467
ARTICLE
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Effect of ginsenoside Rg1 on proliferation and neural phenotype differentiation of human adipose-derived stem cells in vitro Fang-Tian Xu, Hong-Mian Li, Qing-Shui Yin, Shi-En Cui, Da-Lie Liu, Hua Nan, Zhi-An Han, and Kun-Ming Xu
Abstract: Aims: To investigate whether ginsenoside Rg1 can promote neural phenotype differentiation of human adipose-derived stem cells (hASCs) in vitro. Methods: hASCs were isolated from lipo-aspirates, and characterized by specific cell markers and multilineage differentiation capacity after culturing to the 3rd passage. Cultured hASCs were treated with neural inductive media alone (group A, control) or inductive media plus 10, 50, or 100 g/mL ginsenoside Rg1 (groups B, C, and D, respectively). Cell proliferation was assessed by CCK-8 assay. Neuron specific enolase (NSE) and microtubule-associated protein-2 (MAP-2) levels were measured by Western blot. mRNA levels of growth associated protein-43 (GAP-43), neural cell adhesion molecule (NCAM), and synapsin-1 (SYN-1) were determined by real-time PCR. Results: Ginsenoside Rg1 promoted the proliferation of hASCs (groups B, C, and D) and resulted in higher expression of NSE and MAP-2 compared with the control group. Gene expression levels of GAP-43, NCAM, and SYN-1 in the test groups were higher than that in thw control. The results displayed a dose-dependent effect of ginsenoside Rg1 on cell proliferation and neural phenotype differentiation. Conclusion: This study indicated that ginsenoside Rg1 promotes cell proliferation and neural phenotype differentiation of hASCs in vitro, suggesting a potential use for hASCs in neural regeneration medicine. Key words: adipose-derived stem cells, cell therapy, induced differentiation, neural regeneration, ginsenoside Rg1, cell proliferation, neural phenotype. Résumé : Buts : Examiner si le ginsénoside Rg1 peut promouvoir la différenciation des cellules souches humaines dérivées du tissu adipeux (ou hASC pour human adipose-derived stem cells) vers un phénotype neural in vitro. Méthodes : les hASC ont été isolées a` partir de lipo-aspirations et caractérisées a` l'aide de marqueurs cellulaires spécifiques et selon leur capacité de différenciation en lignages multiples après une culture jusqu'au 3ième passage. Les hACS en culture ont été traitées avec un milieu induisant un phénotype neural (groupe A, contrôle), ou un milieu inducteur comprenant 10, 50, ou 100 g/mL de ginsenoside Rg1 (groupes B, C et D, respectivement). La prolifération cellulaire a été évaluée a` l'aide d'un dosage CCK-8. Les niveaux d'énolase spécifique au neurone NSE et de la protéine associée aux microtubules MAP-2 ont été mesurés par buvardage Western. Les niveaux d'ARNm de la protéine GAP-43, de la molécule d'adhésion NCAM et de la synapsine-1 (SYN-1) ont été déterminés par PCR en temps réel. Résultats : Le ginsénoside Rg1 pouvait promouvoir la prolifération des hASC (groupes B, C, et D), ce qui résultait en une expression accrue de NSE et de MAP-2 comparativement au groupe contrôle. Les niveaux d'expression génique de GAP-43, NCAM et SYN-1 dans les groupes test étaient supérieurs a` ceux du groupe contrôle. Les résultats montraient un effet dépendant de la concentration du ginsénoside Rg1 sur la prolifération cellulaire et la différenciation vers un phénotype neural. Conclusion : Cette étude a indiqué que le ginsénoside Rg1 peut promouvoir la prolifération et la différenciation des hASC vers un phénotype neural in vitro, suggérant que les hASC pourraient possiblement être utilisées en neurologie régénérative. [Traduit par la Rédaction] Mots-clés : cellules souches dérivées du tissu adipeux, thérapie cellulaire, différenciation induite, régénération neurale, ginsénoside Rg1, prolifération cellulaire, phénotype neural.
Introduction Injuries to the nervous system are very common and represent a major health problem worldwide. It has been estimated that approximately 90 000 people suffer from such conditions every year in China. Among these, spinal-cord injuries affect more than 10 000 people. Although the peripheral nervous system possesses
an intrinsic ability to regenerate, the injured nerve usually cannot reach full functional rehabilitation, even after surgical interventions. The central nervous system is incapable of self-repair, and to date no treatments are available for the complete recovery of human nerve functions. Regenerative medicine, which describes the process of creating living, functional tissues to repair or replace tissue or organ function, utilizes stem cells that have been
Received 18 November 2013. Accepted 30 March 2014. F.-T. Xu.* Southern Medical University, Guangzhou 510515, China; Department of Orthopedics, the First Affiliated Hospital of Gannan Medical University, Ganzhou 341000, China. H.-M. Li.* Department of Plastic and Aesthetic Surgery, Zhongshan Bo'ai Hospital of Southern Medical University, Zhongshan 528403, China. Q.-S. Yin. Southern Medical University, Guangzhou 510515, China; Department of Orthopedic Surgery, Guangzhou General Hospital of PLA, Guangzhou 510180, China. S.-E. Cui and K.-M. Xu. Department of Mammary Gland Surgery, Zhongshan Hospital of Sun Yat-Sen University, Zhongshan 528403, China. D.-L. Liu and H. Nan. Department of Plastic and Reconstructive Surgery, Zhujiang Hospital of Southern Medical University, Guangzhou 510282, China. Z.-A. Han. Department of Neurosurgery, Zhongshan Hospital of Sun Yat-Sen University, Zhongshan 528403, China. Corresponding authors: Hong-Mian Li (e-mails: [email protected]) and Qing-Shui Yin (e-mail: [email protected]). *Hong-Mian Li, Qing-Shui Yin, and Fang-Tian Xu contributed equally as co-first authors. Can. J. Physiol. Pharmacol. 92: 467–475 (2014) dx.doi.org/10.1139/cjpp-2013-0377
Published at www.nrcresearchpress.com/cjpp on 17 April 2014.
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
468
widely documented for their potential to treat nervous system injuries (Eggleson 2012; Frattini et al. 2012; Petrova 2012; Ren et al. 2012). There are several possible sources of stem cells. Among them, adult mesenchymal stem cells are very attractive owing to their distinct advantages over other stem cells. Compared with embryonic stem cells, adult mesenchymal stem cells are much easier to harvest and have fewer ethical implications. Compared with progenitor or precursor cells, adult mesenchymal stem cells have the ability to undergo multilineage differentiation. Finally, most mesenchymal stem cells have strong proliferative capacity, which is important for their potential clinical applications. There are many potential sources of mesenchymal stem cells. Currently, they can be harvested from bone marrow, adipose tissue, muscle, dermal skin, and hair follicles. Among these potential sources, adipose tissue may be the most suitable for clinical applications. Adipose tissue is readily available because of plastic surgery, which has become popular in many societies. The pluripotency and proliferative capacity of human adipose-derived stem cells (hASCs) are similar to those of bone marrow-derived stem cells. ASCs have also been proven to be capable of neurogenic differentiation, and experimental studies in animal models have demonstrated their potential use in nerve regeneration therapy (Kang et al. 2004; Taha and Hedayati 2010; Kwon et al. 2011; Cardozo et al. 2012). Other compounds in combination with ASCs may prove to enhance their neurogenic effects. For example, ginsenoside Rg1, a steroidal saponin that is abundant in ginseng, is one of the most active components in ginseng. Previous studies have demonstrated that ginsenoside enhances the proliferation and differentiation of neural stem cells (Shi et al. 2005; Lin et al. 2012). More specifically, Rg1 has been shown to exhibit neurotropic and neuroprotective effects in various models, both in vivo and in vitro (Wu et al. 2013), and it has been found to regulate the proliferation of neural progenitor cells. Moreover, Rg1 increased neurogenesis after transient global ischemia in the dentate gyrus of adult gerbils (Shen and Zhang 2003, 2007). However, the mechanism and potential role of Rg1 in neuronal lineage commitment and its ability to affect hASC behavior is not well understood. Therefore, in this study, ginsenoside Rg1 was used as a supplement in cell cultures to test its ability to promote proliferation and neural phenotype differentiation of hASCs.
Materials and methods Isolation and characterization of hASCs hASCs were isolated from lipo-aspirates obtained during liposuction procedures, with consent given by the patients. The fat portion of the lipo-aspirates was washed with phosphate buffered saline (PBS) to eliminate red blood cells. The adipose tissue was finely minced and digested with 0.1% collagenase at 37 °C for 60 min by vigorous shaking. After centrifugation at 260g for 5 min, the cell pellet was resuspended with Dulbecco's modified Eagle medium (DMEM) plus 15% fetal bovine serum (FBS). The isolated cells were seeded onto culture dishes and incubated at 37 °C in 5% carbon dioxide. The first medium change was carried out at 24 h after seeding, and non-adherent cells were discarded; the medium was subsequently replaced every 3 d. Cultured cells were observed using a microscope to assess expansion and cell morphology. Cells were harvested at 80%–90% confluence and passaged at a ratio of 1:3. To confirm the multilineage differentiation capacity of the isolated hASCs, subconfluent hASCs from the 3rd passage were cultured using osteogenic, adipogenic, and chondrogenic inductive media (Table 1). After 2 or 3 weeks of induction, differentiation of the hASCs was detected using the relevant his-
1
Can. J. Physiol. Pharmacol. Vol. 92, 2014
tological assays combined with assessment of mRNA expression of lipoprotein lipase, osteopontin, and collagen type II using realtime PCR. Immunofluorescence and immunohistochemistry To identify specific cellular surface markers, CD29, CD34, CD44, CD45, CD73, and CD90 immunofluorescence staining was performed on hASCs at the 3rd passage. The primary antibodies used were monoclonal mouse anti-human (1:200; Sigma, Santa Clara, California, USA), and the secondary antibodies were goat antimouse IgG-Cy3 (CD29, CD34) or IgG-FITC (CD44, CD45, CD73, and CD90) (all 1:100; Sigma). The nuclei of the CD73 stained hASCs were counterstained with propidium iodide, whereas those of CD29, CD34, CD44, CD45, and CD90 were counterstained with 4=,6-diamidino-2-phenylindole, hydrochloride. To specifically identify neuronal markers, nestin and neuron specific enolase (NSE) immunohistochemical analyses were run on hASCs. The primary antibodies used were mouse anti-human NSE monoclonal antibody and mouse anti-human nestin monoclonal antibody (both 1:200; Sigma). The secondary antibody was biotin-goat anti-mouse IgG (1:100; Sigma). Preparation of ginsenoside Rg1 Ginsenoside Rg1 (protopanaxatriol extract monomer; Sigma), which is a colorless semi-crystalline material, was easily dissolved in pyridine and acetone (both 100 g/mL, final concentration). The chemical name of ginsenoside Rg1 is (3,6␣, 12)-20-(-D-glucopyranosyloxy)-3,12-dihydroxydammar-24-en-6yl-(-D-glucopyranoside). The molecular formula is C42H72O14, the molecular weight is 801.01, and the chemical structure formula is presented in the Supplementary data1. Effect of ginsenoside Rg1 on hASC morphology and neurite outgrowth hASCs that were obtained after the 3rd passage were seeded onto 6-well culture plates. The culture medium was discarded when the cells were at 70%–80% confluence. Cells were assigned either to the control group (A) or to one of 3 test groups (B, C, or D). All groups were exposed to pre-induction medium (high glucose DMEM, 0.5 g/mL bFGF, and 10% FBS), which was discarded after 6 h. Following PBS washing, the treatment groups were incubated with neural inductive conditioned medium (high glucose DMEM without FBS, 100 mol/L butylatedhydroxyanisole) plus 10 g/mL ginsenoside Rg1 (group B), 50 g/mL ginsenoside Rg1 (group C), or 100 g/mL ginsenoside Rg1 (group D); the control group (group A) was exposed to neural inductive conditioned medium plus drug vehicle only. Cellular morphology and neurite growth were observed every 24 h under a phase-contrast microscope, and 3-dimensional patterns were observed using an inverted phasecontrast microscope. To measure neurite length, one image from each test group and one from the control group was taken from each visual field after 72 h. Neurite length was measured using the DM16000B image analysis system (Leica, Somme, Germany). The presence of neurites was assessed in 100 random cells to calculate the percentage of neurite-positive cells (as determined by a neurite length longer than 1.5 × body diameter). Effect of ginsenoside Rg1 on hASC proliferation hASCs at passage 3 were harvested and seeded onto 96-well culture plates for the proliferation assay. The CCK-8 test (Cell Counting Kit-8, Dojindo Laboratories, Kyoto, Japan) was performed daily for 7 d to obtain growth curves for treatment and control groups. This test is based on a colorimetric assay and utilizes a highly water-soluble tetrazolium salt (ST-8[2-(2-methyxy4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium,
Supplementary data are available with the article through the journal Web site at http://nrcresearchpress.com/doi/suppl/10.1139/cjpp-2013-0377. Published by NRC Research Press
Xu et al.
469
Table 1. Multilineage induction of ASCs.
Adipogenic
Osteogenic
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Chondrogenic
Induction
Characterization
DMEM (high glucose), 10% FBS, 1% antibiotic/antimycotic, 200 mol/L indomethacin, 0.5 mmol/L isobutyl–methylxanthine (IBMX), 1 mol/L dexamethasone, 10 mol/L insulin DMEM (high glucose), 10% FBS, 1% antibiotic/antimycotic, 0.1 mol/L dexamethasone, 50 mol/L ascorbate-2-phosphate, 10 mmol/L b-glycerophosphate DMEM (high glucose), 1% FBS, 10 ng/mL TGF-1, 1% antibiotic/antimycotic, 6.25 g/mL insulin, 50 nmol/L ascorbate-2-phosphate
Oil red O staining and mRNA lipoprotein analysis by RT-PCR Alizarin red staining and mRNA osteopontin analysis by RT-PCR Alcian blue staining and mRNA collagen type II analysis by RT-PCR
Table 2. Primer sequences. Gene name (human)
Forward primer sequence (5= to 3=)
Reverse primer sequence (5= to 3=)
GAP-43 NCAM SYN-1 Lipoprotein lipase Osteopontin Collagen type II GAPDH
GGATGGCTCTGCTACTAC CGACGTTGGAGAGTCCAAAT CTTCAGCAGCATCATCCAGAC AAGGTCAGAGCCAAGAGAAGCA CACCTGTGCCATACCAGTTAA GGCAATAGCAGGTTCACGTACA GGTGAAGGTCGGAGTCAACG
GTCGGCTTGTTTAGGCTC TTAAACTCCTGTGGGGTTGG CACCTTGGTCGTGGATCATCATAGC CCAGAAAAGTGAATCTTGACTTGGT GGTGATGTCCTCGTCTGTAGCATC CGATAACAGTCTTGCCCCACTT CAAAGTTGTCATGGATGHACC
monosodium salt]). To assess viability, cells were plated in 24-well plates at a density of 1 × 105 cells per well in 200 L of growth medium. After 24 h, 15 L of CCK-8 reagent were added to each well and incubated at 37 °C for 2 h. After centrifugation, 100 L of supernatant were transferred to 96-well microtiter plates and optical density (O.D.) was measured at 450 nm. CCK-8 is a one-bottle solution; no premixing of components is required. Being nonradioactive, CCK-8 allows sensitive colorimetric assays for the determination of the number of the viable cells in cell proliferation and cytotoxicity assays. WST-8* is reduced by dehydrogenases in the cells, yielding an orange colored formazan, which is soluble in the tissue culture medium. The amount of the formazan dye generated by dehydrogenases in cells is directly proportional to the number of living cells. The cells were pretreated with 1.0 mmol/L N-acetyl cysteine (NAC; Sigma) 30 min before the treatments. Protein extraction and Western blotting Seventy-two hours after induction, 10 samples collected from the control and each treatment group were harvested for Western blot analysis. Whole cell extracts were obtained from all 4 groups of differentiated hASCs. Briefly, confluent cells were washed with ice-cold PBS and removed by scraping. Cell pellets were sonicated in the extraction buffer. Extracts were quantified using the BioRad DC protein assay kit (BioRad, Hercules, Calif.). Equal amounts of protein were resolved on 4%–12% SDS–PAGE and transferred to PVDF membranes (Millipore, Bedford, Massachusetts, USA). Membranes were blocked with blocking solution (Pierce, Rockford, Illinois, USA). Primary antibodies used were: anti-human NSE, anti-human microtubule-associated protein-2 (MAP-2) (all from Abcam, London, UK). Horseradish-peroxidase-conjugated secondary antibody and enhanced chemiluminescence substrate (Supersignal West Dura Detection System; Pierce) were used for the detection of the primary antibody. RNA extraction and real-time PCR Seventy-two hours after induction, RT-PCR was performed for lipoprotein lipase, osteopontin, collagen type II, growth associated protein-43 (GAP-43), neural cell adhesion molecule (NCAM), and synapsin-1 (SYN-1). Total RNA was isolated from monolayer cultures using Ultraspec RNA purification reagent (Biotecx, Houston, Texas, USA) according to the manufacturer's instructions. Two micrograms of total RNA were reverse-transcribed using SuperScript II (Life Technologies, Rockville, Maryland, USA) random primers (n = 6).
Quantitative RT-PCR was performed with an MJ Research Opticon 2 RT-PCR machine following the manufacturer's recommended protocol and using the DyNamo SYBR green Q-PCR kit (MJ Research, Reno, Nevada, USA). Melting curve analysis and agarose gel electrophoresis were performed to ensure the purity of PCR products. The primers used are reported in Table 2. Total RNA was extracted using the TRIzol reagent (Life Technologies, Grand Island, New York, USA) in combination with the PureLink RNA Mini Kit (Life Technologies) according to the manufacturer's instructions. RNA was treated with TurboDNAse (Life Technologies) according to manufacturer's instructions. The purified RNA (10 ng/mL) was reverse transcribed with the High Capacity cDNA Reverse Transcription (RT) kit (Life Technologies) under the following conditions: 25 °C for 10 min, 37 °C for 120 min, followed by 85 °C for 5 min. To identify potential genomic DNA contamination, controls with no enzyme were evaluated. The PCR reactions were performed on an Applied Biosystems StepOnePlus PCR machine using 5 L SYBR Green PCR Master Mix (Life Technologies), 2 L sequence specific primers (0.5 mmol/L, GAPDH was used at 0.25 mmol/L, Table 1), and 3 L cDNA (cDNA dilutions: ADIPQ, ALPL, FABP4, OPN =10-fold; BGLAP = 5-fold; COL1A1, LEP = 31-fold) under the following conditions: 95 °C for 10 min followed by 40 cycles of 15 s of denaturation at 95 °C and 60 s of annealing and elongation at 60 °C. A melting curve analysis was performed after each run to confirm product specificity. The ⌬⌬CT method was employed to determine the relative gene expression level of the gene of interest, normalized to the endogenous controls glyceraldehyde-3-phosphate (GAPDH) and ribosomal protein L13A (RPL13A). Statistical significance was determined using a 2-way ANOVA to compare the treatments and time points followed by Newman–Keuls' post-hoc comparison of groups. Statistical analyses Experiments were repeated 6 times, and results are the mean ± SD. Results of the RT-PCR and Western blot assays were compared using the unpaired Student's t test and ANOVA; values for P < 0.05 were considered to be statistically significant. All statistical analyses were performed using SPSS 16.0 (SPSS, Chicago, Ill.).
Results Characterization and pluripotency of hASCs Cultured hASCs were expanded after plating or flasking and grown to confluence. After approximately 2 weeks, the cultured cells became more uniform and grew as a monolayer with typical Published by NRC Research Press
470
Can. J. Physiol. Pharmacol. Vol. 92, 2014
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Fig. 1. Characterization of human adipose-derived stem cells (hASCs) prior to and following induction. (A) hASCs at passage 3 were marked with the following: (B) oil red O following adipogenic induction for 2 weeks; (C) alizarin red staining following osteogenic induction for 3 weeks; (D) alcian blue staining following chondrogenic induction for 2 weeks; (E–J) immunofluorescence staining for CD29, CD34, CD44, CD45, CD73, and CD90, respectively. Scale bars = 100 m (A, C, E, F, G, H, I, and J); 20 m (B and D).
fibroblast-like morphology (Fig. 1A), showing strong proliferative ability. Cultured cells can be passaged 7 days after seeding and then passaged every 2–3 d. When cultured in lineage-specific media for 2–3 weeks, hASCs stained positively for oil Red-O, alizarin red, and alcian blue following adipogenic, osteogenic, and chondrogenic induction, respectively (Figs. 1B–1D). Immunofluorescence staining of hASCs after the 3rd passage showed that these cells expressed the well-accepted mesenchymal stem cell markers CD29, CD44, CD73, and CD90 (Fig. 1 E, G, I, and J), whereas they did not express the hematopoietic cell markers CD34 and CD45 (Figs. 1F and 1H). Moreover, mRNA expression of lipoprotein lipase, osteopontin, and collagen type II was evaluated by RT-PCR analysis after adipogenic, osteogenic, and chondrogenic induction, respectively. The intensity of each gene was normalized to GAPDH (internal control), and these experiments were repeated a minimum of 6 times. The relative densities (mRNA/GAPDH) of lipoprotein lipase, osteopontin, and collagen type II in the inducted groups were clearly higher than those in the control group (P < 0.001, Figs. 2A–2C). Influence of ginsenoside Rg1 on cell proliferation of hASCs During the neurogenic induction process, CCK-8 tests were performed on the 3 test groups of hASCs (i.e., exposed to 10, 50, or 100 g/mL of ginsenoside Rg1) and the vehicle-only control group. The results, expressed as growth curves, clearly demonstrated that ginsenoside Rg1 promoted cell proliferation of hASCs during the neurogenic differentiation process. Beginning 3 d after treatment, the proliferation rate of the ginsenoside Rg1 groups (A, B, and C) was significantly higher than that of the control group (P < 0.001, Fig. 3). The results show that ginsenoside Rg1 has obvious positive dose-dependant dose effects on cell proliferation.
Effects of ginsenoside Rg1 on neurogenic differentiation of hASCs After hASCs were exposed to 10, 50, or 100 g/mL of ginsenoside Rg1 for 24 h, cellular morphology began to change: the cytoplasm decreased in size, cells exhibited a typical perikarya shape, and displayed pseudopodia, and the percentage of neurite-positive cells was significantly higher than that of the control group (P < 0.01, Table 3). After 72 h, the majority of cells became bipolar or multipolar neuron-like cells, displaying long neurites similar to those of axons or dendrites. These cells were positive for NSE and nestin (Fig. 4). Some cells were connected in a network structure, and the percentage of neurite-positive cells was still significantly increased at this time point (Table 3). This finding suggests that ginsenoside Rg1 promoted the outgrowth of neuronal-like structures in hASCs. Seventy-two hours after neurogenic induction, NSE and MAP-2 protein expression were measured in the treatment and control groups by Western blot analysis. The expression of both proteins was significantly increased when the inductive medium was supplemented with 10–100 g/mL of ginsenoside Rg1 compared with the control group (P < 0.001, Fig. 5). Moreover, the highest expression of NSE and MAP-2 was observed in group D. After induction, mRNA expressions of the neuronal-specific cell markers GAP-43, NCAM, and SYN-1 were significantly higher in the 3 treatment groups than those of the control group (P < 0.001, Fig. 6). Moreover, the highest mRNA expression of all 3 markers occurred in group D.
Discussion To date, several regenerative medicine studies have focused on mesenchymal stem cells. Bone-marrow-derived mesenchymal Published by NRC Research Press
Xu et al.
471
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Fig. 2. Real-time PCR mRNA analysis of the multipotent capacity of human adipose-derived stem cells. (A) Lipoprotein lipase expression 2 weeks after culturing in lipoprotein lipase inducing medium (adipogenic); (B) osteopontin expression 3 weeks after culturing in osteopontin inducing medium (osteogenic); (C) collagen type II expression 2 weeks after culturing in collagen type II inducing medium (chondrogenic). The intensity for each gene was normalized to GAPDH (control), and these experiments were repeated a minimum of 6 times. Results are the mean ± SD, n = 6; *, P < 0.01, as assessed using Student's t test.
Fig. 3. Results of the cell proliferation assay using the CCK-8 test. The Rg1 groups (B, C, and D) displayed a significantly higher value for absorbance compared with the control group (A) at every time point starting from day 2 of the study. Results are the mean ± SD, n = 6; *, P < 0.001, as assessed using ANOVA.
stem cells have been studied extensively and currently are available for clinical use. During the last decade it was recognized that fat is not only an energy reservoir but also a rich source of multipotent stem cells. Subcutaneous adipose deposits are ubiquitous and easily accessible in large quantities with a minimally invasive procedure. The lipoaspirate is discarded as medical waste, but it is a good source for isolation of autologous hASCs. It is also possible to isolate hASCs from needle biopsies of human adipose tissue or
from inguinal fat pads in mice or from other mammals (Safford et al. 2002; Tholpady et al. 2003; Peptan et al. 2006; Vidal et al. 2007; Neupane et al. 2008). The large number of multipotent cells available from adipose tissue is an essential criterion for stemcell-based therapies. Stem and progenitor cells in the uncultured stroma–vascular fraction from adipose tissue usually account for up to 3% of all cells present, and this is 2500-fold higher than the amount of stem cells present in bone marrow (Fraser et al. 2008). Published by NRC Research Press
472
Can. J. Physiol. Pharmacol. Vol. 92, 2014
Table 3. Percentage of neurite-positive hASCs and average process length (mean ± SD). Group
Neurite-positive cells (n = 10, %)
Average length of cell processes (n = 20, m)
Control 1 (no treatment for 24 h) Ginsenoside Rg1 treated for 24 h Control 2 (no treatment for 72 h) Ginsenoside Rg1 treated for 72 h
7.83±1.12 53.23±3.05** 11.08±2.14 79.32±4.51**
10.33±0.71 76.82±5.67** 30.43±1.49 136.85±9.28**
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Note: The number of neurite-positive cells is expressed as the percentage of cells with a neurite length longer than 1.5 × body diameter. **, P < 0.01 compared with the respective control, as assessed using Student's t test.
Fig. 4. Immunohistochemical staining of neuronal markers. Strong immunoreactivity to NSE (A) and nestin (B) is apparent in cells treated with 100 g/mL ginsenoside Rg1 compared with their respective controls (C and D, no ginsenoside Rg1) 72 h after induction. Scale bars = 50 m.
Fig. 5. Effects of different concentrations of ginsenoside Rg1 on neurogenic differentiation of human adipose-derived stem cells. Western blot assay of NSE (A) and MAP2 (B) expression. Results are the mean ± SD, n = 6; *, P < 0.001, as assessed using ANOVA, and further compared using the Bonferroni post-hoc test; P < 0.008333.
The in-vitro differentiation of ASCs into multiple cell types of mesodermal origin has been observed in several studies. ASCs can be cultured using serial passaging without losing their multipotent properties, and they have the capacity to maintain chromosome stability in long-term cultures (Grimes et al. 2009). Many
studies have described the ability of ASCs to develop into chondrocytes, osteoblasts, adipocytes, and myocytes (Mizuno et al. 2002; Safford et al. 2002; Zuk et al. 2002; Gimble and Guilak 2003a, 2003b; Jack et al. 2005; Strem et al. 2005; Fraser et al. 2006; Lee and Kemp 2006; Rodríguez et al. 2006). In general, the induction of Published by NRC Research Press
Xu et al.
473
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Fig. 6. Effects of different concentrations of ginsenoside Rg1 on the neurogenic differentiation of human adipose-derived stem cells as determined using real-time PCR analysis of GAP-43, NCAM, and SYN-1 mRNA expression; GAPDH was used as the control. Results are the mean + SD, n = 6; *, P < 0.001, as assessed using ANOVA, and further compared using the Bonferroni post-hoc test; P < 0.008333.
ASC differentiation in vitro is mainly achieved by culturing cells in selective media with lineage-specific induction factors. The transcriptional and molecular events triggering mesodermal lineage-specific differentiation of stem cells are well known (Liu et al. 2007; Schäffler and Büchler 2007; Davis and Zur Nieden 2008; Li et al. 2008; Karbiener et al. 2009; James et al. 2010). ASCs have also been shown to be angiogenic and hematopoietic supporting cells (Cousin et al. 2003; Miranville et al. 2004; Corre et al. 2006). In summary, the study of hASCs during the last decade has shown great potential for their application in regenerative medicine. ASCs have properties that are similar to bone marrowderived stem cells, but they can be harvested more easily and non-invasively in larger quantities. This is partly due to liposuction procedures becoming more popular in recent decades. Similar to bone-marrow-derived mesenchymal stem cells, ASCs can differentiate into osteogenic, chondrogenic, adipogenic, myogenic, neurogenic, and angiogenic lineages. ASCs also differentiate into neural lineage cells, but this differentiation ability is limited. Therefore, it is very important to develop a highly efficient method for enhancing the neurogenic differentiation capacity of hASCs. Recently, our studies have clearly verified that platelet-rich plasma (PRP) is capable of promoting cell proliferation and neurogenic differentiation of hASCs in vitro; the addition of autologous PRP could facilitate the potential use of hASCs in nerve regeneration (Li et al. 2013). Our findings showed that hASCs can be harvested easily from small amounts of fat tissue and expanded in vitro. They exhibit typical MSC characteristics (i.e., fibroblastoid morphology, multipotential capability, and the expression of a typical set of MSC surface markers). We used hASCs of 3 passages for the experiments and observed that more than 98% of cells expressed MSC markers and showed the ability to differentiate into mesodermal lineages, including osteogenic, adipogenic, and chondrogenic cells. Ginsenoside Rg1, a steroidal saponin that is abundant in ginseng, is one of the most active components of ginseng and contributes to many of its effects. Previous studies have shown that ginsenoside Rg1 can induce differentiation of mouse embryonic stem cells into neurons in vitro via the GR–MEK–ERK1/2–PI3K–Akt signaling pathway, and induce endothelial progenitor cell proliferation and angiogenesis, and inhibit their senescence (Shi et al. 2011; Wang and Kisaalita 2011; Wu et al. 2013). Shi et al. (2009) reported that administration of BDNF/ginsenosides (Rg1 and Rb1) in a differentiation medium
promoted cell survival and enhanced neurite outgrowth and synaptic marker expression during differentiation. In addition, Shi et al. (2005) found that ginsenoside-Rd (2-O--D-glucopyranosyl-(3, 12)-20-(-D-glucopyranosyloxy)-12-hydroxydammara-24-en-3-yl--Dglucopyranoside, GSRd, C48H82O18·3H2O) promotes the differentiation of neurospheres into astrocytes and increases the production of astrocytes in a dose-dependent manner. However, whether ginsenoside Rg1 can promote the neurogenic differentiation of hASCs was unknown prior to this study. In this study we administered 10, 50, or 100 g/mL of ginsenoside Rg1 to cultured hASCs and found that this supplement significantly enhanced the expression level of neural specific factors such as NSE protein (relative density from 1.86 to 4.83), MAP-2 protein (relative density from 1.24 to 4.98), GAP43 mRNA (relative density from 0.39 to 1.97), NCAM mRNA (relative density from 0.43 to 2.39), and SYN1 mRNA (relative density from 0.58 to 3.15) when hASCs were maintained in neural inductive conditioned medium for 72 h. Thus, different concentrations of ginsenoside Rg1 can promote neural phenotype differentiation in hASCs. In addition, the cell growth curves showed that supplementation with ginsenoside Rg1 promoted cell proliferation within 7 d when hASCs were undergoing neural phenotype differentiation. These findings not only demonstrate the potential use of ginsenoside Rg1 for nerve regeneration, but also support the theory that ginsenoside Rg1 has a broad range of effects on cell differentiation and proliferation. Ginsenoside Rg1 has notable neurotropic and neuroprotective effects in various models, both in vivo and in vitro (Ma et al. 2010; Fang et al. 2012; Wu et al. 2013), the mechanisms by which it affects hASC behavior are not yet fully understood and need to be explored further in future studies. Huang et al. (2007) reported that piglet ASCs can be induced to undergo morphologic and phenotypic changes consistent with developing neuronal cells. In the current study, the ASCs showed a typical neuron-like morphology and expressed the specific neuron markers MAP2,  tubulin III, and NeuN. Thus, we demonstrated a neurogenic phenotype after the in-vitro induction, but whether or not the hASCs can differentiate into neurons needs to be explored further in future studies.
Conclusions This study demonstrated that ginsenoside Rg1 is capable of promoting cell proliferation and neural phenotype differentiation of Published by NRC Research Press
474
hASCs in vitro. Thus, it may prove to be beneficial in nerve regeneration and nerve tissue engineering.
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Acknowledgements Authors' contributions: Hong-Mian Li developed the research design and evaluated all of the experimental results; Fang-Tian Xu performed research and contributed to the writing of this paper; Qing-Shui Yin and Da-Lie Liu evaluated experimental results; Hua Nan contributed new reagents and analytic tools and performed research; Shi-En Cui analyzed data and contributed to the writing of this paper; Zhi-An Han and Kun-Ming Xu performed the research. This work was financially supported by the China Postdoctoral Science Foundation (No. 20090450910) and the Medical Scientific Research Foundation of Guangdong Province, China (Nos. A2011739 and A2012814). The authors thank the Research Center of Tissue Engineering, Southern Medical University for their support, and special thanks are owed to Professor Shan Jiang. Conflict of interest: None of the authors have any financial relationships to disclose.
References Cardozo, A.J., Gómez, D.E., and Argibay, P.F. 2012. Neurogenic differentiation of human adipose-derived stem cells: Relevance of different signaling molecules, transcription factors, and key marker genes. Gene, 511(2): 427–436. doi:10.1016/j.gene.2012.09.038. PMID:23000064. Corre, J., Barreau, C., Cousin, B., Chavoin, J.P., Caton, D., Fournial, G., et al. 2006. Human subcutaneous adipose cells support complete differentiation but not self-renewal of hematopoietic progenitors. J. Cell. Physiol. 208(2): 282–288. doi:10.1002/jcp.20655. PMID:16619234. Cousin, B., André, M., Arnaud, E., Pénicaud, L., and Casteilla, L. 2003. Reconstitution of lethally irradiated mice by cells isolated from adipose tissue. Biochem. Biophys. Res. Commun. 301(4): 1016–1022. doi:10.1016/S0006-291X (03)00061-5. PMID:12589814. Davis, L.A., and Zur Nieden, N.I. 2008. Mesodermal fate decisions of a stem cell: the Wnt switch. Cell. Mol. Life Sci. 65(17): 2658–2674. doi:10.1007/s00018-0088042-1. PMID:18528633. Eggleson, K.K. 2012. Stem cell-based therapies: promises, obstacles, discordance, and the agora. Perspect. Biol. Med. 55(1): 1–25. doi:10.1353/pbm.2012.0001. PMID:22643713. Fang, F., Chen, X., Huang, T., Lue, L.F., Luddy, J.S., and Yan, S.S. 2012. Multi-faced neuroprotective effects of Ginsenoside Rg1 in an Alzheimer mouse model. Biochim. Biophys. Acta, 1822(2): 286–292. doi:10.1016/j.bbadis.2011.10.004. PMID:22015470. Fraser, J.K., Schreiber, R., Strem, B., Zhu, M., Alfonso, Z., Wulur, I., et al. 2006. Plasticity of human adipose stem cells toward endothelial cells and cardiomyocytes. Nat. Clin. Pract. Cardiovasc. Med. 3(Suppl. 1): S33-3. doi:10.1038/ ncpcardio0444. PMID:16501628. Fraser, J.K., Zhu, M., Wulur, I., and Alfonso, Z. 2008. Adipose-derived stem cells. Methods Mol. Biol. 449: 59–67. doi:10.1007/978-1-60327-169-1_4. PMID:18370083. Frattini, F., Lopes, F.R., Almeida, F.M., Rodrigues, R.F., Boldrini, L.C., Tomaz, M.A., et al. 2012. Mesenchymal stem cells in a polycaprolactone conduit promote sciatic nerve regeneration and sensory neuron survival after nerve injury. Tissue Eng. Part A, 18(19–20): 2030–2039. doi:10.1089/ten.tea. 2011.0496. PMID:22646222. Gimble, J., and Guilak, F. 2003a. Adipose-derived adult stem cells: isolation, characterization, and differentiation potential. Cytotherapy, 5(5): 362–369. doi:10.1080/14653240310003026. PMID:14578098. Gimble, J.M., and Guilak, F. 2003b. Differentiation potential of adipose derived adult stem (ADAS) cells. Curr. Top. Dev. Biol. 58: 137–160. doi:10.1016/S00702153(03)58005-X. PMID:14711015. Grimes, B.R., Steiner, C.M., Merfeld-Clauss, S., Traktuev, D.O., Smith, D., Reese, A., et al. 2009. Interphase FISH demonstrates that human adipose stromal cells maintain a high level of genomic stability in long-term culture. Stem Cells Dev. 18(5): 717–724. doi:10.1089/scd.2008.0255. PMID:18754715. Huang, T., He, D., Kleiner, G., and Kuluz, J. 2007. Neuron-like differentiation of adipose-derived stem cells from infant piglets in vitro. J. Spinal Cord Med. 30(Suppl. 1): S35–S40. PMID:17874685. Jack, G.S., Almeida, F.G., Zhang, R., Alfonso, Z.C., Zuk, P.A., and Rodríguez, L.V. 2005. Processed lipoaspirate cells for tissue engineering of the lower urinary tract: implications for the treatment of stress urinary incontinence and bladder reconstruction. J. Urol. 174(5): 2041–2045. doi:10.1097/01.ju.0000176489. 96993.84. PMID:16217390. James, A.W., Leucht, P., Levi, B., Carre, A.L., Xu, Y., Helms, J.A., et al. 2010. Sonic Hedgehog influences the balance of osteogenesis and adipogenesis in mouse adipose-derived stromal cells. Tissue Eng. Part A, 16(8): 2605–2616. doi:10. 1089/ten.tea.2010.0048. PMID:20367246. Kang, S.K., Putnam, L.A., Ylostalo, J., Popescu, I.R., Dufour, J., Belousov, A., et al.
Can. J. Physiol. Pharmacol. Vol. 92, 2014
2004. Neurogenesis of Rhesus adipose stromal cells. J. Cell Sci. 117(18): 4289– 4299. doi:10.1242/jcs.01264. PMID:15292397. Karbiener, M., Fischer, C., Nowitsch, S., Opriessnig, P., Papak, C., Ailhaud, G., et al. 2009. microRNA miR-27b impairs human adipocyte differentiation and targets PPARgamma. Biochem. Biophys. Res. Commun. 390(2): 247–251. doi: 10.1016/j.bbrc.2009.09.098. PMID:19800867. Kwon, E.B., Lee, J.Y., Piao, S., Kim, I.G., Ra, J.C., and Lee, J.Y. 2011. Comparison of human muscle-derived stem cells and human adipose-derived stem cells in neurogenic trans-differentiation. Korean J. Urol. 52(12): 852–857. doi:10.4111/ kju.2011.52.12.852. PMID:22216399. Lee, J.H., and Kemp, D.M. 2006. Human adipose-derived stem cells display myogenic potential and perturbed function in hypoxic conditions. Biochem. Biophys. Res. Commun. 341(3): 882–888. doi:10.1016/j.bbrc.2006.01.038. PMID: 16442498. Li, H.X., Luo, X., Liu, R.X., Yang, Y.J., and Yang, G.S. 2008. Roles of Wnt/betacatenin signaling in adipogenic differentiation potential of adipose-derived mesenchymal stem cells. Mol. Cell. Endocrinol. 291(1–2): 116–124. doi:10.1016/ j.mce.2008.05.005. PMID:18584948. Li, H., Han, Z., Liu, D., Zhao, P., Liang, S., and Xu, K. 2013. Autologous platelet-rich plasma promotes neurogenic differentiation of human adipose derived stem cells in vitro. Int. J. Neurosci. 123(3): 184–190. doi:10.3109/00207454.2012. 742077. PMID:23126279. Lin, T., Liu, Y., Shi, M., Liu, X., Li, L., Liu, Y., et al. 2012. Promotive effect of ginsenoside Rd on proliferation of neural stem cells in vivo and in vitro. J. Ethnopharmacol. 142(3): 754–761. doi:10.1016/j.jep.2012.05.057. PMID: 22683911. Liu, T.M., Martina, M., Hutmacher, D.W., Hui, J.H., Lee, E.H., and Lim, B. 2007. Identification of common pathways mediating differentiation of bone marrow- and adipose tissue-derived human mesenchymal stem cells into three mesenchymal lineages. Stem Cells, 25(3): 750–760. doi:10.1634/stem cells.2006-0394. PMID:17095706. Ma, J., Li, W., Tian, R., and Lei, W. 2010. Ginsenoside Rg1 promotes peripheral nerve regeneration in rat model of nerve crush injury. Neurosci. Lett. 478(2): 66–71. doi:10.1016/j.neulet.2010.04.064. PMID:20438804. Miranville, A., Heeschen, C., Sengenès, C., Curat, C.A., Busse, R., and Bouloumié, A. 2004. Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation, 110(3): 349–355. doi:10.1161/01. CIR.0000135466.16823.D0. PMID:15238461. Mizuno, H., Zuk, P.A., Zhu, M., Lorenz, H.P., Benhaim, P., and Hedrick, M.H. 2002. Myogenic differentiation by human processed lipoaspirate cells. Plast. Reconstr. Surg. 109(1): 199–209; discussion 210–211. doi:10.1097/00006534200201000-00030. PMID:11786812. Neupane, M., Chang, C.C., Kiupel, M., and Yuzbasiyan-Gurkan, V. 2008. Isolation and characterization of canine adipose-derived mesenchymal stem cells. Tissue Eng. Part A, 14(6): 1007–1015. doi:10.1089/ten.tea.2007.0207. PMID: 19230125. Peptan, I.A., Hong, L., and Mao, J.J. 2006. Comparison of osteogenic potentials of visceral and subcutaneous adipose-derived cells of rabbits. Plast. Reconstr. Surg. 117(5): 1462–1470. doi:10.1097/01.prs.0000206319.80719.74. PMID:16641714. Petrova, E.S. 2012. The use of stem cells to stimulate regeneration of damaged nerve. Tsitologiia, 54(7): 525–540. PMID:23074855. Ren, Z., Wang, Y., Peng, J., Zhao, Q., and Lu, S. 2012. Role of stem cells in the regeneration and repair of peripheral nerves. Rev. Neurosci. 23(2): 135–143. doi:10.1515/revneuro-2011-0069. PMID:22499672. Rodríguez, L.V., Alfonso, Z., Zhang, R., Leung, J., Wu, B., and Ignarro, L.J. 2006. Clonogenic multipotent stem cells in human adipose tissue differentiate into functional smooth muscle cells. Proc. Natl. Acad. Sci. U.S.A. 103(32): 12167– 12172. doi:10.1073/pnas.0604850103. PMID:16880387. Safford, K.M., Hicok, K.C., Safford, S.D., Halvorsen, Y.D., Wilkison, W.O., Gimble, J.M., et al. 2002. Neurogenic differentiation of murine and human adipose-derived stromal cells. Biochem. Biophys. Res. Commun. 294(2): 371– 379. doi:10.1016/S0006-291X(02)00469-2. PMID:12051722. Schäffler, A., and Büchler, C. 2007. Concise review: adipose tissue-derived stromal cells: basic and clinical implications for novel cell-based therapies. Stem Cells, 25(4): 818–827. doi:10.1634/stemcells.2006-0589. PMID:17420225. Shen, L., and Zhang, J. 2003. Ginsenoside Rg1 increases ischemia-induced cell proliferation and survival in the dentate gyrus of adult gerbils. Neurosci Lett. 344(1): 1–4. doi:10.1016/S0304-3940(03)00318-5. PMID:12781907. Shen, L., and Zhang, J. 2007. NMDA receptor and iNOS are involved in the effects of ginsenoside Rg1 on hippocampal neurogenesis in ischemic gerbils. Neurol. Res. 29(3): 270–273. doi:10.1179/016164107X159144. PMID:17509226. Shi, A.W., Wang, X.B., Lu, F.X., Zhu, M.M., Kong, X.Q., and Cao, K.J. 2009. Ginsenoside Rg1 promotes endothelial progenitor cell migration and proliferation. Acta Pharmacol. Sin. 30(3): 299–306. doi:10.1038/aps.2009.6. PMID: 19262553. Shi, A.W., Gu, N., Liu, X.M., Wang, X., and Peng, Y.Z. 2011. Ginsenoside Rg1 enhances endothelial progenitor cell angiogenic potency and prevents senescence in vitro. J. Int. Med. Res. 39 (4): 1306–1318. doi:10.1177/ 147323001103900418. PMID:21986132. Shi, Q., Hao, Q., Bouissac, J., Lu, Y., Tian, S., and Lu, B. 2005. Ginsenoside-Rd from Panax notoginseng enhances astrocyte differentiation from neural stem cells. Life Sci. 76(9): 983–995. doi:10.1016/j.lfs.2004.07.026. PMID:15607328. Strem, B.M., Hicok, K.C., Zhu, M., Wulur, I., Alfonso, Z., Schreiber, R.E., et al. Published by NRC Research Press
Xu et al.
mesenchymal stromal cells. Vet. Surg. 36(7): 613–622. doi:10.1111/j.1532-950X. 2007.00313.x. PMID:17894587. Wang, L., and Kisaalita, W.S. 2011. Administration of BDNF/ginsenosides combination enhanced synaptic development in human neural stem cells. J. Neurosci. Methods. 194(2): 274–282. doi:10.1016/j.jneumeth.2010.10.025. PMID: 21094185. Wu, J., Pan, Z., Cheng, M., Shen, Y., Yu, H., Wang, Q., et al. 2013. Ginsenoside Rg1 facilitates neural differentiation of mouse embryonic stem cells via GRdependent signaling pathway. Neurochem. Int. 62(1): 92–102. doi:10.1016/j. neuint.2012.09.016. PMID:23063465. Zuk, P.A., Zhu, M., Ashjian, P., De Ugarte, D.A., Huang, J.I., Mizuno, H., et al. 2002. Human adipose tissue is a source of multipotent stem cells. Mol. Biol. Cell, 13(12): 4279–4295. doi:10.1091/mbc.E02-02-0105. PMID:12475952.
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
2005. Multipotential differentiation of adipose tissue-derived stem cells. Keio J. Med. 54(3): 132–141. doi:10.2302/kjm.54.132. PMID:16237275. Taha, M.F., and Hedayati, V. 2010. Isolation, identification and multipotential differentiation of mouse adipose tissue-derived stem cells. Tissue Cell, 42(4): 211–216. doi:10.1016/j.tice.2010.04.003. PMID:20483444. Tholpady, S.S., Katz, A.J., and Ogle, R.C. 2003. Mesenchymal stem cells from rat visceral fat exhibit multipotential differentiation in vitro. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 272(1): 398–402. doi:10.1002/ar.a.10039. PMID: 12704697. Vidal, M.A., Kilroy, G.E., Lopez, M.J., Johnson, J.R., Moore, R.M., and Gimble, J.M. 2007. Characterization of equine adipose tissue-derived stromal cells: adipogenic and osteogenic capacity and comparison with bone marrow-derived
475
Published by NRC Research Press
ARTICLE
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Effect of ginsenoside Rg1 on proliferation and neural phenotype differentiation of human adipose-derived stem cells in vitro Fang-Tian Xu, Hong-Mian Li, Qing-Shui Yin, Shi-En Cui, Da-Lie Liu, Hua Nan, Zhi-An Han, and Kun-Ming Xu
Abstract: Aims: To investigate whether ginsenoside Rg1 can promote neural phenotype differentiation of human adipose-derived stem cells (hASCs) in vitro. Methods: hASCs were isolated from lipo-aspirates, and characterized by specific cell markers and multilineage differentiation capacity after culturing to the 3rd passage. Cultured hASCs were treated with neural inductive media alone (group A, control) or inductive media plus 10, 50, or 100 g/mL ginsenoside Rg1 (groups B, C, and D, respectively). Cell proliferation was assessed by CCK-8 assay. Neuron specific enolase (NSE) and microtubule-associated protein-2 (MAP-2) levels were measured by Western blot. mRNA levels of growth associated protein-43 (GAP-43), neural cell adhesion molecule (NCAM), and synapsin-1 (SYN-1) were determined by real-time PCR. Results: Ginsenoside Rg1 promoted the proliferation of hASCs (groups B, C, and D) and resulted in higher expression of NSE and MAP-2 compared with the control group. Gene expression levels of GAP-43, NCAM, and SYN-1 in the test groups were higher than that in thw control. The results displayed a dose-dependent effect of ginsenoside Rg1 on cell proliferation and neural phenotype differentiation. Conclusion: This study indicated that ginsenoside Rg1 promotes cell proliferation and neural phenotype differentiation of hASCs in vitro, suggesting a potential use for hASCs in neural regeneration medicine. Key words: adipose-derived stem cells, cell therapy, induced differentiation, neural regeneration, ginsenoside Rg1, cell proliferation, neural phenotype. Résumé : Buts : Examiner si le ginsénoside Rg1 peut promouvoir la différenciation des cellules souches humaines dérivées du tissu adipeux (ou hASC pour human adipose-derived stem cells) vers un phénotype neural in vitro. Méthodes : les hASC ont été isolées a` partir de lipo-aspirations et caractérisées a` l'aide de marqueurs cellulaires spécifiques et selon leur capacité de différenciation en lignages multiples après une culture jusqu'au 3ième passage. Les hACS en culture ont été traitées avec un milieu induisant un phénotype neural (groupe A, contrôle), ou un milieu inducteur comprenant 10, 50, ou 100 g/mL de ginsenoside Rg1 (groupes B, C et D, respectivement). La prolifération cellulaire a été évaluée a` l'aide d'un dosage CCK-8. Les niveaux d'énolase spécifique au neurone NSE et de la protéine associée aux microtubules MAP-2 ont été mesurés par buvardage Western. Les niveaux d'ARNm de la protéine GAP-43, de la molécule d'adhésion NCAM et de la synapsine-1 (SYN-1) ont été déterminés par PCR en temps réel. Résultats : Le ginsénoside Rg1 pouvait promouvoir la prolifération des hASC (groupes B, C, et D), ce qui résultait en une expression accrue de NSE et de MAP-2 comparativement au groupe contrôle. Les niveaux d'expression génique de GAP-43, NCAM et SYN-1 dans les groupes test étaient supérieurs a` ceux du groupe contrôle. Les résultats montraient un effet dépendant de la concentration du ginsénoside Rg1 sur la prolifération cellulaire et la différenciation vers un phénotype neural. Conclusion : Cette étude a indiqué que le ginsénoside Rg1 peut promouvoir la prolifération et la différenciation des hASC vers un phénotype neural in vitro, suggérant que les hASC pourraient possiblement être utilisées en neurologie régénérative. [Traduit par la Rédaction] Mots-clés : cellules souches dérivées du tissu adipeux, thérapie cellulaire, différenciation induite, régénération neurale, ginsénoside Rg1, prolifération cellulaire, phénotype neural.
Introduction Injuries to the nervous system are very common and represent a major health problem worldwide. It has been estimated that approximately 90 000 people suffer from such conditions every year in China. Among these, spinal-cord injuries affect more than 10 000 people. Although the peripheral nervous system possesses
an intrinsic ability to regenerate, the injured nerve usually cannot reach full functional rehabilitation, even after surgical interventions. The central nervous system is incapable of self-repair, and to date no treatments are available for the complete recovery of human nerve functions. Regenerative medicine, which describes the process of creating living, functional tissues to repair or replace tissue or organ function, utilizes stem cells that have been
Received 18 November 2013. Accepted 30 March 2014. F.-T. Xu.* Southern Medical University, Guangzhou 510515, China; Department of Orthopedics, the First Affiliated Hospital of Gannan Medical University, Ganzhou 341000, China. H.-M. Li.* Department of Plastic and Aesthetic Surgery, Zhongshan Bo'ai Hospital of Southern Medical University, Zhongshan 528403, China. Q.-S. Yin. Southern Medical University, Guangzhou 510515, China; Department of Orthopedic Surgery, Guangzhou General Hospital of PLA, Guangzhou 510180, China. S.-E. Cui and K.-M. Xu. Department of Mammary Gland Surgery, Zhongshan Hospital of Sun Yat-Sen University, Zhongshan 528403, China. D.-L. Liu and H. Nan. Department of Plastic and Reconstructive Surgery, Zhujiang Hospital of Southern Medical University, Guangzhou 510282, China. Z.-A. Han. Department of Neurosurgery, Zhongshan Hospital of Sun Yat-Sen University, Zhongshan 528403, China. Corresponding authors: Hong-Mian Li (e-mails: [email protected]) and Qing-Shui Yin (e-mail: [email protected]). *Hong-Mian Li, Qing-Shui Yin, and Fang-Tian Xu contributed equally as co-first authors. Can. J. Physiol. Pharmacol. 92: 467–475 (2014) dx.doi.org/10.1139/cjpp-2013-0377
Published at www.nrcresearchpress.com/cjpp on 17 April 2014.
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
468
widely documented for their potential to treat nervous system injuries (Eggleson 2012; Frattini et al. 2012; Petrova 2012; Ren et al. 2012). There are several possible sources of stem cells. Among them, adult mesenchymal stem cells are very attractive owing to their distinct advantages over other stem cells. Compared with embryonic stem cells, adult mesenchymal stem cells are much easier to harvest and have fewer ethical implications. Compared with progenitor or precursor cells, adult mesenchymal stem cells have the ability to undergo multilineage differentiation. Finally, most mesenchymal stem cells have strong proliferative capacity, which is important for their potential clinical applications. There are many potential sources of mesenchymal stem cells. Currently, they can be harvested from bone marrow, adipose tissue, muscle, dermal skin, and hair follicles. Among these potential sources, adipose tissue may be the most suitable for clinical applications. Adipose tissue is readily available because of plastic surgery, which has become popular in many societies. The pluripotency and proliferative capacity of human adipose-derived stem cells (hASCs) are similar to those of bone marrow-derived stem cells. ASCs have also been proven to be capable of neurogenic differentiation, and experimental studies in animal models have demonstrated their potential use in nerve regeneration therapy (Kang et al. 2004; Taha and Hedayati 2010; Kwon et al. 2011; Cardozo et al. 2012). Other compounds in combination with ASCs may prove to enhance their neurogenic effects. For example, ginsenoside Rg1, a steroidal saponin that is abundant in ginseng, is one of the most active components in ginseng. Previous studies have demonstrated that ginsenoside enhances the proliferation and differentiation of neural stem cells (Shi et al. 2005; Lin et al. 2012). More specifically, Rg1 has been shown to exhibit neurotropic and neuroprotective effects in various models, both in vivo and in vitro (Wu et al. 2013), and it has been found to regulate the proliferation of neural progenitor cells. Moreover, Rg1 increased neurogenesis after transient global ischemia in the dentate gyrus of adult gerbils (Shen and Zhang 2003, 2007). However, the mechanism and potential role of Rg1 in neuronal lineage commitment and its ability to affect hASC behavior is not well understood. Therefore, in this study, ginsenoside Rg1 was used as a supplement in cell cultures to test its ability to promote proliferation and neural phenotype differentiation of hASCs.
Materials and methods Isolation and characterization of hASCs hASCs were isolated from lipo-aspirates obtained during liposuction procedures, with consent given by the patients. The fat portion of the lipo-aspirates was washed with phosphate buffered saline (PBS) to eliminate red blood cells. The adipose tissue was finely minced and digested with 0.1% collagenase at 37 °C for 60 min by vigorous shaking. After centrifugation at 260g for 5 min, the cell pellet was resuspended with Dulbecco's modified Eagle medium (DMEM) plus 15% fetal bovine serum (FBS). The isolated cells were seeded onto culture dishes and incubated at 37 °C in 5% carbon dioxide. The first medium change was carried out at 24 h after seeding, and non-adherent cells were discarded; the medium was subsequently replaced every 3 d. Cultured cells were observed using a microscope to assess expansion and cell morphology. Cells were harvested at 80%–90% confluence and passaged at a ratio of 1:3. To confirm the multilineage differentiation capacity of the isolated hASCs, subconfluent hASCs from the 3rd passage were cultured using osteogenic, adipogenic, and chondrogenic inductive media (Table 1). After 2 or 3 weeks of induction, differentiation of the hASCs was detected using the relevant his-
1
Can. J. Physiol. Pharmacol. Vol. 92, 2014
tological assays combined with assessment of mRNA expression of lipoprotein lipase, osteopontin, and collagen type II using realtime PCR. Immunofluorescence and immunohistochemistry To identify specific cellular surface markers, CD29, CD34, CD44, CD45, CD73, and CD90 immunofluorescence staining was performed on hASCs at the 3rd passage. The primary antibodies used were monoclonal mouse anti-human (1:200; Sigma, Santa Clara, California, USA), and the secondary antibodies were goat antimouse IgG-Cy3 (CD29, CD34) or IgG-FITC (CD44, CD45, CD73, and CD90) (all 1:100; Sigma). The nuclei of the CD73 stained hASCs were counterstained with propidium iodide, whereas those of CD29, CD34, CD44, CD45, and CD90 were counterstained with 4=,6-diamidino-2-phenylindole, hydrochloride. To specifically identify neuronal markers, nestin and neuron specific enolase (NSE) immunohistochemical analyses were run on hASCs. The primary antibodies used were mouse anti-human NSE monoclonal antibody and mouse anti-human nestin monoclonal antibody (both 1:200; Sigma). The secondary antibody was biotin-goat anti-mouse IgG (1:100; Sigma). Preparation of ginsenoside Rg1 Ginsenoside Rg1 (protopanaxatriol extract monomer; Sigma), which is a colorless semi-crystalline material, was easily dissolved in pyridine and acetone (both 100 g/mL, final concentration). The chemical name of ginsenoside Rg1 is (3,6␣, 12)-20-(-D-glucopyranosyloxy)-3,12-dihydroxydammar-24-en-6yl-(-D-glucopyranoside). The molecular formula is C42H72O14, the molecular weight is 801.01, and the chemical structure formula is presented in the Supplementary data1. Effect of ginsenoside Rg1 on hASC morphology and neurite outgrowth hASCs that were obtained after the 3rd passage were seeded onto 6-well culture plates. The culture medium was discarded when the cells were at 70%–80% confluence. Cells were assigned either to the control group (A) or to one of 3 test groups (B, C, or D). All groups were exposed to pre-induction medium (high glucose DMEM, 0.5 g/mL bFGF, and 10% FBS), which was discarded after 6 h. Following PBS washing, the treatment groups were incubated with neural inductive conditioned medium (high glucose DMEM without FBS, 100 mol/L butylatedhydroxyanisole) plus 10 g/mL ginsenoside Rg1 (group B), 50 g/mL ginsenoside Rg1 (group C), or 100 g/mL ginsenoside Rg1 (group D); the control group (group A) was exposed to neural inductive conditioned medium plus drug vehicle only. Cellular morphology and neurite growth were observed every 24 h under a phase-contrast microscope, and 3-dimensional patterns were observed using an inverted phasecontrast microscope. To measure neurite length, one image from each test group and one from the control group was taken from each visual field after 72 h. Neurite length was measured using the DM16000B image analysis system (Leica, Somme, Germany). The presence of neurites was assessed in 100 random cells to calculate the percentage of neurite-positive cells (as determined by a neurite length longer than 1.5 × body diameter). Effect of ginsenoside Rg1 on hASC proliferation hASCs at passage 3 were harvested and seeded onto 96-well culture plates for the proliferation assay. The CCK-8 test (Cell Counting Kit-8, Dojindo Laboratories, Kyoto, Japan) was performed daily for 7 d to obtain growth curves for treatment and control groups. This test is based on a colorimetric assay and utilizes a highly water-soluble tetrazolium salt (ST-8[2-(2-methyxy4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium,
Supplementary data are available with the article through the journal Web site at http://nrcresearchpress.com/doi/suppl/10.1139/cjpp-2013-0377. Published by NRC Research Press
Xu et al.
469
Table 1. Multilineage induction of ASCs.
Adipogenic
Osteogenic
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Chondrogenic
Induction
Characterization
DMEM (high glucose), 10% FBS, 1% antibiotic/antimycotic, 200 mol/L indomethacin, 0.5 mmol/L isobutyl–methylxanthine (IBMX), 1 mol/L dexamethasone, 10 mol/L insulin DMEM (high glucose), 10% FBS, 1% antibiotic/antimycotic, 0.1 mol/L dexamethasone, 50 mol/L ascorbate-2-phosphate, 10 mmol/L b-glycerophosphate DMEM (high glucose), 1% FBS, 10 ng/mL TGF-1, 1% antibiotic/antimycotic, 6.25 g/mL insulin, 50 nmol/L ascorbate-2-phosphate
Oil red O staining and mRNA lipoprotein analysis by RT-PCR Alizarin red staining and mRNA osteopontin analysis by RT-PCR Alcian blue staining and mRNA collagen type II analysis by RT-PCR
Table 2. Primer sequences. Gene name (human)
Forward primer sequence (5= to 3=)
Reverse primer sequence (5= to 3=)
GAP-43 NCAM SYN-1 Lipoprotein lipase Osteopontin Collagen type II GAPDH
GGATGGCTCTGCTACTAC CGACGTTGGAGAGTCCAAAT CTTCAGCAGCATCATCCAGAC AAGGTCAGAGCCAAGAGAAGCA CACCTGTGCCATACCAGTTAA GGCAATAGCAGGTTCACGTACA GGTGAAGGTCGGAGTCAACG
GTCGGCTTGTTTAGGCTC TTAAACTCCTGTGGGGTTGG CACCTTGGTCGTGGATCATCATAGC CCAGAAAAGTGAATCTTGACTTGGT GGTGATGTCCTCGTCTGTAGCATC CGATAACAGTCTTGCCCCACTT CAAAGTTGTCATGGATGHACC
monosodium salt]). To assess viability, cells were plated in 24-well plates at a density of 1 × 105 cells per well in 200 L of growth medium. After 24 h, 15 L of CCK-8 reagent were added to each well and incubated at 37 °C for 2 h. After centrifugation, 100 L of supernatant were transferred to 96-well microtiter plates and optical density (O.D.) was measured at 450 nm. CCK-8 is a one-bottle solution; no premixing of components is required. Being nonradioactive, CCK-8 allows sensitive colorimetric assays for the determination of the number of the viable cells in cell proliferation and cytotoxicity assays. WST-8* is reduced by dehydrogenases in the cells, yielding an orange colored formazan, which is soluble in the tissue culture medium. The amount of the formazan dye generated by dehydrogenases in cells is directly proportional to the number of living cells. The cells were pretreated with 1.0 mmol/L N-acetyl cysteine (NAC; Sigma) 30 min before the treatments. Protein extraction and Western blotting Seventy-two hours after induction, 10 samples collected from the control and each treatment group were harvested for Western blot analysis. Whole cell extracts were obtained from all 4 groups of differentiated hASCs. Briefly, confluent cells were washed with ice-cold PBS and removed by scraping. Cell pellets were sonicated in the extraction buffer. Extracts were quantified using the BioRad DC protein assay kit (BioRad, Hercules, Calif.). Equal amounts of protein were resolved on 4%–12% SDS–PAGE and transferred to PVDF membranes (Millipore, Bedford, Massachusetts, USA). Membranes were blocked with blocking solution (Pierce, Rockford, Illinois, USA). Primary antibodies used were: anti-human NSE, anti-human microtubule-associated protein-2 (MAP-2) (all from Abcam, London, UK). Horseradish-peroxidase-conjugated secondary antibody and enhanced chemiluminescence substrate (Supersignal West Dura Detection System; Pierce) were used for the detection of the primary antibody. RNA extraction and real-time PCR Seventy-two hours after induction, RT-PCR was performed for lipoprotein lipase, osteopontin, collagen type II, growth associated protein-43 (GAP-43), neural cell adhesion molecule (NCAM), and synapsin-1 (SYN-1). Total RNA was isolated from monolayer cultures using Ultraspec RNA purification reagent (Biotecx, Houston, Texas, USA) according to the manufacturer's instructions. Two micrograms of total RNA were reverse-transcribed using SuperScript II (Life Technologies, Rockville, Maryland, USA) random primers (n = 6).
Quantitative RT-PCR was performed with an MJ Research Opticon 2 RT-PCR machine following the manufacturer's recommended protocol and using the DyNamo SYBR green Q-PCR kit (MJ Research, Reno, Nevada, USA). Melting curve analysis and agarose gel electrophoresis were performed to ensure the purity of PCR products. The primers used are reported in Table 2. Total RNA was extracted using the TRIzol reagent (Life Technologies, Grand Island, New York, USA) in combination with the PureLink RNA Mini Kit (Life Technologies) according to the manufacturer's instructions. RNA was treated with TurboDNAse (Life Technologies) according to manufacturer's instructions. The purified RNA (10 ng/mL) was reverse transcribed with the High Capacity cDNA Reverse Transcription (RT) kit (Life Technologies) under the following conditions: 25 °C for 10 min, 37 °C for 120 min, followed by 85 °C for 5 min. To identify potential genomic DNA contamination, controls with no enzyme were evaluated. The PCR reactions were performed on an Applied Biosystems StepOnePlus PCR machine using 5 L SYBR Green PCR Master Mix (Life Technologies), 2 L sequence specific primers (0.5 mmol/L, GAPDH was used at 0.25 mmol/L, Table 1), and 3 L cDNA (cDNA dilutions: ADIPQ, ALPL, FABP4, OPN =10-fold; BGLAP = 5-fold; COL1A1, LEP = 31-fold) under the following conditions: 95 °C for 10 min followed by 40 cycles of 15 s of denaturation at 95 °C and 60 s of annealing and elongation at 60 °C. A melting curve analysis was performed after each run to confirm product specificity. The ⌬⌬CT method was employed to determine the relative gene expression level of the gene of interest, normalized to the endogenous controls glyceraldehyde-3-phosphate (GAPDH) and ribosomal protein L13A (RPL13A). Statistical significance was determined using a 2-way ANOVA to compare the treatments and time points followed by Newman–Keuls' post-hoc comparison of groups. Statistical analyses Experiments were repeated 6 times, and results are the mean ± SD. Results of the RT-PCR and Western blot assays were compared using the unpaired Student's t test and ANOVA; values for P < 0.05 were considered to be statistically significant. All statistical analyses were performed using SPSS 16.0 (SPSS, Chicago, Ill.).
Results Characterization and pluripotency of hASCs Cultured hASCs were expanded after plating or flasking and grown to confluence. After approximately 2 weeks, the cultured cells became more uniform and grew as a monolayer with typical Published by NRC Research Press
470
Can. J. Physiol. Pharmacol. Vol. 92, 2014
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Fig. 1. Characterization of human adipose-derived stem cells (hASCs) prior to and following induction. (A) hASCs at passage 3 were marked with the following: (B) oil red O following adipogenic induction for 2 weeks; (C) alizarin red staining following osteogenic induction for 3 weeks; (D) alcian blue staining following chondrogenic induction for 2 weeks; (E–J) immunofluorescence staining for CD29, CD34, CD44, CD45, CD73, and CD90, respectively. Scale bars = 100 m (A, C, E, F, G, H, I, and J); 20 m (B and D).
fibroblast-like morphology (Fig. 1A), showing strong proliferative ability. Cultured cells can be passaged 7 days after seeding and then passaged every 2–3 d. When cultured in lineage-specific media for 2–3 weeks, hASCs stained positively for oil Red-O, alizarin red, and alcian blue following adipogenic, osteogenic, and chondrogenic induction, respectively (Figs. 1B–1D). Immunofluorescence staining of hASCs after the 3rd passage showed that these cells expressed the well-accepted mesenchymal stem cell markers CD29, CD44, CD73, and CD90 (Fig. 1 E, G, I, and J), whereas they did not express the hematopoietic cell markers CD34 and CD45 (Figs. 1F and 1H). Moreover, mRNA expression of lipoprotein lipase, osteopontin, and collagen type II was evaluated by RT-PCR analysis after adipogenic, osteogenic, and chondrogenic induction, respectively. The intensity of each gene was normalized to GAPDH (internal control), and these experiments were repeated a minimum of 6 times. The relative densities (mRNA/GAPDH) of lipoprotein lipase, osteopontin, and collagen type II in the inducted groups were clearly higher than those in the control group (P < 0.001, Figs. 2A–2C). Influence of ginsenoside Rg1 on cell proliferation of hASCs During the neurogenic induction process, CCK-8 tests were performed on the 3 test groups of hASCs (i.e., exposed to 10, 50, or 100 g/mL of ginsenoside Rg1) and the vehicle-only control group. The results, expressed as growth curves, clearly demonstrated that ginsenoside Rg1 promoted cell proliferation of hASCs during the neurogenic differentiation process. Beginning 3 d after treatment, the proliferation rate of the ginsenoside Rg1 groups (A, B, and C) was significantly higher than that of the control group (P < 0.001, Fig. 3). The results show that ginsenoside Rg1 has obvious positive dose-dependant dose effects on cell proliferation.
Effects of ginsenoside Rg1 on neurogenic differentiation of hASCs After hASCs were exposed to 10, 50, or 100 g/mL of ginsenoside Rg1 for 24 h, cellular morphology began to change: the cytoplasm decreased in size, cells exhibited a typical perikarya shape, and displayed pseudopodia, and the percentage of neurite-positive cells was significantly higher than that of the control group (P < 0.01, Table 3). After 72 h, the majority of cells became bipolar or multipolar neuron-like cells, displaying long neurites similar to those of axons or dendrites. These cells were positive for NSE and nestin (Fig. 4). Some cells were connected in a network structure, and the percentage of neurite-positive cells was still significantly increased at this time point (Table 3). This finding suggests that ginsenoside Rg1 promoted the outgrowth of neuronal-like structures in hASCs. Seventy-two hours after neurogenic induction, NSE and MAP-2 protein expression were measured in the treatment and control groups by Western blot analysis. The expression of both proteins was significantly increased when the inductive medium was supplemented with 10–100 g/mL of ginsenoside Rg1 compared with the control group (P < 0.001, Fig. 5). Moreover, the highest expression of NSE and MAP-2 was observed in group D. After induction, mRNA expressions of the neuronal-specific cell markers GAP-43, NCAM, and SYN-1 were significantly higher in the 3 treatment groups than those of the control group (P < 0.001, Fig. 6). Moreover, the highest mRNA expression of all 3 markers occurred in group D.
Discussion To date, several regenerative medicine studies have focused on mesenchymal stem cells. Bone-marrow-derived mesenchymal Published by NRC Research Press
Xu et al.
471
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Fig. 2. Real-time PCR mRNA analysis of the multipotent capacity of human adipose-derived stem cells. (A) Lipoprotein lipase expression 2 weeks after culturing in lipoprotein lipase inducing medium (adipogenic); (B) osteopontin expression 3 weeks after culturing in osteopontin inducing medium (osteogenic); (C) collagen type II expression 2 weeks after culturing in collagen type II inducing medium (chondrogenic). The intensity for each gene was normalized to GAPDH (control), and these experiments were repeated a minimum of 6 times. Results are the mean ± SD, n = 6; *, P < 0.01, as assessed using Student's t test.
Fig. 3. Results of the cell proliferation assay using the CCK-8 test. The Rg1 groups (B, C, and D) displayed a significantly higher value for absorbance compared with the control group (A) at every time point starting from day 2 of the study. Results are the mean ± SD, n = 6; *, P < 0.001, as assessed using ANOVA.
stem cells have been studied extensively and currently are available for clinical use. During the last decade it was recognized that fat is not only an energy reservoir but also a rich source of multipotent stem cells. Subcutaneous adipose deposits are ubiquitous and easily accessible in large quantities with a minimally invasive procedure. The lipoaspirate is discarded as medical waste, but it is a good source for isolation of autologous hASCs. It is also possible to isolate hASCs from needle biopsies of human adipose tissue or
from inguinal fat pads in mice or from other mammals (Safford et al. 2002; Tholpady et al. 2003; Peptan et al. 2006; Vidal et al. 2007; Neupane et al. 2008). The large number of multipotent cells available from adipose tissue is an essential criterion for stemcell-based therapies. Stem and progenitor cells in the uncultured stroma–vascular fraction from adipose tissue usually account for up to 3% of all cells present, and this is 2500-fold higher than the amount of stem cells present in bone marrow (Fraser et al. 2008). Published by NRC Research Press
472
Can. J. Physiol. Pharmacol. Vol. 92, 2014
Table 3. Percentage of neurite-positive hASCs and average process length (mean ± SD). Group
Neurite-positive cells (n = 10, %)
Average length of cell processes (n = 20, m)
Control 1 (no treatment for 24 h) Ginsenoside Rg1 treated for 24 h Control 2 (no treatment for 72 h) Ginsenoside Rg1 treated for 72 h
7.83±1.12 53.23±3.05** 11.08±2.14 79.32±4.51**
10.33±0.71 76.82±5.67** 30.43±1.49 136.85±9.28**
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Note: The number of neurite-positive cells is expressed as the percentage of cells with a neurite length longer than 1.5 × body diameter. **, P < 0.01 compared with the respective control, as assessed using Student's t test.
Fig. 4. Immunohistochemical staining of neuronal markers. Strong immunoreactivity to NSE (A) and nestin (B) is apparent in cells treated with 100 g/mL ginsenoside Rg1 compared with their respective controls (C and D, no ginsenoside Rg1) 72 h after induction. Scale bars = 50 m.
Fig. 5. Effects of different concentrations of ginsenoside Rg1 on neurogenic differentiation of human adipose-derived stem cells. Western blot assay of NSE (A) and MAP2 (B) expression. Results are the mean ± SD, n = 6; *, P < 0.001, as assessed using ANOVA, and further compared using the Bonferroni post-hoc test; P < 0.008333.
The in-vitro differentiation of ASCs into multiple cell types of mesodermal origin has been observed in several studies. ASCs can be cultured using serial passaging without losing their multipotent properties, and they have the capacity to maintain chromosome stability in long-term cultures (Grimes et al. 2009). Many
studies have described the ability of ASCs to develop into chondrocytes, osteoblasts, adipocytes, and myocytes (Mizuno et al. 2002; Safford et al. 2002; Zuk et al. 2002; Gimble and Guilak 2003a, 2003b; Jack et al. 2005; Strem et al. 2005; Fraser et al. 2006; Lee and Kemp 2006; Rodríguez et al. 2006). In general, the induction of Published by NRC Research Press
Xu et al.
473
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Fig. 6. Effects of different concentrations of ginsenoside Rg1 on the neurogenic differentiation of human adipose-derived stem cells as determined using real-time PCR analysis of GAP-43, NCAM, and SYN-1 mRNA expression; GAPDH was used as the control. Results are the mean + SD, n = 6; *, P < 0.001, as assessed using ANOVA, and further compared using the Bonferroni post-hoc test; P < 0.008333.
ASC differentiation in vitro is mainly achieved by culturing cells in selective media with lineage-specific induction factors. The transcriptional and molecular events triggering mesodermal lineage-specific differentiation of stem cells are well known (Liu et al. 2007; Schäffler and Büchler 2007; Davis and Zur Nieden 2008; Li et al. 2008; Karbiener et al. 2009; James et al. 2010). ASCs have also been shown to be angiogenic and hematopoietic supporting cells (Cousin et al. 2003; Miranville et al. 2004; Corre et al. 2006). In summary, the study of hASCs during the last decade has shown great potential for their application in regenerative medicine. ASCs have properties that are similar to bone marrowderived stem cells, but they can be harvested more easily and non-invasively in larger quantities. This is partly due to liposuction procedures becoming more popular in recent decades. Similar to bone-marrow-derived mesenchymal stem cells, ASCs can differentiate into osteogenic, chondrogenic, adipogenic, myogenic, neurogenic, and angiogenic lineages. ASCs also differentiate into neural lineage cells, but this differentiation ability is limited. Therefore, it is very important to develop a highly efficient method for enhancing the neurogenic differentiation capacity of hASCs. Recently, our studies have clearly verified that platelet-rich plasma (PRP) is capable of promoting cell proliferation and neurogenic differentiation of hASCs in vitro; the addition of autologous PRP could facilitate the potential use of hASCs in nerve regeneration (Li et al. 2013). Our findings showed that hASCs can be harvested easily from small amounts of fat tissue and expanded in vitro. They exhibit typical MSC characteristics (i.e., fibroblastoid morphology, multipotential capability, and the expression of a typical set of MSC surface markers). We used hASCs of 3 passages for the experiments and observed that more than 98% of cells expressed MSC markers and showed the ability to differentiate into mesodermal lineages, including osteogenic, adipogenic, and chondrogenic cells. Ginsenoside Rg1, a steroidal saponin that is abundant in ginseng, is one of the most active components of ginseng and contributes to many of its effects. Previous studies have shown that ginsenoside Rg1 can induce differentiation of mouse embryonic stem cells into neurons in vitro via the GR–MEK–ERK1/2–PI3K–Akt signaling pathway, and induce endothelial progenitor cell proliferation and angiogenesis, and inhibit their senescence (Shi et al. 2011; Wang and Kisaalita 2011; Wu et al. 2013). Shi et al. (2009) reported that administration of BDNF/ginsenosides (Rg1 and Rb1) in a differentiation medium
promoted cell survival and enhanced neurite outgrowth and synaptic marker expression during differentiation. In addition, Shi et al. (2005) found that ginsenoside-Rd (2-O--D-glucopyranosyl-(3, 12)-20-(-D-glucopyranosyloxy)-12-hydroxydammara-24-en-3-yl--Dglucopyranoside, GSRd, C48H82O18·3H2O) promotes the differentiation of neurospheres into astrocytes and increases the production of astrocytes in a dose-dependent manner. However, whether ginsenoside Rg1 can promote the neurogenic differentiation of hASCs was unknown prior to this study. In this study we administered 10, 50, or 100 g/mL of ginsenoside Rg1 to cultured hASCs and found that this supplement significantly enhanced the expression level of neural specific factors such as NSE protein (relative density from 1.86 to 4.83), MAP-2 protein (relative density from 1.24 to 4.98), GAP43 mRNA (relative density from 0.39 to 1.97), NCAM mRNA (relative density from 0.43 to 2.39), and SYN1 mRNA (relative density from 0.58 to 3.15) when hASCs were maintained in neural inductive conditioned medium for 72 h. Thus, different concentrations of ginsenoside Rg1 can promote neural phenotype differentiation in hASCs. In addition, the cell growth curves showed that supplementation with ginsenoside Rg1 promoted cell proliferation within 7 d when hASCs were undergoing neural phenotype differentiation. These findings not only demonstrate the potential use of ginsenoside Rg1 for nerve regeneration, but also support the theory that ginsenoside Rg1 has a broad range of effects on cell differentiation and proliferation. Ginsenoside Rg1 has notable neurotropic and neuroprotective effects in various models, both in vivo and in vitro (Ma et al. 2010; Fang et al. 2012; Wu et al. 2013), the mechanisms by which it affects hASC behavior are not yet fully understood and need to be explored further in future studies. Huang et al. (2007) reported that piglet ASCs can be induced to undergo morphologic and phenotypic changes consistent with developing neuronal cells. In the current study, the ASCs showed a typical neuron-like morphology and expressed the specific neuron markers MAP2,  tubulin III, and NeuN. Thus, we demonstrated a neurogenic phenotype after the in-vitro induction, but whether or not the hASCs can differentiate into neurons needs to be explored further in future studies.
Conclusions This study demonstrated that ginsenoside Rg1 is capable of promoting cell proliferation and neural phenotype differentiation of Published by NRC Research Press
474
hASCs in vitro. Thus, it may prove to be beneficial in nerve regeneration and nerve tissue engineering.
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
Acknowledgements Authors' contributions: Hong-Mian Li developed the research design and evaluated all of the experimental results; Fang-Tian Xu performed research and contributed to the writing of this paper; Qing-Shui Yin and Da-Lie Liu evaluated experimental results; Hua Nan contributed new reagents and analytic tools and performed research; Shi-En Cui analyzed data and contributed to the writing of this paper; Zhi-An Han and Kun-Ming Xu performed the research. This work was financially supported by the China Postdoctoral Science Foundation (No. 20090450910) and the Medical Scientific Research Foundation of Guangdong Province, China (Nos. A2011739 and A2012814). The authors thank the Research Center of Tissue Engineering, Southern Medical University for their support, and special thanks are owed to Professor Shan Jiang. Conflict of interest: None of the authors have any financial relationships to disclose.
References Cardozo, A.J., Gómez, D.E., and Argibay, P.F. 2012. Neurogenic differentiation of human adipose-derived stem cells: Relevance of different signaling molecules, transcription factors, and key marker genes. Gene, 511(2): 427–436. doi:10.1016/j.gene.2012.09.038. PMID:23000064. Corre, J., Barreau, C., Cousin, B., Chavoin, J.P., Caton, D., Fournial, G., et al. 2006. Human subcutaneous adipose cells support complete differentiation but not self-renewal of hematopoietic progenitors. J. Cell. Physiol. 208(2): 282–288. doi:10.1002/jcp.20655. PMID:16619234. Cousin, B., André, M., Arnaud, E., Pénicaud, L., and Casteilla, L. 2003. Reconstitution of lethally irradiated mice by cells isolated from adipose tissue. Biochem. Biophys. Res. Commun. 301(4): 1016–1022. doi:10.1016/S0006-291X (03)00061-5. PMID:12589814. Davis, L.A., and Zur Nieden, N.I. 2008. Mesodermal fate decisions of a stem cell: the Wnt switch. Cell. Mol. Life Sci. 65(17): 2658–2674. doi:10.1007/s00018-0088042-1. PMID:18528633. Eggleson, K.K. 2012. Stem cell-based therapies: promises, obstacles, discordance, and the agora. Perspect. Biol. Med. 55(1): 1–25. doi:10.1353/pbm.2012.0001. PMID:22643713. Fang, F., Chen, X., Huang, T., Lue, L.F., Luddy, J.S., and Yan, S.S. 2012. Multi-faced neuroprotective effects of Ginsenoside Rg1 in an Alzheimer mouse model. Biochim. Biophys. Acta, 1822(2): 286–292. doi:10.1016/j.bbadis.2011.10.004. PMID:22015470. Fraser, J.K., Schreiber, R., Strem, B., Zhu, M., Alfonso, Z., Wulur, I., et al. 2006. Plasticity of human adipose stem cells toward endothelial cells and cardiomyocytes. Nat. Clin. Pract. Cardiovasc. Med. 3(Suppl. 1): S33-3. doi:10.1038/ ncpcardio0444. PMID:16501628. Fraser, J.K., Zhu, M., Wulur, I., and Alfonso, Z. 2008. Adipose-derived stem cells. Methods Mol. Biol. 449: 59–67. doi:10.1007/978-1-60327-169-1_4. PMID:18370083. Frattini, F., Lopes, F.R., Almeida, F.M., Rodrigues, R.F., Boldrini, L.C., Tomaz, M.A., et al. 2012. Mesenchymal stem cells in a polycaprolactone conduit promote sciatic nerve regeneration and sensory neuron survival after nerve injury. Tissue Eng. Part A, 18(19–20): 2030–2039. doi:10.1089/ten.tea. 2011.0496. PMID:22646222. Gimble, J., and Guilak, F. 2003a. Adipose-derived adult stem cells: isolation, characterization, and differentiation potential. Cytotherapy, 5(5): 362–369. doi:10.1080/14653240310003026. PMID:14578098. Gimble, J.M., and Guilak, F. 2003b. Differentiation potential of adipose derived adult stem (ADAS) cells. Curr. Top. Dev. Biol. 58: 137–160. doi:10.1016/S00702153(03)58005-X. PMID:14711015. Grimes, B.R., Steiner, C.M., Merfeld-Clauss, S., Traktuev, D.O., Smith, D., Reese, A., et al. 2009. Interphase FISH demonstrates that human adipose stromal cells maintain a high level of genomic stability in long-term culture. Stem Cells Dev. 18(5): 717–724. doi:10.1089/scd.2008.0255. PMID:18754715. Huang, T., He, D., Kleiner, G., and Kuluz, J. 2007. Neuron-like differentiation of adipose-derived stem cells from infant piglets in vitro. J. Spinal Cord Med. 30(Suppl. 1): S35–S40. PMID:17874685. Jack, G.S., Almeida, F.G., Zhang, R., Alfonso, Z.C., Zuk, P.A., and Rodríguez, L.V. 2005. Processed lipoaspirate cells for tissue engineering of the lower urinary tract: implications for the treatment of stress urinary incontinence and bladder reconstruction. J. Urol. 174(5): 2041–2045. doi:10.1097/01.ju.0000176489. 96993.84. PMID:16217390. James, A.W., Leucht, P., Levi, B., Carre, A.L., Xu, Y., Helms, J.A., et al. 2010. Sonic Hedgehog influences the balance of osteogenesis and adipogenesis in mouse adipose-derived stromal cells. Tissue Eng. Part A, 16(8): 2605–2616. doi:10. 1089/ten.tea.2010.0048. PMID:20367246. Kang, S.K., Putnam, L.A., Ylostalo, J., Popescu, I.R., Dufour, J., Belousov, A., et al.
Can. J. Physiol. Pharmacol. Vol. 92, 2014
2004. Neurogenesis of Rhesus adipose stromal cells. J. Cell Sci. 117(18): 4289– 4299. doi:10.1242/jcs.01264. PMID:15292397. Karbiener, M., Fischer, C., Nowitsch, S., Opriessnig, P., Papak, C., Ailhaud, G., et al. 2009. microRNA miR-27b impairs human adipocyte differentiation and targets PPARgamma. Biochem. Biophys. Res. Commun. 390(2): 247–251. doi: 10.1016/j.bbrc.2009.09.098. PMID:19800867. Kwon, E.B., Lee, J.Y., Piao, S., Kim, I.G., Ra, J.C., and Lee, J.Y. 2011. Comparison of human muscle-derived stem cells and human adipose-derived stem cells in neurogenic trans-differentiation. Korean J. Urol. 52(12): 852–857. doi:10.4111/ kju.2011.52.12.852. PMID:22216399. Lee, J.H., and Kemp, D.M. 2006. Human adipose-derived stem cells display myogenic potential and perturbed function in hypoxic conditions. Biochem. Biophys. Res. Commun. 341(3): 882–888. doi:10.1016/j.bbrc.2006.01.038. PMID: 16442498. Li, H.X., Luo, X., Liu, R.X., Yang, Y.J., and Yang, G.S. 2008. Roles of Wnt/betacatenin signaling in adipogenic differentiation potential of adipose-derived mesenchymal stem cells. Mol. Cell. Endocrinol. 291(1–2): 116–124. doi:10.1016/ j.mce.2008.05.005. PMID:18584948. Li, H., Han, Z., Liu, D., Zhao, P., Liang, S., and Xu, K. 2013. Autologous platelet-rich plasma promotes neurogenic differentiation of human adipose derived stem cells in vitro. Int. J. Neurosci. 123(3): 184–190. doi:10.3109/00207454.2012. 742077. PMID:23126279. Lin, T., Liu, Y., Shi, M., Liu, X., Li, L., Liu, Y., et al. 2012. Promotive effect of ginsenoside Rd on proliferation of neural stem cells in vivo and in vitro. J. Ethnopharmacol. 142(3): 754–761. doi:10.1016/j.jep.2012.05.057. PMID: 22683911. Liu, T.M., Martina, M., Hutmacher, D.W., Hui, J.H., Lee, E.H., and Lim, B. 2007. Identification of common pathways mediating differentiation of bone marrow- and adipose tissue-derived human mesenchymal stem cells into three mesenchymal lineages. Stem Cells, 25(3): 750–760. doi:10.1634/stem cells.2006-0394. PMID:17095706. Ma, J., Li, W., Tian, R., and Lei, W. 2010. Ginsenoside Rg1 promotes peripheral nerve regeneration in rat model of nerve crush injury. Neurosci. Lett. 478(2): 66–71. doi:10.1016/j.neulet.2010.04.064. PMID:20438804. Miranville, A., Heeschen, C., Sengenès, C., Curat, C.A., Busse, R., and Bouloumié, A. 2004. Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation, 110(3): 349–355. doi:10.1161/01. CIR.0000135466.16823.D0. PMID:15238461. Mizuno, H., Zuk, P.A., Zhu, M., Lorenz, H.P., Benhaim, P., and Hedrick, M.H. 2002. Myogenic differentiation by human processed lipoaspirate cells. Plast. Reconstr. Surg. 109(1): 199–209; discussion 210–211. doi:10.1097/00006534200201000-00030. PMID:11786812. Neupane, M., Chang, C.C., Kiupel, M., and Yuzbasiyan-Gurkan, V. 2008. Isolation and characterization of canine adipose-derived mesenchymal stem cells. Tissue Eng. Part A, 14(6): 1007–1015. doi:10.1089/ten.tea.2007.0207. PMID: 19230125. Peptan, I.A., Hong, L., and Mao, J.J. 2006. Comparison of osteogenic potentials of visceral and subcutaneous adipose-derived cells of rabbits. Plast. Reconstr. Surg. 117(5): 1462–1470. doi:10.1097/01.prs.0000206319.80719.74. PMID:16641714. Petrova, E.S. 2012. The use of stem cells to stimulate regeneration of damaged nerve. Tsitologiia, 54(7): 525–540. PMID:23074855. Ren, Z., Wang, Y., Peng, J., Zhao, Q., and Lu, S. 2012. Role of stem cells in the regeneration and repair of peripheral nerves. Rev. Neurosci. 23(2): 135–143. doi:10.1515/revneuro-2011-0069. PMID:22499672. Rodríguez, L.V., Alfonso, Z., Zhang, R., Leung, J., Wu, B., and Ignarro, L.J. 2006. Clonogenic multipotent stem cells in human adipose tissue differentiate into functional smooth muscle cells. Proc. Natl. Acad. Sci. U.S.A. 103(32): 12167– 12172. doi:10.1073/pnas.0604850103. PMID:16880387. Safford, K.M., Hicok, K.C., Safford, S.D., Halvorsen, Y.D., Wilkison, W.O., Gimble, J.M., et al. 2002. Neurogenic differentiation of murine and human adipose-derived stromal cells. Biochem. Biophys. Res. Commun. 294(2): 371– 379. doi:10.1016/S0006-291X(02)00469-2. PMID:12051722. Schäffler, A., and Büchler, C. 2007. Concise review: adipose tissue-derived stromal cells: basic and clinical implications for novel cell-based therapies. Stem Cells, 25(4): 818–827. doi:10.1634/stemcells.2006-0589. PMID:17420225. Shen, L., and Zhang, J. 2003. Ginsenoside Rg1 increases ischemia-induced cell proliferation and survival in the dentate gyrus of adult gerbils. Neurosci Lett. 344(1): 1–4. doi:10.1016/S0304-3940(03)00318-5. PMID:12781907. Shen, L., and Zhang, J. 2007. NMDA receptor and iNOS are involved in the effects of ginsenoside Rg1 on hippocampal neurogenesis in ischemic gerbils. Neurol. Res. 29(3): 270–273. doi:10.1179/016164107X159144. PMID:17509226. Shi, A.W., Wang, X.B., Lu, F.X., Zhu, M.M., Kong, X.Q., and Cao, K.J. 2009. Ginsenoside Rg1 promotes endothelial progenitor cell migration and proliferation. Acta Pharmacol. Sin. 30(3): 299–306. doi:10.1038/aps.2009.6. PMID: 19262553. Shi, A.W., Gu, N., Liu, X.M., Wang, X., and Peng, Y.Z. 2011. Ginsenoside Rg1 enhances endothelial progenitor cell angiogenic potency and prevents senescence in vitro. J. Int. Med. Res. 39 (4): 1306–1318. doi:10.1177/ 147323001103900418. PMID:21986132. Shi, Q., Hao, Q., Bouissac, J., Lu, Y., Tian, S., and Lu, B. 2005. Ginsenoside-Rd from Panax notoginseng enhances astrocyte differentiation from neural stem cells. Life Sci. 76(9): 983–995. doi:10.1016/j.lfs.2004.07.026. PMID:15607328. Strem, B.M., Hicok, K.C., Zhu, M., Wulur, I., Alfonso, Z., Schreiber, R.E., et al. Published by NRC Research Press
Xu et al.
mesenchymal stromal cells. Vet. Surg. 36(7): 613–622. doi:10.1111/j.1532-950X. 2007.00313.x. PMID:17894587. Wang, L., and Kisaalita, W.S. 2011. Administration of BDNF/ginsenosides combination enhanced synaptic development in human neural stem cells. J. Neurosci. Methods. 194(2): 274–282. doi:10.1016/j.jneumeth.2010.10.025. PMID: 21094185. Wu, J., Pan, Z., Cheng, M., Shen, Y., Yu, H., Wang, Q., et al. 2013. Ginsenoside Rg1 facilitates neural differentiation of mouse embryonic stem cells via GRdependent signaling pathway. Neurochem. Int. 62(1): 92–102. doi:10.1016/j. neuint.2012.09.016. PMID:23063465. Zuk, P.A., Zhu, M., Ashjian, P., De Ugarte, D.A., Huang, J.I., Mizuno, H., et al. 2002. Human adipose tissue is a source of multipotent stem cells. Mol. Biol. Cell, 13(12): 4279–4295. doi:10.1091/mbc.E02-02-0105. PMID:12475952.
Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by YORK UNIV on 07/01/14 For personal use only.
2005. Multipotential differentiation of adipose tissue-derived stem cells. Keio J. Med. 54(3): 132–141. doi:10.2302/kjm.54.132. PMID:16237275. Taha, M.F., and Hedayati, V. 2010. Isolation, identification and multipotential differentiation of mouse adipose tissue-derived stem cells. Tissue Cell, 42(4): 211–216. doi:10.1016/j.tice.2010.04.003. PMID:20483444. Tholpady, S.S., Katz, A.J., and Ogle, R.C. 2003. Mesenchymal stem cells from rat visceral fat exhibit multipotential differentiation in vitro. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 272(1): 398–402. doi:10.1002/ar.a.10039. PMID: 12704697. Vidal, M.A., Kilroy, G.E., Lopez, M.J., Johnson, J.R., Moore, R.M., and Gimble, J.M. 2007. Characterization of equine adipose tissue-derived stromal cells: adipogenic and osteogenic capacity and comparison with bone marrow-derived
475
Published by NRC Research Press
