Biol Trace Elem Res (2014) 161:101–106 DOI 10.1007/s12011-014-0075-8
Effects of Resistance Exercise on Iron Absorption and Balance in Iron-Deficient Rats Takako Fujii & Tatsuhiro Matsuo & Koji Okamura
Received: 23 June 2014 / Accepted: 11 July 2014 / Published online: 25 July 2014 # Springer Science+Business Media New York 2014
Abstract We have previously reported that resistance exercise improved the iron status in iron-deficient rats. The current study investigated the mechanisms underlying this exerciserelated effect. Male 4-week-old rats were divided into a group sacrificed at the start (week 0) (n=7), a group maintained sedentary for 6 weeks (S) or a group that performed exercise for 6 weeks (E), and all rats in the latter groups were fed an iron-deficient diet (12 mg iron/kg) for 6 weeks. The rats in the E group performed climbing exercise (5 min×6 sets/day, 3 days/week). Compared to the week 0 rats, the rats in the S and E groups showed lower tissue iron content, and the hematocrit, hemoglobin, plasma iron, and transferrin saturation values were all low. However, the tissue iron content and blood iron status parameters, and the whole body iron content measured using the whole body homogenates of the rats, did not differ between the S group and the E group. The messenger RNA (mRNA) expression levels of hepcidin, duodenal cytochrome b, divalent metal transporter 1, and ferroportin 1 did not differ between the S group and the E group. The apparent absorption of iron was significantly lower in the E group than in the S group. Therefore, it was concluded that resistance exercise decreases iron absorption, whereas the whole body iron content is not affected, and an increase in iron recycling in the body seems to be responsible for this effect.
Keywords Resistance exercise . Iron deficiency . Iron absorption . Iron balance . Iron recycle T. Fujii (*) : K. Okamura Exercise Nutrition Laboratory, Graduate School of Sport Sciences, Osaka University of Health and Sport Sciences, Osaka, Japan e-mail: [email protected] T. Matsuo Faculty of Agriculture, Kagawa University, Kagawa, Japan
Introduction Athletes, such as long distance runners, whose routine training regimen is highly energy-consuming, have a relatively high prevalence of iron-deficiency anemia [1]. It has been proposed that iron deficiency is caused by low iron intake and gastrointestinal hemorrhage. Therefore, exercise is often considered to cause iron-deficiency anemia and worsen the symptoms. However, mild resistance exercise improves the iron status in young female humans with nonanemic iron deficiency without iron supplementation [2]. Rats engaged in climbing exercise, a model of resistance exercise, for 3 weeks have been shown to have enhanced heme biosynthesis in the bone marrow, regardless of the dietary iron content, and the effect is stronger than that induced by aerobic exercise [3, 4]. The bone marrow δ-aminolevulinic acid dehydratase (ALAD) activity, the key enzyme involved in hemoglobin synthesis, is increased after resistance exercise and decreases with time [5]. In addition, the bone marrow ALAD activity is maintained at a high level by routine resistance exercise training, compared with that in sedentary rats [6, 7]. It has been reported that iron absorption is decreased by exercise [8, 9]. Ruckman and Sherman reported that swimming exercise increased the fecal iron excretion and decreased the apparent iron absorption. Hepcidin was proposed as a factor responsible for this decrease in iron absorption by exercise. Hepcidin is a liver-produced peptide hormone that inhibits intestinal iron absorption and macrophage iron recycling, thereby decreasing the body’s iron availability [10]. Hepcidin synthesis is induced by iron overload, hypoxia, and inflammatory signals, such as interleukin-6 (IL-6) [11]. Exercise is one of the factors that increases hepcidin synthesis [12–16]. Increases in the plasma and/or urinary hepcidin levels have been consistently reported in response to a single bout of prolonged and intense exercise in humans [13–16], beginning during exercise and peaking during early recovery
102
[14]. In addition, in rats trained for 5 weeks, high hepcidin messenger RNA (mRNA) levels have been reported, together with low plasma iron and ferritin concentrations [17]. Therefore, it has been suggested that exercise enhances hepcidin synthesis and inhibits iron absorption. However, some studies reported that the iron status was improved by resistance exercise [2, 3, 6, 7]. This raised the possibility that the resistance exercise-induced improvement in the iron status is not due to an increase in iron absorption but an increase in the recycling of iron in the body. It is assumed that if resistance exercise increases iron recycling in the body, the whole body iron content would not decrease even if the iron absorption is decreased by resistance exercise. This study therefore investigated the effects of resistance exercise on the iron absorption and whole body iron status. The hypothesis of the present study was that resistance exercise decreases the iron absorption, without affecting the whole body iron content due to an increase in iron recycling in the body.
Materials and Methods Animals and Experimental Design This study used 21 male Sprague–Dawley rats (4 weeks old; body weight, 60–80 g; Japan CLEA, Inc., Osaka, Japan). All animals were individually housed in an animal room at 23± 1 °C with lights off from 0800 to 2000 hours. All rats were fed an AIN-93G-based [18] iron-deficient diet containing 12 mg iron/kg diet. The dietary composition was as follows (g/kg): corn starch, 397; milk casein, 200; α-corn starch, 132; glucose, 100; purified soybean oil, 70; cellulose, 50; mineral mixture, 10; ferric citrate, 0.07; vitamin mixture, 10; L-cysteine, 3; choline bitartrate, 2.5; and t-butylhydroquinone, 0.01. The diet was available from 1800 to 1030 hours, and drinking water was available at all times. The rats were randomly divided into three groups: a group sacrificed at the start date (week 0, n=7), a group that remained sedentary for 6 weeks (S, n=7), or a group that performed exercise for 6 weeks (E, n=7). The rats in the E group performed a climbing exercise from 1700 to 1800 hours, with 5 min of rest between the exercise sessions each day during the 6-week study period, as reported previously [7, 19]. The body weight of the rats and the food intake were measured every day throughout the study. The protocol of this study was approved by the Experimental Animal Care Committee of Osaka University of Health and Sport Sciences. Dissection The rats were fasted overnight and killed by drawing blood from the abdominal aorta at 0900 hours under anesthesia with
Fujii et al.
diethyl ether. Specimens of the liver and duodenum were quickly removed, weighed, and stored at −80 °C until they were used to analyze the mRNA expression of proteins related to iron absorption. Portions of the liver and small intestine were quickly sampled, weighed, and were stored at −30 °C until the analyses of the iron contents of these tissues. The whole body skin, with the subcutaneous adipose tissues, was separated from the carcass. The carcass, skin, and blood samples were stored at −30 °C until the analyses. Blood and Plasma Analyses The hematocrit level was measured using the blood samples collected into a heparinized microcapillary tubes after centrifugation at 12,000 rpm for 5 min. The blood hemoglobin concentration was determined colorimetrically using the sodium lauryl sulfate-hemoglobin method (Hemoglobin B-Test kit, Wako Pure Chemical Industries, Osaka). The plasma iron concentration was determined with the Nitroso-PSAP method (Iron kit, Wako Pure Chemical Industries). The total ironbinding capacity (TIBC) was measured using a method prescribed by the International Nutritional Anemia Consultative Group. The transferrin saturation was calculated together with the plasma iron concentration and the TIBC [20]. Analyses of the Tissue and Whole Body Iron Contents The carcass and skin were homogenized using a blender and a mill (Vita-Mix Blender Absolute, Vita-Mix Corp., Cleveland, OH) before incineration. The specimens of the liver, small intestine, carcass, and skin were incinerated with the wet ashing method. After incineration, the residue was dissolved in distilled water to determine the iron concentration with the Nitroso-PSAP method (Iron kit, Wako Pure Chemical Industries), and the iron content of the tissues was calculated. The iron content of the whole body was calculated by adding the iron content of the liver, small intestine, carcass, and skin. Real-Time PCR Analysis The triceps muscles were homogenized in 1 ml of TRIzol reagent (Invitrogen) using a hand homogenizer (AS ONE, Osaka, Japan). RNA was isolated according to the manufacturer’s instructions, and the concentration and purity of the isolated RNA prepared in TE buffer were estimated by determining the OD 260/280. The purified RNA was then treated with DNase I Recombinant (Roche Applied Science, Tokyo, Japan) to degrade any residual contaminating genomic DNA. Complementary DNA (cDNA) synthesis was performed using the High Capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, CA). Real-time PCR was performed using a ViiA™ 7 Real-Time PCR System (Applied Biosystems, Foster City, CA). The PCR reaction was carried
Effects of Resistance Exercise on Iron Absorption and Balance
out with the Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) using 10 μmol/l of primers for hepcidin (forward, GAAGGCAAGATGGCACTAAGCA and reverse, TCTCGTCTGTTGCCGGAGATAG), duodenal cytochrome b (Dcytb) (forward, TCCTGAGAGCGATTGT GTTG and reverse, TTAATGGGGCATAGCCAGAG), divalent metal transporter 1 (DMT1) (forward, GCTGAGCGAA GATACCAGCG and reverse, TGTGCAACGGCACATACT TG), and ferroportin 1 (FPN1) (forward, TTCCGCACTTTT CGAGATGG and reverse, TACAGTCGAAGCCCAGGACT GT). The fluorescence was monitored during PCR by an ABI ViiA™ 7 Real-Time PCR System. A melting curve analysis was performed to ensure that a single product was obtained. PCR data were normalized to the β-actin expression, which was used as an internal control.
103 Table 1 The body weight and food intake Week 0
B.W. (g)
Week 0 Week 6 Food intake (g/6 weeks)
Week 6
72.7±11.5
S
E
72.4±4.3 362.4±21.1 887.6±51.4
72.3±4.8 346.4±20.7 878.6±69.4
The values are the means±SD for six to seven rats B.W. body weight, S sedentary group, E exercise group
The data are expressed as the means±SD. The Bonferroni method was employed to compare week 0 and week 6. Student’s t test was used to compare the body weight, food intake, blood iron parameters, dietary iron balance, and tissue iron content between the S group and the E group. To compare the mRNA expression between the S group and the E group, the Mann–Whitney U test for a nonparametric analysis was employed. Values of p
Effects of Resistance Exercise on Iron Absorption and Balance in Iron-Deficient Rats Takako Fujii & Tatsuhiro Matsuo & Koji Okamura
Received: 23 June 2014 / Accepted: 11 July 2014 / Published online: 25 July 2014 # Springer Science+Business Media New York 2014
Abstract We have previously reported that resistance exercise improved the iron status in iron-deficient rats. The current study investigated the mechanisms underlying this exerciserelated effect. Male 4-week-old rats were divided into a group sacrificed at the start (week 0) (n=7), a group maintained sedentary for 6 weeks (S) or a group that performed exercise for 6 weeks (E), and all rats in the latter groups were fed an iron-deficient diet (12 mg iron/kg) for 6 weeks. The rats in the E group performed climbing exercise (5 min×6 sets/day, 3 days/week). Compared to the week 0 rats, the rats in the S and E groups showed lower tissue iron content, and the hematocrit, hemoglobin, plasma iron, and transferrin saturation values were all low. However, the tissue iron content and blood iron status parameters, and the whole body iron content measured using the whole body homogenates of the rats, did not differ between the S group and the E group. The messenger RNA (mRNA) expression levels of hepcidin, duodenal cytochrome b, divalent metal transporter 1, and ferroportin 1 did not differ between the S group and the E group. The apparent absorption of iron was significantly lower in the E group than in the S group. Therefore, it was concluded that resistance exercise decreases iron absorption, whereas the whole body iron content is not affected, and an increase in iron recycling in the body seems to be responsible for this effect.
Keywords Resistance exercise . Iron deficiency . Iron absorption . Iron balance . Iron recycle T. Fujii (*) : K. Okamura Exercise Nutrition Laboratory, Graduate School of Sport Sciences, Osaka University of Health and Sport Sciences, Osaka, Japan e-mail: [email protected] T. Matsuo Faculty of Agriculture, Kagawa University, Kagawa, Japan
Introduction Athletes, such as long distance runners, whose routine training regimen is highly energy-consuming, have a relatively high prevalence of iron-deficiency anemia [1]. It has been proposed that iron deficiency is caused by low iron intake and gastrointestinal hemorrhage. Therefore, exercise is often considered to cause iron-deficiency anemia and worsen the symptoms. However, mild resistance exercise improves the iron status in young female humans with nonanemic iron deficiency without iron supplementation [2]. Rats engaged in climbing exercise, a model of resistance exercise, for 3 weeks have been shown to have enhanced heme biosynthesis in the bone marrow, regardless of the dietary iron content, and the effect is stronger than that induced by aerobic exercise [3, 4]. The bone marrow δ-aminolevulinic acid dehydratase (ALAD) activity, the key enzyme involved in hemoglobin synthesis, is increased after resistance exercise and decreases with time [5]. In addition, the bone marrow ALAD activity is maintained at a high level by routine resistance exercise training, compared with that in sedentary rats [6, 7]. It has been reported that iron absorption is decreased by exercise [8, 9]. Ruckman and Sherman reported that swimming exercise increased the fecal iron excretion and decreased the apparent iron absorption. Hepcidin was proposed as a factor responsible for this decrease in iron absorption by exercise. Hepcidin is a liver-produced peptide hormone that inhibits intestinal iron absorption and macrophage iron recycling, thereby decreasing the body’s iron availability [10]. Hepcidin synthesis is induced by iron overload, hypoxia, and inflammatory signals, such as interleukin-6 (IL-6) [11]. Exercise is one of the factors that increases hepcidin synthesis [12–16]. Increases in the plasma and/or urinary hepcidin levels have been consistently reported in response to a single bout of prolonged and intense exercise in humans [13–16], beginning during exercise and peaking during early recovery
102
[14]. In addition, in rats trained for 5 weeks, high hepcidin messenger RNA (mRNA) levels have been reported, together with low plasma iron and ferritin concentrations [17]. Therefore, it has been suggested that exercise enhances hepcidin synthesis and inhibits iron absorption. However, some studies reported that the iron status was improved by resistance exercise [2, 3, 6, 7]. This raised the possibility that the resistance exercise-induced improvement in the iron status is not due to an increase in iron absorption but an increase in the recycling of iron in the body. It is assumed that if resistance exercise increases iron recycling in the body, the whole body iron content would not decrease even if the iron absorption is decreased by resistance exercise. This study therefore investigated the effects of resistance exercise on the iron absorption and whole body iron status. The hypothesis of the present study was that resistance exercise decreases the iron absorption, without affecting the whole body iron content due to an increase in iron recycling in the body.
Materials and Methods Animals and Experimental Design This study used 21 male Sprague–Dawley rats (4 weeks old; body weight, 60–80 g; Japan CLEA, Inc., Osaka, Japan). All animals were individually housed in an animal room at 23± 1 °C with lights off from 0800 to 2000 hours. All rats were fed an AIN-93G-based [18] iron-deficient diet containing 12 mg iron/kg diet. The dietary composition was as follows (g/kg): corn starch, 397; milk casein, 200; α-corn starch, 132; glucose, 100; purified soybean oil, 70; cellulose, 50; mineral mixture, 10; ferric citrate, 0.07; vitamin mixture, 10; L-cysteine, 3; choline bitartrate, 2.5; and t-butylhydroquinone, 0.01. The diet was available from 1800 to 1030 hours, and drinking water was available at all times. The rats were randomly divided into three groups: a group sacrificed at the start date (week 0, n=7), a group that remained sedentary for 6 weeks (S, n=7), or a group that performed exercise for 6 weeks (E, n=7). The rats in the E group performed a climbing exercise from 1700 to 1800 hours, with 5 min of rest between the exercise sessions each day during the 6-week study period, as reported previously [7, 19]. The body weight of the rats and the food intake were measured every day throughout the study. The protocol of this study was approved by the Experimental Animal Care Committee of Osaka University of Health and Sport Sciences. Dissection The rats were fasted overnight and killed by drawing blood from the abdominal aorta at 0900 hours under anesthesia with
Fujii et al.
diethyl ether. Specimens of the liver and duodenum were quickly removed, weighed, and stored at −80 °C until they were used to analyze the mRNA expression of proteins related to iron absorption. Portions of the liver and small intestine were quickly sampled, weighed, and were stored at −30 °C until the analyses of the iron contents of these tissues. The whole body skin, with the subcutaneous adipose tissues, was separated from the carcass. The carcass, skin, and blood samples were stored at −30 °C until the analyses. Blood and Plasma Analyses The hematocrit level was measured using the blood samples collected into a heparinized microcapillary tubes after centrifugation at 12,000 rpm for 5 min. The blood hemoglobin concentration was determined colorimetrically using the sodium lauryl sulfate-hemoglobin method (Hemoglobin B-Test kit, Wako Pure Chemical Industries, Osaka). The plasma iron concentration was determined with the Nitroso-PSAP method (Iron kit, Wako Pure Chemical Industries). The total ironbinding capacity (TIBC) was measured using a method prescribed by the International Nutritional Anemia Consultative Group. The transferrin saturation was calculated together with the plasma iron concentration and the TIBC [20]. Analyses of the Tissue and Whole Body Iron Contents The carcass and skin were homogenized using a blender and a mill (Vita-Mix Blender Absolute, Vita-Mix Corp., Cleveland, OH) before incineration. The specimens of the liver, small intestine, carcass, and skin were incinerated with the wet ashing method. After incineration, the residue was dissolved in distilled water to determine the iron concentration with the Nitroso-PSAP method (Iron kit, Wako Pure Chemical Industries), and the iron content of the tissues was calculated. The iron content of the whole body was calculated by adding the iron content of the liver, small intestine, carcass, and skin. Real-Time PCR Analysis The triceps muscles were homogenized in 1 ml of TRIzol reagent (Invitrogen) using a hand homogenizer (AS ONE, Osaka, Japan). RNA was isolated according to the manufacturer’s instructions, and the concentration and purity of the isolated RNA prepared in TE buffer were estimated by determining the OD 260/280. The purified RNA was then treated with DNase I Recombinant (Roche Applied Science, Tokyo, Japan) to degrade any residual contaminating genomic DNA. Complementary DNA (cDNA) synthesis was performed using the High Capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, CA). Real-time PCR was performed using a ViiA™ 7 Real-Time PCR System (Applied Biosystems, Foster City, CA). The PCR reaction was carried
Effects of Resistance Exercise on Iron Absorption and Balance
out with the Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) using 10 μmol/l of primers for hepcidin (forward, GAAGGCAAGATGGCACTAAGCA and reverse, TCTCGTCTGTTGCCGGAGATAG), duodenal cytochrome b (Dcytb) (forward, TCCTGAGAGCGATTGT GTTG and reverse, TTAATGGGGCATAGCCAGAG), divalent metal transporter 1 (DMT1) (forward, GCTGAGCGAA GATACCAGCG and reverse, TGTGCAACGGCACATACT TG), and ferroportin 1 (FPN1) (forward, TTCCGCACTTTT CGAGATGG and reverse, TACAGTCGAAGCCCAGGACT GT). The fluorescence was monitored during PCR by an ABI ViiA™ 7 Real-Time PCR System. A melting curve analysis was performed to ensure that a single product was obtained. PCR data were normalized to the β-actin expression, which was used as an internal control.
103 Table 1 The body weight and food intake Week 0
B.W. (g)
Week 0 Week 6 Food intake (g/6 weeks)
Week 6
72.7±11.5
S
E
72.4±4.3 362.4±21.1 887.6±51.4
72.3±4.8 346.4±20.7 878.6±69.4
The values are the means±SD for six to seven rats B.W. body weight, S sedentary group, E exercise group
The data are expressed as the means±SD. The Bonferroni method was employed to compare week 0 and week 6. Student’s t test was used to compare the body weight, food intake, blood iron parameters, dietary iron balance, and tissue iron content between the S group and the E group. To compare the mRNA expression between the S group and the E group, the Mann–Whitney U test for a nonparametric analysis was employed. Values of p
