Cell, Vol. 63, 1239-1246,

December

21, 1990, Copyright

0 1990 by Cell Press

Effect of Dystrophin Gene Deletions on mRNA Levels and Processing in Duchenne and Becker Muscular Dystrophies Jamel Chelly,’ H&ne Gilgenkrantz,’ Martine Lambert: Ghislaine Hamard, Philippe Chafey,’ Dominique R&can: Pierre Katz,t Albert de la Chapelle,+ Michel Koenig,5 leke B. Ginjaar,ll Michel Fardeau,# Fernando Tom&# Axel Kahn,’ and Jean-Claude Kaplan’ * INSERM U129 lnstitut Cochin de G6nBtique Mol&ulaire #INSERM U153 17 rue du Fer & Moulin Paris, France t HBpital Necker-Enfants Malades Clinique de GBn&ique M6dicale Paris, France $ Department of Medical Genetics University of Helsinki Helsinki, Finland 5 Dbpartement de GbnBtique Humaine lnstitut de Chimie Biologique Facultb de MBdecine II Strasbourg, France IIDepartment of Human Genetics Sylvius Laboratories Leiden. The Netherlands

Muscle dystrophin mRNAs from Duchenne (DMD) and Becker (BMD) patients with internal deletion of the DMD gene were quantitated and sequenced. In all cases (eight DMD and three BMD), truncated mature transcripts were found, and their amount was correlated to the clinical phenotype and to the reading frame. We focused on four cases that were apparently not in agreement with the reading frame rule. In two DMD casds, slightly reduced amounts of in-frame truncated mRNA are present but no dystrophin is detected, suggesting impaired translation and/or instability of the protein. In two BYD patients with outof-frame deletions, the presence of minor in-frame alternatively spliced mRNA species Is congruent with the observed truncated dystrophin and the mild phenotype. Introduction Duchenne and Becker muscular dystrophies (DMD and BMD) are produced by allelic defects of the huge (>2000 kb) dystrophin gene (reviewed by Monaco and Kunkel, 1988; Worton and Thompson, 1988). The final product, a 427 kd protein mainly localized in muscle sarcolemma, is encoded by a 14 kb mRNA. In about 60% of the cases, the gene defect is a deletion of variable extent and location, resulting either in the severe DMD type of disease or in the milder BMD type. Hoffman et al. (1988) showed that

the clinical phenotype correlates with the status of muscle dystrophin, absent or drastically reduced (lO%) and/or size in BMD patients. Concomitantly, it was observed that the severe DMD phenotype is produced by deletions causing a disruption of the reading frame in the gene, precluding any production of functional dystrophin; conversely, the milder BMD phenotype is produced by deletions that do not alter the reading frame, resulting in the production of a truncated dystrophin (Monaco et al., 1988; Koenig et al., 1989). However, exceptions to the reading frame theory, i.e, DMD with in-frame deletions and BMD with out-of-frame deletions (Malhotra et al., 1988; Gilgenkrantz et al., 1989), are found in about 8% of the deletions (Koenig et al., 1989). In previous studies, sensitive methods, such as in situ RNA hybridization (Oronzi-Scott et al., 1988) and mRNA polymerase chain reaction (PCR) (Chelly et al., 1988; Muntoni and Strong, 1989), showed the presence of dystrophin transcript even in cases with internal gene deletions. In these studies, however, the amount and the sequence of resulting truncated dystrophin transcripts have not been investigated. Such analysis should help to check the actual reading frame and to understand the molecular basis of the cases that are in apparent contradiction with Monaco’s rule. In this study, PCR-amplified dystrophin transcripts are investigated in muscle specimens from eight DMD and three BMD patients with known internal deletions of the DMD gene, with special emphasis on four cases (two DMD and two BMD) that are apparently not in agreement with the reading frame rule. Using appropriate combinations of primers amplifying across the predicted junction point, we looked for alternative splicing patterns that might explain these exceptions. The results are correlated with the clinical phenotype, the reading frame deduced from the gene deletion, and the dystrophin status. Results Detection and Quantitation of Mature Transcripts of the Dystrophin Gene in Muscle from DMD and BMD Patients We screened by PCR coamplification three different portions of the dystrophin mRNA (see Figure la) from muscle biopsy specimens: a 201 nucleotide segment in the 5’ region spanning nucleotides 1015-1216 on the cDNA sequence, as established by Koenig et al. (1988); a 170 nucleotide segment in the middle part of the transcript (6365-6535); and a 125 nucleotide segment in the 3’ region (9362-9487). The relative amount of dystrophin mRNA in each sample was determined as already described (Chelly et al., 1990). In this procedure a known amount of exogenous mRNA (rat L-pyruvate kinase [L-PK]), used as a standard, is added and coamplified along with the dystrophin mRNA segments. In 11 muscle specimens from patients with previously

Cell 1240

Table 1. Dystrophin and BMD

16 c

of Three Different Segments from Muscle Biopsy

of the Dystro-

(a) Position of primers (indicated below) and their relation to the target gene region and size of coamplified cDNA fragments (bold line indicated above). The primers-complementary (c) and identical (i)-are chosen in different exons to distinguish amplification of mRNA fragments from amplification of contaminating DNA. The following primers were used: in exon 6, E6i (5”CATCAAATGCACTATTCTCAACAG-3’) and in exon 10, ElOc (WCTCCAlCAAlGAACTGCCAAATGA-3’) for segment A; in exon 43, E43i (S-CTCTTTAAGCAAGAGGAGTCT-3’) and in exon 44, E44c (5’-CCATTTCTCAACAGATCTGTC-3r) for segment B; in exon 61, E61i (5’TTTCACGTCTGTCCAGGGTCCC3’) and exon 62, E62c (r%CTGGTAGAGCTCTGTCATTTTGGGA-3’) for segment C. (b) Autoradiograms of Southern blots performed on cDNA PCRcoamplified products (15 cycles) of dystrophin (segments A, B, and C) transcripts, hybridized with dystrophin cDNA probes (9.7,44.7, and 63.1 for segments A, B, and C, respectively). The dystrophin transcript was analyzed in muscle biopsy from patients 1 to 6 (Table 1) and from normal muscle (Ct). Added L-PK mRNA was used as an internal standard (IS) and hybridized with an internal oligoprobe.

detected internal gene deletions (eight DMD and three BMD), the three dystrophin mRNA segments were found, except when one of the primers was in the deleted region (Table 1 and Figure 1). in addition, in two DMD cases without any detected gene deletion, the three segments could be amplified, indicating that the gene was not deleted in the corresponding region (patients 4 and 9; Table 1 and Figure 1). Quantitative analysis in 13 muscle samples, performed (after 15 PCR cycles) in the exponential phase of the amplification (prerequisite to do relative quantitation; Chelly et al., 1990) showed that the dystrophin transcript was diminished in the majority of cases, the decrease being approximately equivalent for the three segments in each sample (Figure lb). The amount of residual mRNA varied greatly, and two categories could be defined: one with less than 10% dystrophin mRNA (eight DMD) (see, for example, Figures lb and 2a, 15 cycles), the other with more than 25% dystrophin mRNA (two DMD and three BMD) (see Figures lb and 5a). in the first group, all cases are DMD, six of which with a known deletion that apparently disrupts the reading frame, and two in which DNA had not been investigated. In the second group, with significantly higher levels of dystrophin mRNA, there are two DMD cases with a known de-

Analysis

Patients

Phenotype

Deleted Exons

Predicted Reading Frame

1

DMD DMD DMD DMD DMD DMD DMD DMD DMD BMD BMD BMD DMD

3-34 6-13 12 NA 46-46 44-47 7-13 44 NA 3-7 3-7 45-46 50

ORF ORF Frameshift ? Frameshift Frameshift Frameshift Frameshift ? Frameshift Frameshift ORF Frameshift

2 3 4 5 6 7 6

9

Figure 1. Coamplification phin mRNA Originating

DNA and mRNA

10 11 12 13

in Patients

with DMD

mRNA Fragment Detected A

B

C

+ + + + + + + + + +

+ + + + + + + + + + +

+ + + + + + + + + + + + +

Phenotypes are classified as described in Experimental Procedures. The predicted consequence of deletion on the reading frame was determined by examining the remaining two exons flanking the deletion (the exon borders were defined by Koenig et al., 1969). Abbreviations are as follows: NA, not analyzed by Southern blot; ORF, open reading frame; for fragments A, B, and C, see Figure 1.

letion respecting the reading to 34) and two BMD cases 7, which apparently disrupts BMD case with an in-frame (Table 1).

frame (exons 6 to 13 and 3 with a deletion of exons 3 to the reading frame, and one deletion of exons 45 to 46

Analysis of Dystrophin lkanscripts in Cases in Which the Phenotype (DMD or BMD) is in Agreement with the Reading Frame Hypothesis To investigate the truncated dystrophin mRNA, we used primers flanking the deleted exons to amplify the transcript of muscle samples from two DMD and one BMD patient. In Figure 2, we show typical results obtained in a DMD case with an internal out-of-frame deletion removing exon 50 (patient 13; Table 1 and Figure 2). Using primers in exons 49 and 52, we amplified, as expected, a fragment of about 350 bp, which hybridized to the internal oligoprobes E52c2 and E49i2. Figure 2a shows that, after 15 cycles, the level of truncated dystrophin transcripts is very reduced (> 2-10 > 1-8 > l-10 (bold type indicating the in-frame species). The 2-10 transcript is at least 10 times more abundant in the patient than in the control muscle specimen. To estimate the level of dystrophin mRNA in this patient, in addition to the coamplification of the three

kD

,Dystrophin,

-427

- 180 cl16

b

a

-64

MyosinC Figure

4. Western

Blot Analysis

of Muscle

Dystrophin

in Patient

1

Blots were probed with the following purified antibodies: 60 kd (a) and P20 (b). Note the absence of dystrophin in patient 1, especially with the P20 antibody, which is directed against a region not deleted in this patient. Staining of the myosin heavy chain band (c) on a different acrylamide gel in each lane is used as an indicator of the amount of muscle protein loaded.

segment (C in Figure 5a) with the Eli-ElOc primer couple and a 93 bp segment (E, barely visible in Figure 5a) with the Eli-E8c primer couple. In normal control muscle, none of these species was observed after 15 PCR cycles. All the above mentioned

Eli-EIC

mRNA-PCR

a

bp 455)

Eli-ElOC

P ct

P

E49i Et

-E5OC

P

CL

Eli-EOC

b

Eli-ElOC

P

ct

P

ACGTACGT

ct

0 ExonlO Exon

A

Figure

5. Alternative

Splicing

in the 5’ Coding

Sequence

of Muscle

5

2

E,*E*+EO+EO+ElO

8;

El.EZ+E(I

C=

E,+E?*ElO

DE

E4S.ESO

E=

El+EB

F:

ElrElO

Dystrophin

Transcript

from EMD Patient

10 and in Normal

Muscle

(a) Autoradiograms of Southern blots performed on cDNA PCR-coamplified products (15 cycles) of dystrophin transcripts from patient 10 (P) with an apparent out-of-frame deletion (exons 3 to 7) and from normal muscle (Ct) hybridized with dystrophin cDNA probes (probe 9.7 for PCR products obtained with primer couples Eli-E6c and Eli-ElOc, and probe 44.1 for PCR products obtained with primer couple E49i-E50c). Added L-PK mRNA was used as an internal standard and hybridized with an internal oligoprobe. The largest fragment detected in the patient with Eli-E6c shows the same sequence as fragment B and corresponds to the amplification of a secondary structure of this latter segment. (b) Same analysis as in (a) performed after 30 cycles. Southern blots were hybridized with internal oligoprobes (Elc and E2c). (c) Spliced exons corresponding to the amplified segments mentioned in (a) and (b). (d and e) Gel sequencing and nucleotide sequence of the l-2-10 in-frame segment showing alternative splicing of exons 6 and 9 in the patient’s muscle and position of primers used for PCR and for hybridization (positon of Elc primer is indicated in Figures 3c and 3d).

Cell 1244

Figure

6. Western

Blot Analysis

of Muscle

Dystrophin

in BMD Patients

10 and 11 and lmmunofluorescence

Analysis

of Patient 10 Muscle

Dystrophin

(a) lmmunoblots probed with purified 60 kd antibody showing reduced molecular weight and decreased amount of dystrophin in muscle biopsy samples of patients 10 and 11 with an out-of-frame deletion (exons 3 to 7) and of a BMD patient with a deletion removing exons 45 to 46 (corresponding to 220 amino acids; patient 12) and exons 45 to 49 (corresponding to 254 amino acids), respectively. The size of normal dystrophin is 421 kd. (b) Staining of the myosin heavy chain band (on a different acrylamide gel) in each lane, which is used as an indicator of the amount of muscle protein loaded. (c, d, and e) Indirect immunofluorescence analysis using the anti-dystrophin antibody 60 kd in unfixed cryostat transverse section of skeletal muscle fibers (all magnified 165x): normal fibers (c); patient 10 muscle sample (note the hypertrophy of fibers) (d); DMD skeletal muscle (e).

fragments described in the first section, we have also amplified a segment contained between exons 49 and 5O,,distal to the breakpoint. It was found to be about 25% of the normal specimen (fragment D, Figure 5a). At the protein level, reduced amounts (about 10% of a normal muscle sample) of a truncated dystrophin were seen on Western blot analysis using 60 kd (Figure 6a), DlO, and P20 antibodies (data not shown). The reduction of size of this abnormal dystrophin (exons 3 to 7 correspond to 165 codons) is at least equal to two in-frame BMD deletions removing 220 and 254 codons, respectively (deletions of exons 45 to 46 and of exons 45 to 49; Figure Sa). However, at this level of molecular weight, it is difficult to conclude that the observed size of the dystrophin corresponds precisely to the translation of the 2-10 alternatively spliced transcript (289 deleted codons). Immu-

nofluorescence assay using the 60 kd antibody showed a reduced and patchy staining of the patient muscle sarcolemma (Figure 6d). Patient 11 (Gilgenkrantz et al., 1989) is another patient with a typical BMD phenotype and a deletion removing exons 3 to 7 of the dystrophin gene that disrupts the reading frame. The dystrophin transcripts were explored in muscle, using the same primers as in the preceding case. Similar results were obtained, but in this case the species corresponding to the in frame 2-10 splicing was more abundant than in patient 10, and the residual amount of mRNA, estimated by amplification of a more distal segment (as in the case described above) was only slightly diminished (data not shown). Western blot analysis of muscle extracts showed the same qualitative results as in patient 10 (Figure Sa).

D&rophin

mRNA

in Duchenne

and Becker

Dystrophies

Discussion Consequences of Genomic Deletions on Muscle Dystrophin mRNA Level Mature dystrophin transcripts were detected in muscle specimens from all the DMD patients investigated (ten individuals). This result is in agreement with previous data (Oronzi-Scott et al., 1988; Chelly et al., 1988; Muntoni and Strong, 1989). In this study, quantitative analysis shows that the amount of transcript may be categorized into two classes. In one class (eight patients), the amount of residual mRNA is drastically reduced (