, in

preparation). We have isolated spontaneous coumermycin-resistant mutants of E. co//and determined the DNA sequence corresponding to the W-terminal region of the DNA gyrase B protein. We have also included in this study strains LE316 (Orr ef ai, 1979), a spontaneous chlorobiocin-resistant thermosensitive {ts) mutant, and N4177 (Menzel and Gellert. 1983), a ts coumermycin-resistant double mutant obtained by nitrosoguanidine mutagenesis. In both strains the mutations map at gyrB. Determination of the DNA sequences of the 5"-end of the gyrB genes from these strains revealed the following differences when compared with the wild-type sequence (Yamagishi efai. 1986; Adachi ef ai, 1987); a GC-»AT transition at position 406 (Arg136-*Cys) in strains CC2. CC4. CC6. CC8 and N4177; a GC-*TA transversion at position 406 (Arg-136-tSer) in CC3 and CC7; a CG^TA transition at position 407 (Arg136^iHis) in CCI and CC5; a CG->AT transversion at position 491 (Gly-164->Val) in LE316 and a GC->AT transition at position 511 (Pro-171^Ser) in N4177. These results confirm the genetic analyses which suggested that the ts and coumarin-resistant phenotypes are the result of a single mutation in LE316 (Orr etai, 1979) and two independent changes in N4177 (Menzel and Gellert, 1983). Thus we have found that nine independent mutations responsible for coumermycin resistance alter Arg-136. In addition, del Castillo et ai (1991) have reported another three independent mutations at the same residue (Arg136->Leu or Cys). These results suggest that Arg-136 is the main residue in the E. coli gyrase & protein which can be mutated to confer resistance to coumermycin without significantly impairing gyrase activity. The mutation Gly164->Vai does not confer a high level of resistance to

Coumarin-resistance mutations in gyrase

Fig. 2. In wVo supercoiling of plasmid DNA irom wild-type and coumermycin-resistant derivatives. Isogenic strains carrying plasmid pUC18 were grown in LB with ampicillin to 00595 = 0.4, the plasmid DNA isolated and run on 0.8% agarose gels containing lOjig ml"' chloroquine. Lane 1 is plasmid DNA from HBIOI. lane 2 is from CC5. lane 3 is from CC6, and lane 4 is from CC7.

coumermycin. In addition, LE316 (which carries the mutation Gly-164->Vai) has been shown to be affected in a number of in t^/Vo functions {Orr et ai, 1979; Fairweather et ai. 1980), and in our hands its rate of growth, even at permissive temperatures, is iower than that of the isogenic strain LE234 {data not shown). We have found no differences in the growth rates of strains CC1 to CC8 compared with the parental strain HB101 (data not shown). To determine whether GyrB mutations at Arg-136 have an effect on the level of supercoiiing in vivo, plasmid pUC18 was transformed into strains HB101, CC5, CC6 and CC7. plasmid DNA isolated from each of them, and its level of supercoiiing analysed by gel electrophoresis in the presence of chloroquine (Fig. 2). Plasmid DNA from all three mutants, when analysed on a series of chloroquine-containing gels, consistently showed a reduction in the level of supercoiiing compared with the wild type. This result implies that mutations at Arg-136 do have an effect on gyrase activity (see below).

1619

reduced sensitivity to chlorobiocin and novobiocin; the concentration of drug required to inhibit growth by 50% (ICso) was about 10-fold higher in the mutants than in HBI01. The mutation Gly-164->\/al mutation also confers a high level of resistance to these two drugs (compare LE316 with LE234 in Table 1), However, there are significant differences in the susceptibilities of the mutant strains to coumermycin. The strain bearing the mutation Arg-136-^His is less resistant (four- to fivefold) to this drug than the strains with other mutations at this position, which have IC50 values at least 20-fold greater than that of the wild type (HB101), The mutation Gly-164-^Val confers only a twofold increase in resistance to coumermycin compared with the corresponding wild type (LE234). The latter result explains the discrepancies between different authors when this strain is referred to as coumermycinresistant (Orr etai, 1979), or coumermycin-sensitive (del Castillo era/., 1991).

Overproduction of gyrase B proteins and analysis of their enzymic activities In order to produce the coumarin-resistant GyrB proteins In large amounts, the mutant gyrS genes were substituted forthe wild type in plasmid pAG111 (Hallett e/a/.. 1990), GyrBvai-164 was not accumulated to a significant level, as judged by SDS-polyacrylamide gel electrophoresis (PAGE), when strain JMiO9(pCC2O9) was grown at 30°C under conditions which yield the wild-type GyrB as 40% of total cell protein (Hallett et ai. 1990). Similar observations were made for JM109(pCC210) which makes GyrBcys.i36. ser-171. suggesting that these two ts mutations make GyrB more labile even at the permissive temperatures. In contrast, all three strains overproducing GyrB with substitutions at Arg-136 accumulate the B protein to the same extent as the wild-type protein (as judged by SDS-PAGE; data not shown). This suggests that these mutations do not have a severe impact on protein structure, and we have focussed subsequent enzymic studies on these proteins. In standard DNA gyrase supercoiiing assays all three

In vivo inhibition o/gyrB mutants by different coumarins Mutations conferring resistance to different coumarins map at the same locus (cou or gyrB), and the same general mechanism Is invoked to explain the inhibition of gyrase by the different coumarins. However, it is not known whether there are differences among the coumarins with respect to specific interactions with GyrB. As an approach to this problem we analysed the effect of the different coumarins on the growth of the strains bearing mutations conferring resistance to coumarins (Table 1). All three strains carrying mutations at Arg-136 showed

Table 1. IC50 values of coumarin drugs for wild-type and coumarinresistant E. CO//strains. IC50 (Jig mr^) Strains HB101 (GyrB) CC5 (GyrBH,s.,36) CC6 {GyrBcy^.,36) CC7(GyrB.^,.,36) LE234 (GyrB) LE316(GyrB,.,.,6.)

coumermycin

Chlorobiocin

6 29

S

133

125

80 B3

6 12

14 100

novobiocin

50 580 600 660

660 >2000

1620

A. Contreras and A. f\Aaxwell 1

Time (sees)

I

2

I

3

10 20 30 40 so 60 1020 3040 SO 60 10 20 30 405060

OC Rel

ATPase activities for the different mutants, with 136 being the least active protein and GyrBcys. 136 the most active. In the absence of ATP, all four gyrase proteins are capable of relaxing supercoiled DNA with equal efficiency (data not shown), implying that the mutant proteins retain the ability to form active A^Bj complexes and to carry out the DNA breakage-reunion reaction, and that the mutations only affect the ATP-driven reactions of gyrase.

SC

Effects of novobiocin and coumermycin on the supercoiiing and ATPase activities of the mutant proteins

SC

Fig. 3. Effect ot gyrSmutations on supercoiiing by gyrase and susceptibility to coumarins. Supercoiiing reactions were earned out as described in the Experimental procedures. A. Wild-type gyrase: 1. no drugs; 2, novobiocin (100 nM); 3, coumermycin (50 nM). B. Gyrase formed with GyrBc)».i3e; 1. no drugs; 2, novobiocin 1 jiM; 3, coumermycin (500 nM).

mutant B proteins (GyrBcya-iae- GyrBHis.ne and 136)- when comptexed with wild-type GyrA. show a decrease in activity relative to wild-type GyrB under the same conditions (Fig. 3 and Table 2). In addition, these complexes also show impaired ATPase activity with respect to the wild type. Although in relative terms the supercoiiing activities of the mutant proteins are more severely affected than their ATPase activities (perhaps reflecting the higher complexity of the process), there is a clear correlation between the level of supercoiiing and Table 2. DNA supercoiiing and ATP hydrolysis by wild-type and coumarjn-resistanl GyrB proteins. Supercoiiing

Protein GyrB GyrBcys-136 GyrBser 136

ATPase

IC«(nM) ICso(nM) Relative Relative activity novobiocin coumermycin activity novobiocin 100 13 9 6

100 1000 1000 1000

50 500 250 500

100 48 26 21

90 1400 700 4300

The effect of novobiocin and coumermycin on the supercoiling activities of wild-type and mutant GyrB proteins (complexed with GyrA) was examined (Fig. 3 and Table 2). For all three mutants {GyrBcys-iae- GyrBH,s-i36GyrBser 136). the amount of novobiocin required to inhibit the supercoiiing reaction by 50% (IC50) was approximately 10 times that for the wild-type B complex. For example. Fig. 3 shows the DNA supercoiiing activity of gyrase containing GyrB or GyrBcys-136 and the effect of coumarin drugs on these reactions. Differences among the mutant proteins were observed in the presence of coumermycin; the IC50 values for GyrBcys-136 and GyrBser 136 were ten times that of the wild type, while the IC50 for GyrBnis 136 was only five times that of the wild type. In all cases (wild-type and mutant proteins) at least twice as much novobiocin as coumermycin was required to achieve the same inhibition of supercoiiing. The effect of novobiocin on the ATPase activities of wild-type and mutant proteins complexed with GyrA and DNA was also investigated (Fig. 4 and Table 2), The IC50 values are in broad agreement with those derived from the supercoiiing reaction, and show that the mutant B proteins are less sensitive to the inhibitory effect of novobiocin, requiring 10- to 50-fold more drug to inhibit the ATPase activity than does the wild-type protein. We believe that differences in the IC50 between different mutants are probably a consequence of the difficulty of measuring the intrinsically low ATPase activity of gyrase, further reduced in the case of mutant proteins, and that the figures are not significantly different from those measured in the more sensitive supercoiiing assay. Discussion The 43 kDa W-terminal fragment of the B subunit of DNA gyrase hydrolyses ATP. binds coumarins, and forms dimers in the presence of the non-hydrolysable ATP analogue ADPNP (J, Ali et ai, in preparation; Wigley et ai, 1991). Despite the detailed structural information available for this protein, very little is known about the site of action and mechanism by which coumarin drugs inhibit the ATP-dependent reactions catalysed by gyrase. We

Coumarin-resistance mutations in gyrase

1621

analysed here accumulated to the same level as wild-type GyrB. Engineering of more conservative substitutions at Gly-164 may provide further data concerning coumarin-GyrB interactions. Chlorobiocin-novobiocin versus coumermycin

1

100

10

Novoblodn concentration (nM) F i g . 4 . Edect of gyrB mutations on th9 sensitivity to novobiocin of the

ATPase reaction of gyrase. The rate of ATP hydrolysis was determined as described in the Experimental procedures. ATPase activity is expressed relative to the rate in the absence ot drug (100%).

have identified residues responsible for in vivo resistance to coumarin drugs and analysed the effect of these substitutions both in vivo and in vitro, with the aim of targeting structural and functional features of GyrB involved in the interaction between coumarin drugs and GyrB. Arg-136 and Gly-164 are involved In coumarin interaction All mutations analysed in this work which confer coumarin resistance to E co//were localized, as expected, in the Nterminal part of GyrB, All nine independently isolated coumermycin-resistant strains have substitutions affecting Arg-136. In addition, del Castillo etal. (1991) have previously reported three independent substitutions conferring resistance to coumermycin which also affect Arg136 (mutations to Leu or Cys). In complete agreement with the biochemical evidence signalling this region as the target for coumarins, del Castillo etal. (1991) have shown that overproduction of a polypeptide retaining the first 500 amino acids of GyrB confers resistance to coumermycin in a wild-type strain, while the same construct made from a coumermycin-resistant strain does not, suggesting a clear correlation between binding of coumermycin by GyrB and inhibition of gyrase activity by the drug. The titration of coumermycin by wild type truncated GyrB indicates that very tight binding of coumarins to GyrB also occurs in vivo. Taken together, these data show that Arg136 is the main residue that can be mutated in vivo to produce an active GyrB with greatly reduced affinity for coumermycin. The other amino acid residue {conferring chlorobiocin resistance) identified in this work is Gly-164; its mutation to Val has a greater impact on GyrB stability and activity, and the mutant protein could not be overproduced, while the proteins with substitutions at Arg-136

Analysis of the susceptibility of gyrB mutants to different coumarin drugs shows that strains carrying GyrBHJs-ise and GyrBvai.i36 'differentiate' between chlorobiocinnovobiocin and coumermycin. Based on these findings we suggest the analysis of chlorobiocin-resistant mutants (novobiocin is not suitable because of permeability barriers and the high basal level of resistance of most E. coli strains) as a means of identifying further residues involved in coumarin interactions. Coumermycin is known to be a more potent inhibitor of the ATPase activity of GyrB than novobiocin and chlorobiocin (Gellert etai.. 1976; Staudenbauer and Orr, 1981). In addition, our results show (Fig, 3 and Table 2) that twice as much novobiocin than coumermycin is needed to inhibit supercoiiing activity. These data suggest that novobiocin may bind to the GyrB monomer while coumermycin may bind to the GyrB dimer or to two GyrB monomers, an idea consistent with the pseudo-dimeric structure of coumermycin (see Fig. 1), Differences in the susceptibility of GyrB mutants to the inhibition mediated by coumermycin and novobiocin may also reflect different modes of binding of the drugs. Our results from in vivo susceptibility to different coumarins and in vitro inhibition of supercoiiing by novobiocin and coumermycin suggest that all the mutant proteins have greatly reduced ability to bind chlorobiocin and novobiocin while two proteins, GyrBvaii64and GyrBHis.i36- show only modest reductions in their ability to bind coumermycin. This may indicate that coumermycin is capable of wider contacts than chlorobiocin-novobiocin with residues of GyrB. Coumarin binding and ATP-binding sites Arg-136 and Gly-164, the two residues shown to be involved in coumarin resistance in E. coli lie outside the ATP-binding site of GyrB (Fig, 5). In E. coli. the guanidinium group of Arg-136 forms an H-bond with the main chain carbony! group of Tyr-5, the only residue among those in the proposed ATP-binding site belonging to a different potypeptide chain (Wigley et al., 1991), This bond may be important in stabilizing interactions between monomers. Arg-136 and Tyr-5 are present in all GyrB proteins analysed to date. Arg-136 also appears to be involved in coumarin resistance in the halophilic archaebacterium Haloferax, in which three mutations have been reported in a novobiocin-resistant strain (Holmes and Dyall-Smith, 1991): these are Asp-81-»Gly,Ser-121^Thr

1622

A. Contreras and A. Maxwell

Fig. 5. Schematic diagram ot the GyrB W-terminal dimer showing CPK represenlations ot the residues discussed in this work. The bound ADPNP ts shown as a 'ball and stick' representation. For clarity the two subunits are depicted in different shades of grey. The program used was MOLSCRiPT (Kraulis, 1991).

and Arg-136-»His (residue numbers are as in E. coli). Given the extensive homotogies of GyrB proteins between phylogenetically distant bacteria, we can assume that His-136 is responsible for the novobiocinresistant phenotype in Haloferax. The significance of the two other mutations (Asp-81->Gly and Ser-121-^Thr) is not clear. The location of these residues in the ATPase domain of GyrB (see Fig. 5) suggests that Gly-81 and/or Thr-121 substitutions in Haloferax are responsible for either further increasing the level of resistance to novobiocin provided by His-136 and/or they provide compensatory mutations restoring some of the in vivo altered functions of GyrB. Both in vivo and in vitro data obtained in this work indicate that mutations which reduce the binding of coumarins to GyrB have an effect on ATPase and supercoiling activity by gyrase. Althought mutant strains with substitutions at Arg-136 grow normally, plasmid DNA isolated from these strains is less negatively supercoiled than DNA isolated from the wild type. In vitro, only reactions requiring ATP hydrolysis were affected, as shown by the fact that all three mutant proteins exhibited normal relaxation activity. It is not clear what features of the Arg side chain are important to maintain full catalytic activity of the enzyme. The presence of a residue with a potential positive charge (His-136) at that position is not sufficient to maintain maximum activity and does not result in a more active enzyme than the one having Cys at the same

position. Substitution to Ser further decreases the catalytic activity of GyrB. The reduction in supercoiiing activity by different mutations correlates with the decrease in ATPase activity. In all cases, supercoiiing was more severely impaired than ATPase activity when compared with activity by wild-type protein. This may be attributable to a reduced efficiency in the coupling between ATP hydrolysis and supercoiiing by the mutant proteins. Recent results from steady-state kinetics experiments (J. Ali et al., in preparation) are consistent with the idea of a non-competitive mechanism for the inhibition of the ATPase activity of GyrB by coumarin drugs. The data presented here also support this view. Because of the need for an active gyrase imposed on the mutations analysed here, we cannot rule out the possibility that important residues for coumarin interaction in the ATP-binding site have been missed. Nevertheless the presence of a 'hotspot' of coumarin-resistant mutations on the surface of the protein and clearly outside the ATP-binding site is difficult to reconcile with the proposal of a common binding site. In addition, the lack of strong structural resemblance between ATP and coumarin drugs argues against a competitive mechanism. Further experimentation is needed to clarify the precise interactions between GyrB and coumarin drugs. Experimental procedures Bacterial strains and plasmids The bacterial strains and plasmids used in this work are listed in Table 3.

Bacteriological methods LurJa broth and M9 minimal medium were prepared as described by Maniatis et al. (1982); when required, amino Table 3, Bacterial strains and plasmids. Strain

Relevant features

Source/reference

Strain HB101 GyrB CC1.CC5 HB101 GyrBH,9-,36 CC2. CC4, CC6, CCS HB101 GyrBc,6-,3e CC3. CC7 HB101 GyrBs^ 136 LE234 Gyre LE316 LE234 GyrBvai-iM N4177 t^yrBc^.iae. sor i r i JM109

Bolivar and Bachman (1979) This work This work This work Orr eraA( 1979) Orr e( a/, (1979) Menze) and Gelleri (1983) Yanisch-Perron etal. (1985)

Piasmid pAGlii pCC205 pCC206 pCC207 pCC209 pCC210 pUCIB pBR322

Hallett etal,, 1990 This work This work This work This work This work Norrander ef a/, (1983) Bolivar era/. (1977)

GyrB GyrBH«,M GyrBcy,.,36 GyrBse,-,36 GyrBva,.,M GyrBcys 136. Sol 171

Coumarin-resistance mutations in gyrase acids and thiamine were added to final concentrations of 20 |ig ml"^ and 10 jjg ml"', respectively. For strains harbouring plasmids pUC18 and p A G I I I and derivatives, 50 ^ig ml"^ ampicillin was added to the growth media. £. coli HBI 01 and derived strains were grown at 37''C; LE234, LE3t6 and N4177 were grown at 3O''C. For the determination of 50% inhibitory concentrations, bacteria were grown overnight on M9 minimal medium, then diluted 1/10"* into the same medium and aliquoted In microtltre plates containing two told serial dilutions of antibiotics. After incubation for 24 h, the absorbance at 570 nm was determined. Values given are the means of two to four independent experiments. To isolate coumermycin-resistant strains, approximately 10'° cells from overnight cultures of HB101 were plated on minimal agar media containing 15 ng ml"^ coumermycin. Eight independent isolates were selected for further analysis {strains CC1 to CC8).

Cloning of coumarin-resistant gyrB genes Chromosomal DNA was prepared from strains CC1 to CC8 and the ts strains LE316 and N4177 as described by Ardeshir et ai (1981), The DNA encoding the first 424 amino acids of the gyrase B protein was amplified by the polymerase chain reaction (PCR) using Vent polymerase (New England Biolabs) according to the manufacturer's instructions. The DNA primers used were 5 TGAGCGAGAAACGTTGATGTCG and 5'CTTCCACCAGGTACAGTTCGG (kindly made by D. Langton. University of Leicester, UK). After amplification, the PCR products (1289 bp) were digested with EcoRI (a gift of S. E. Halford, University of Bristol, UK) and Ss/BI (New England Biolabs) and the resulting 538 bp fragments were substituted for the equivalent fragment in plasmid p A G I I l {Hallett et al., 1990). The resulting plasmids were named pCC201 to pCC208 (corresponding to strains CC1 to CC8), pCC209 {corresponding to LE316), and pCC210 (corresponding to N4177), Plasmid DNA was isolated by the method of Kraft et al. {1988), and ihe sequence of the substituted DNA determined using Sequenase (United States Biochemicais).

DNA gyrase assays DNA supercoiiing and relaxation assays were carried out as described by Reece and Maxwell {1989), Relative supercoiiing activities of wild-type and mutant enzymes were determined from time courses. Standard supercoiiing reactions (300 MO containing 100 nM gyrase (AgB?) and relaxed pBR322 DNA (10 ng ml"^) were incubated at 25°C. Samples {30 ji') were withdrawn at various times and analysed by gel electrophoresis. To determine IC50 values of coumarin antibiotics, the amount of drug required to reduce the rate of supercoiiing by 50%, compared with a no-drug control, was determined. ATPase assays were carried out using a pyruvate kinase/ lactate dehydrogenase-linked assay (Tamura and Gellert, 1990), Determination of the amount of coumarin drug required to inhibit the ATPase reaction by 50% was carried out as follows. Reactions {150 j.il) containing 100 nM gyrase and 10 ^g of linear pBR322 DNA were incubated at 25°C. Reactions were initiated by the addition of ATP (imM) and the reaction velocity determined. Coumarin drugs were added to the same reaction mixture and the change in reaction velocity measured- The

1623

amount of drug required to inhibit the ATPase reaction by 50% was determined graphically {see Fig. 3),

Other methods DNA gyrase was purified as described previously (Hallett etai. 1990); gyrase A protein was a gift of P, Hallelt {this laboratory); wild-type and coumarin-resistant B proteins were partially purified up to the Heparin-Sepharose step (Hallett et ai, 1990), Protein concentrations were determined by the methods of Bradford (1976) using bovine serum albumin as a standard and using the correction factors of 1.43 and 0.71 for Ihe A and B proteins, respectively (M. Gellert. personal communication), to determine absolute concentrations. Where indicated, DNA samples were analysed on agarose gels containing chloroquine {Shure et ai. 1977). Protein sequences were obtained from the ISIS non-redundant data base. Chlorobiocin was a gift from Rhone-Poulenc Rorer, All other antibiotics used were purchased from Sigma.

Acknowledgements We thank Janid Ali and Alison Howetis for advice and materials, Andy Bates and Dale Wigley for carefully reading the manuscript, and Mike Sutcliffe for assistance with computer graphics. We also thank Marty Gellert and Eli Orr for providing strains, and the Wellcome Trust for financial support, Anthony Maxwell is a Lister Institute Jenner Fellow.

References AdachJ, T., Mizuuchi, M-, Robinson, E.A.. Appella, E.. O'Dea, M.H,, Gellert, M., and Mizuuchi. K. (1987) DNA sequence of the E. coli gyrB gene: application of a new sequencing strategy, NucI Acids fles15: 771-784. Ardeshir, P., Higgins, C.F., and Ames. G.F.-L. {1981) Physical map of the Salmonella typhimurium histidine transport operon: correlation with the genetic map. J Bacteriol 147: 401-409. Bates, A,D. and Maxwell, A. {1989) DNA gyrase can supercoil DNA circles as small as 174 base pairs, EMBO J 8: 1861-1866. Bolivar, F., and Bachman, K. {1979) Plasmids of E. coli as cloning vectors, fvieth Enzymol 68: 245-280. Bolivar, F., Rodriguez. R.L,, Greene, P.J., Bettach, M.C. Heyneker, H,L, Boyer, H,W., Crosa, J.H., and Falkow, S. (1977) Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2: 95-113, Bradford, M.M. (1976) A rapid and sensitive method for Ihe quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254. Brown, P.O., Peebles, G.R., and Cozzarrell, N.R, (1979) A topoisomerase from Escherichia coli related to DNA gyrase, Proc NatI Acad Sci USA 76: 6110-6114, del Castillo, I,. Vizan, J.L., Rodriguez-Sainz, M.C, and Moreno, F. {1991) An unusual mechanism for resistance to the antibiotic coumermycin A,, Proc NatI Acad Sci USA 88: 8860-8864.

1624

A. Contreras and A. Maxweli

Fairweather. N.F.. Orr. E.. and Holland, I.B, (1980) Inhibition of deoxyribonucleic acid gyrase: effects on nucleic acid synthesis and cell division in Escherichia co//K-12. J Bacteria! ^A2: 153-161. Geilert, M. (1981) DNA topoisomerases. Ar\r)u Rev Biochem 50:879-910. Geilert, M.. ODea, M.H., Itoh, T.. and Tomizawa. J. (1976) Novobiocin and coumermycin inhibit DNA supercoiling catalysed by DNA gyrase. Proa NatI Acad Sci USA 73: 4474-4478, Geilert. M., Mizuuchi. K., O'Dea, M.H. Itoh, T.. and Tomizawa, J. (1977) Naiidixic acid resistance: a second genetic character in DNA gyrase activity. Proc NatI Acad Sci USA 74: 4772M776, Hallett, P., Grimshaw. A.J., Wigley. D.B., and Maxwell, A(1990) Cloning of the DNA gyrase genes under fac promoter control: over-expression of the gyrase A and B proteins. Gene 93: 139-142. Hoeksema, H. Johnson, J.L., and Hinman, J.W, (1955) Structural studies on Sfreplonivicin, a new anlibiotic. J Am Chem Soc 77:6710-6711, Holmes, M.L., and Dyail-Smith, M.L (1991) Mutations in DNA gyrase result in novobiocin resistance in halophilic archaebacteria, jeacfer;o/173: 642-648. Kawaguchi, H.. Tsukiura, H.. Okanishi, M., Miyaki, T., Ohmori, T., and Fujisawa, K. (1965) Studies on coumermycin, a new antibiotic. I. Production, isolation and characterization of coumermycin A,. JAntibiot^8:1 Kraft, R.. Tardiff. J., Krauter, K.S., and Leinwand, L.A. (1988) Using mini-prep plasmid DNA for sequencing double stranded templates with Sequenase™. Biotechniques 6: 544-547, Kraulis, P. (1991) Motscript — a programme to produce both detailed and schematic plots of protein structure. J AppI

Cry st 24:946-950. Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Maxwell, A., and Geliert, M. (1986) Mechanistic aspects of DNA topoisomerases, Adv Prot Chem 38: 69-107. Maxwell, A., Rau, D.C., and Geliert, M. (1986) Mechanistic studies of DNA gyrase. Proceedings of the Fourth Conversation in Biomol Stereodynamics III Sarma, R.H.. and Sarma. M.H. (eds). New York: Adenine Press, pp. 137-146. Menzel, R., and Geilert, M. (1983) Regulation of the genes for E. coli DNA gyrase: homeostatic control of supercoiling. Cell 34; 10&-113. Mizuuchi. K., O'Dea. M.H., and Geilert. M, (1978) DNA gyrase: subunit structure and ATPase activity of the purified enzyme. Proc NatI Acad Sci USA 75: 5960-5963, Mizuuchi, K., Mizuuchi, M. O'Dea, M.H., and Geilert, M. (1984) Cloning and simplified purification of Escherichia coli DNA gyrase A and B proteins. J Biol Chem 259: 9199-9201. Norrander. J-, Kempe. T.. and Messing, J. (1983) Construction of improved Ml 3 vectors using otigodeoxynucleotidedirected mufagenesis. Gene 26:101-106. Ninet, L., Benazet, F., Chapentie, Y., Dubost. M., Florent. J., Mancy, D., PreudHomme, J., Threllall, T.L, Vuillemin, B., Wright, D.E., Abraham, A.. Cartier. M., de Chezelles, N., Godard. C , and Theilleux, J. (1972) La clorobiocine (18, 632

R.P.), nouvel anfibiotique chlore produif par plusieurs especes de Streptomyces. C R Acad Sci Ser C 275: 455-^58. Orr, E.. Fainweather. N.F., Holland, I.B., and Pritchard, R-H. (1979) Isolation and characterisation of a strain carrying a conditional lethal mutation in the cou gene of Escherichia coliK12. Mo/ Gen Genet ^77•. 103-112. Osburne. M.S.. Maiese, W,M., and Greenstein. M, (1990) In vitro inhibition of bacterial DNA gyrase by cinodine, a glycocinnamoylspermidine antibiotic, Antimicrob Ag Chemother 34: 1450-1452. Reece, R.J.. and Maxwell, A. (1989) Tryptic fragments of the Escherichia co!i DNA gyrase A protein. J Biol Chem 264: 19648-19653. Reece, R.J., and Maxwell, A. (1991) DNA gyrase: structure and function. CRC Crit Rev Biochem Mol Biol 26: 335-375. Ryan, M.J. (1976) Coumermycin A^ a perterential inhibitor ol replicative DNA synthesis in Escherichia coli. I. In vivo characterization, Biochemistry\5: 3769-3777. Shure, M., Pulleyblank, D.E., and Vinograd, J. (1977) The problems of eukaryotic and prokaryolic DNA packaging and in vivo conformation posed by superhelix density heterogeneity, Nud Acids Res 4:1183-1205. Staudenbauer, W.L., and Orr, E. (1981) DNA gyrase: affinity chromatography on novobiocin-sepharose and catalytic properties. NucI Acids Res 9: 3589-3603 Sugino, A., and Cozzarelli, N.R, (1980) The intrinsic ATPase of DNA gyrase. J Biol Chem 255: 6299-6306. Sugino, A., Peebles. C.L., Kreuzer, K.N.. and Cozzarelli, N,R. (1977) Mechanism of action of Naiidixic acid: purification of Escherichia co!i na!A gene product and its relationship to DNA gyrase and a novel nicking-closing enzyme. Proc Nat! Acad Sci USA 74: 4767-4771. Sugino, A., Higgins. N.P., Brown, P.O., Peebles, C.L., and Cozzarelli, N.R. (1978) Energy coupling in DNA gyrase and the mechanism of action of novobiocin. Proc NatI Acad Sci USA 75: 4838-4842, Swanberg. S.L.. and Wang. J.C. (1987) Cloning and sequencing of the Escherichia coli gyrA gene coding for the A subunit of DNA gyrase. J Mol ao/197: 729-736. Tamura, J., and Geliert. M. (1990) Characterisation of the ATP binding site on Escherichia coHDHA gyrase. Affinity labelling of lys-103 and lys-110 of fhe B subunit by pyridoxal 5"diphospho-5'-adenosine. J Biol Chem 34: 21342-21349. Vizan, J.L., Hernandez-Chico, C . del Castillo, I,, and Moreno, F. (1991) The peptide antibiotic microcin B17 induces double-stranded cleavage of DNA mediated by E. coli DNA gyrase, EMBOJAO: 467-476. Wang, J,C. (1985) DNA topoisomerases. Anna Rev Biochem 54:665-697. Wigley. D.B., Davies, G.J.. Dodson, E.J.. Maxwell, A., and Dodson, G. (1991) Crystal structure of the W-termina! domain of the DNA gyrase B protein. Nature 351: 624-629. Yamagishi, J., Yoshida, H., Yamayoshi, M., and Nakamura. S. (1986) Naiidixic acid-resistant mutations of the gyrB gene of Escherichia coil. Mo! Gen Genet 204: 367-373, Yanisch-Perron, C , Veira. J., and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpi8 and pUC19 vectors. Gene 33: 103-119.