MOLECULAR REPRODUCTION AND DEVELOPMENT 29%-15
(1991)
ElectroPoration of Bovine Spermatozoa to Carry Foreigi DNA in Oocytes MARC B. GAGN@,ly2FRANCOIS POTHIER,'v3 AND MARC-ANDRE SIRARD'-2 Unit6 de Recherche en Ontogdnie et Reproduction, 3Laboratoire d'endocrinologie moldculaire, CHUL Research Center and Lava1 University, and 'Ddpartement de Zootechnie, Pavillon Paul-Comtois, Citd Universitaire, Qutbec (Qudbec), Canada In the present study, electroporaABSTRACT tion was used to test the ability of spermatozoa to carry foreign DNA into the bovine oocytes. Frozen-thawed bovine spermatozoa (107/ml) were electroporated using six different combinations of voltge (500, 1,000, or 1,500 V) and capacitance (1 or 25 pFarads) in the presence of 1 mg/ml of plasmid pRGH527. The portions of plasmids retained by sperm cells after three washings (stable for ten washings) were 4.3, 5.5, 5.1, 6.0, 6.8, and 5.8% for 1 pfarad, 500, 1,000, and 1,500 V and 25 pFarads, 500, 1,000, and 1,500 V, respectively. Nonelectroporated cells have retained only 1%of plasmids. In the same experiment, electroporated spermatozoa were acrosome reacted by treatment with ionophore A23187 to evaluate the fraction of marked plasmids joined at the acrosomal membrane. The results show that 3.5, 5.0, 4.4, 5.0, 6.3, and 4.4% remain tied to the ionophore-treated sperm. Only 0.7%of plasmid was retained after removal of the acrosome of nonelectroporated cells. Acrosome reaction was not significantly induced by the electrical field (EF) (P < 0.005). EF decrease motility significantly for >lo0 V in 0.3 M mannitol (M) and mannitol-TALP (MT) (111) media and 2500 V (P < 0.05) in TALP medium. The retained plasmid rate was compared between TALP medium M and MT media and resulted in a percentage of 1.0, 2.5, 6.5 at 1 pFarads, 100 V, and 0.9, 3.8, and 3.8 at 25 pFarads, 100 V in TALP, MT, and M medium, respectively. Sperm cells electroporated at 1 pfarad, 500 or 1,000 V, 25 pfarad, 500 V or 1,000 in TALP medium hold plasmids in proportion of 5.2,5.4,7.4, and 6.0%. Electroporation above 100 V in M and MT killed the cells. In a part of this experiment, spermatozoa electroporated in the presence of radiolabeled plasmids have been treated with DNase I and results revealed that 35, 28, 54, 58, and 3%of marked DNA remains in sperm cells following digestion after electroporation in TALP (1,000 V, 1 and 25 pFarads), M medium (100 V, 1 and 25 pFarads), and control, respectively. Using in vitro matured bovine oocytes, the electroporation conditions were correlated with the fertilization rate (85%for control and 55% for electroporated spermatozoa). Autoradiography of embryos following fertilization indicated the presence of plasmids in the cytoplasm and in the zona pellucida. Finally, the use of Polymerase Chain Reaction (PCR) revealed the presence of plasmids in blastocyst cells in 12%for control (n = 67) and 22, 17, and 19%for electroporated spermatozoa in TALP (n = 188,25
1991 WILEY-LISS, INC.
pFarads, 1,000 V), MT (n = 29, 25 pFarads, 100 V) and M (n = 21, 25 pFarads, 100 V), respectively. In conclusion, our results indicate A) that electroporation results in an increase absorption of DNA by the spermatozoa, B) that the male gametes can carry foreing DNA in oocytes at fertilisation, and C) that an increased fraction of day 5 embryos is showing a positive response for the inserted gene with the polymerase chain reaction.
Key Words: Sperm, Bovine, Electroporation, PCR, Transgenic
INTRODUCTION T h e production of transgenic mice by microinjection o f DNA i n t o mouse embryos has rapidly gained importance as an experimental tool t o study t h e factors w h i c h determine t h e tissue-specificity of gene expression, t o generate models for human diseases (Leonard e t al., 1988; S m a l l e t al., 19861, as w e l l as t o look a t t h e consequences o f oncogene expressions (Andres e t al., 1987; S i n n et al., 1987). T h r o u g h t h i s technique, recombinant DNA molecules o f any type c a n be introduced i n t o zygotes (Hogan e t al., 1986) and t h u s can be used t o produce transgenic animals. T h e production o f transgenic animals by pronuclear microinjection i s s t i l l problematic in large domestic animals (Rexroad e t al., 1989; Roschlau e t al., 1989; B r i n s t e r e t al., 1985; B i e r y et al., 1988; Gagne e t al., 1990). Introduction of specific gene sequences i n t o early embryos, more particularly i n t o bovine embryos, may be a powerful tool t o obtain more valuable animals (Wagner, 1984). These applications include t h e modification o f several physiological processes such as growth, lactation, and wool production, t h e modification or creation o f n e w metabolic ways (Land and Wilmut, 1987), and possibly t h e genetic resistance t o specific diseases. Electroporation has previously been used b o t h for obtaining stable transformants in eucaryote cell lines ( K n u t s o n e t al., 1987; N e w m a n n e t al., 1982; Evans e t al., 1984) and t o introduce plasmids in bacteria ( M i l l e r e t al., 1988). M o r e recently, L a v i t r a n o e t al. (1989) reported the Received April 24, 1990; accepted December 17, 1990. Address reprint requests to Marc-Andre Sirard, Departement de Zootechnie, Pavillon Paul-Comtois, Citd Universitaire, Quebec (Quebec), G1K 7P4, Canada.
ELECTROPORATION OF BOVINE SPERMATOZOA successful transfer of foreign DNA into mouse oocytes by simple incubation of the spermatozoa with plasmid prior to in vitro fertilization. However, this approach seems restricted to some unknown conditions since so far no other groups have been able to produce transgenic mice using this method (Brinster et al., 1989; Maddox, 1989). The aim of this study was to evaluate the effect of electroporation pulse on bovine sperm cells physiology, to make them carriers of plasmid DNA, and to know if foreign nucleic sequences were persistent in embryonic cells following in vitro fertilization of in vitro matured bovine oocytes. Results show that foreign nucleic sequences can be introduced into bovine oocyte by electroporated spermatozoa.
7
ELMof the calcium ionophore A23187 (Sigma Chemical Co., St. Louis, MO) and incubated 2 h at 37°C with continuous agitation. Following incubation, the spermatozoa were washed once and radioactivity of supernatants and pellets (cells) were counted separately in Liquid Scintillation Counter (Beckman, Fullerton, CA). Samples of electroporated spermatozoa were washed ten times to verify the stability of plasmids anchorage.
Staining Procedure The induction of acrosome reaction was measured by light microscopy following a staining procedure of Bryan and Akruk (1977). At selected times (0, 30, 60, 120 and 240 min) of calcium ionophore treatment or after electroporation, 10 pl samples were taken, immeMATERIALS AND METHODS diately smeared on protamine covered slides, dried at Preparation of Plasmid DNA room temperature and stained with naphtol yellow S The plasmid pRGRH527 (provided by Dr. S. Guerin) and erythrosin B (Sigma Chemical Co., St. Louis, MO). contains the bacterial gene CAT (chloramphenicol Acrosomal caps stained cherry-red while the postacetyl transferase) placed under the control of the nuclear caps stained a pale pink. The loss of the 5'-527 bp rat growth hormone promoter (Tripputi et al., acrosomal caps was determined by phase-contrast mi1988). Prior to use, the construct was linearized by croscopy; 350 to 500 spermatozoa were counted for each single site BglII cleavage and when specified end- sample. labeled (5') with [a3,P]-ATP (Amersham Corp., OnDNase Incubation tario, Canada) as described by Davis et al. (1986). The electroporated DNA-sperm suspensions (in Sperm Preparation and Electroporation TALP, control or 1,000 V, or 25 pFarads, and in Frozen-thawed sperm was obtained from a pool of Mannitol, 100 V, 1or 25 pFarads) were washed once in five different bulls (frozen as a pool) donated by the TALP medium as described above and once in 5 ml of Centre #Insemination Artificielle du Quebec (C.I.A.Q., DNase 1buffer (consisting of 50 mM Tris-HCl, pH 7.5, Inc., St-Hyacinthe, Quebec, Canada). The straws were 10 mM MgCl,, 50 pg/ml BSAFAF) (Ausubel et al., thawed in water bath (35"C, 1 min), and used immedi- 1987) at 750g for 10 min at 20°C. Supernatant was ately; lo7 spermatozoa were added to 1 ml of TALP removed and pellet resuspended in 1 ml of the same medium (Parrish et al., 1985,1988)supplemented with buffer; 500 p1 of each suspension were kept as undi0.6% bovine serum albumin fatty acid free (BSAFAF) gested controls. Two units of DNaseI were added in the (Sigma Chemical Co., St. Louis, MO) or 1 ml of 0.3 M 500 pl suspension remnants and incubated 15 min at mannitol, 0.1 mM MgCl,, 0.05 mM CaCl, (Sigma 37°C. The reaction was arrested by addition of 25 pl of Chemical Co., St. Louis, MO) (Zimmerman et al., 1982) 0.5M EDTA. Digested and undigested electroporated or 1 ml of 50% TALP-medium-50% mannitol medium sperm were finally washed twice in 5 ml TALP medium (v/v),each one containing 1 pg of radiolabeled plasmid and assayed for radioactivity. Substraction of radioacpRGH527 in a 1.4 ml Gene Pulser Cuvette (Bio-Rad tivity of DNase-treated sperms from nonDNase-treated Laboratories, Richmond, CA) with a distance of 4 mm sperms give the fraction of plasmids removed from the between electrodes. Electroporation was accomplished surface of sperm cells. within different combinations of capacitance (1 or 25 pFarads) and voltage (100,500,1,000, or 1,500 V) using In Vitro Maturation and Fertilization of Oocytes Heifers or cow ovaries from cycling or pregnant a Gene Pulser Apparatus (Bio-Rad,Laboratories, Richmond, CA). EF was 0.4 second of duration. The ability animals were removed within 30 min after slaughter of electrical field (EF) to induce acrosome reaction was and transported to the laboratory at about 32°C in 0.9% assayed and the effect on motility was evaluated before NaCl aqueous solution containing 100,000 UI/1 peniand after electroporation. To evaluate the proportion of cilline, 100 mg/l streptomycin, and 250 pg/l amphoteriplasmid associated to the acrosome membrane, electro- cin B (Sigma Chemical Co., St. Louis, MO). Briefly, the porated sperm cells were treated with calcium iono- cumulus oocyte complex (COC)were aspirated from 1to phore and acrosome reacted (Ben-Avet al., 1988; Byrd, 5 mm follicles with 18 g needle, pooled, and selected in 1981; Bennet et al., 1987). To evaluate plasmid incor- accordance of cumulus appearance (Leibfried and First, poration, radiolabeled DNA was used during electropo- 1979). The COC were washed three times in hepes ration and then the sperm was washed twice in 5 ml of buffered tyrode's medium (TLH) (Bavister et al., 1983), TALP medium by centrifugation at 500g for 10 min at supplemented with 0.2 mM pyruvic acid (Sigma Chem20°C. Supernatant was then removed and assayed for ical Co., St. Louis, MO), 0.9 mg/ml glucose (Fisher radioactivity content. Remaining cells were resus- Scientific Co., NJ), 10% fetal calf serum (heat-treated pended in 500 pl of TALP medium with 3 mM CaCl,, 10 FCS, Gibco Lab., Grand Island, NY), and 0.05 mg/ml
8
M.B. GAGNE ET AL.
gentamycin (Sigma Chemical Co., St. Louis, MO). Oocyte maturation was carried out as described before (Sirard et al., 1988): ten oocytes were added in each 50 p1 droplets of maturation media consisting of TCM-199 with Earles salts and 220 mgilOO ml NaC03 (Gibco Lab, Grand Island, NY), 10%heat-treated FCS, 5 pgiml LH (National Institute of Diabetes and Digestive and Kidney Diseases), 0.5 pgiml FSH (NIDDK), 0.2 mM pyruvic acid, 1 pgiml estradiol 17p (Sigma Chemical Co., St. Louis, MO), and 0.05 mgiml gentamycin. The media and the mineral oil recovering droplets (Aldrich Chemical Co., Milwaukee, WI) were preexposed to the maturation conditions for a minimum of 2 h (38.5”C,5% C02, 95% air atmosphere with 100% humidity). In vitro fertilization was accomplished into fertilization medium droplets (45 pl) [composed of modified tyrode lactate medium (Bavister and Yanagimachi, 1977), 0.6% BSA FAF, 0.2 mM pyruvic acid, 10 pgiml heparin (Sigma Chemical Co., St. Louis, MO), and 0.05 mgiml gentamycinl containing 5 COC previously washed two times for 5 min in glucose free TLH (Parrish et al., 1988). The fertilization media droplets were placed in sterile Petri dishes under mineral oil and equilibrated for 2 h in culture conditions prior to use. Five microliters of electroporated sperm (50,000 sperm cells) suspension were directly added into each droplet.
Autoradiography Eighteen hours following fertilization, zygotes were washed and prepared for autoradiography. Embryos were embedded in agar (1%)(Sigma Chemical Co., St. Louis, MO), fixed in paraformaldehyde (4%), dehydrated in ethanol (70%) for up to 2 h, and followed by ethanol (100%) for 15 min. The same day, these embryos were mounted in paraffin and cut in 10 pm slices. Slices were fixed on the pregelatinized glass slides. Following soaking in emulsion NTB2 solution (Kodak Canada, Ontario, Canada), the slides were exposed during 3 weeks at 4°C. Finally, slices of embryos were examined under phase-contrast microscope. Development of Embryos to Blastocyst Stage In the third part of this experiment, oocytes fertilized with electroporated spermatozoa were transferred to the ligated oviducts of pseudopregnant rabbit (Boland, 1984) 48 h after an i.v. injection of 75 UI of HCG (Pharma Science, Inc., Montreal, Canada) (Sirard et al., 1985). Embryos were transferred with 1 mm diameter polypropylene tubing (Fisher Sci. Co., NJ) by midventral laparatomy in oviducts of the anaesthetized rabbits. A mean number of 16 control embryos and 28 “treated” were transferred in 17 rabbits; 120 hours later, the oviducts were excised and flushed with phosphate-buffered saline (PBS, Whittingham, 19711, 0.4% BSAFAF, and 0.05 mgiml gentamycin at 35°C. The recovered blastocysts were kept individually in 20 pl of PBS’CA2+Mg2+free and stored at -20°C before PCR analysis. Additionally, in vitro development of embryos was obtained with a coculture of bovine ovi-
ductal cells have been prepared according to the procedures of Eyestone and First (1989) with some changes. The mucosal tissue was transferred in a 50 ml conical tube with 20 ml Hank’s medium (containing 5% FCS and 5 pg/ml gentamycine); 40 p1 of the decanted tissues were incubated 24 h at 39”C, 5% C02, 95% air atmosphere, and 100% humidity in a 50 ml culture bottle with 10 ml of preequilibrated TCM-199FCS lo%, 0.2 mM pyruvic acid, and 50 pgiml gentamycine. After culture, oviductal tissue forming very small vesicles were chosen. Between 50 to 100 selected vesicles were put in a 50 pl TCM-199FCS droplets under mineral oil [with 20 to 25 (two to four cells) embryos per droplet] in a 60 mm Petri dishes. Culture medium was replenished every 48 h by adding 50 pl of fresh TCM-199FCS.After 5 days, embryos were evaluated for development to the compact morula or blastocyst stage.
Oligonucleotide Primers Oligonucleotide primers were synthesized using a Biosearch 8700 DNA synthesizer (A New Brunswick Scientific Company, NB, Canada). The sequences of the primer were chosen in such a manner to amplify a fragment specific to the CAT gene. Localization and orientation of each primer are shown in Figure 1. Preparation of Embryonic DNA and PCR Zona pellucida of each thawed embryo was microsur ’cally opened with 22-guage needles in PBS (Ca’Mg2+ free), 0.4% BSAFAF and embryonic cells were extracted, washed twice with pipette change, put in 60 p1 of H20 super Q sterile, and boiled 10 min at 100°C (Ninomiya et al., 1989). DNA amplification was immediately carried out by the method of Saiki et al. (1988) with minor modifications. Each amplification mixture contained (in 100 p1) the boiled blastocyst cells (in 60 p1 H20), 0.2 pg of each purified oligonucleotide primer, 200 pM each dNTPs (dATP, dCTP, dTTP, and dGTP), 50 mM KCI, 10 mM Tris-HC1 (pH 8.3),1.5 mM MgCl,, 1% (w/v) gelatin, 10% dimethyl sulfoxide (DMSO), and 2.5 units of Taq polymerase (PerkinElmer Cetus, Norwalk, CT). PCR amplification was performed with a DNA Thermal Cycler (Perkin-Elmer Cetus, Norwalk, CT). It consists in 35 cycles of denaturing at 95°C for 1min, annealing at 55°C for 1 min, and extension at 72°C for 1 min with 2 sec “Auto Seg Extension” per cycle at the extension step. Each PCR samples was subjected to electrophoresis on a 1.4% agarose gel (ICN Biomedicals Inc., Irvine, CA). Statistical analysis was by x2 test with the Yates discontinuity correction and by Fisher-Snedecor test. RESULTS Serial Washings Figure 2 shows that radiolabeled plasmids were strongly captured by spermatozoa. After ten successive washings, the proportion of plasmids carried by the spermatozoa is almost unchanged (P < 0.025). Eight percent of radiolabeled DNA was retained compara-
ELECTROPORATION OF BOVINE SPERMATOZOA
_I
pRGH527
1 ORi
TK
CAT
prGH
H
ti
n
Amp
+
*
10
CCCGTTTATTCACAlTCTTGCCC d ..... ..
...
9
..........
+GACGCTACTCACCGTCCCGCCCCGC primer SIR 2
2480
2
3
2&9
5
10
Washings
100
-
9080
-
70
-
--O- 0.290EtOH
* 20uMio. 0.49bEtOH
6050 40 30
-
--t
-
-
m10 -
0:
I
0 Washings
.
I
.
30
,
60
. , 120
.
,
0.05) was observed between capacitances 1 and 25 pFarads when spermatozoa were subjected to a 500, 1,000, or 1,500 V EF. Results also indicate no significant differ-
ence in retaining rates when electroporation was executed at 1,000 V (6.8 and 6.3% for 1 and 25 pFarads, respectively) compare to 500 (4.3 and 6.0%) or 1,500 V (5.1 and 5.8%) (P > 0.05). In addition, in the same figure, the electroporated spermatozoa were treated with the ionophore A23187 to determine the portion of plasmids associated with the acrosome and the plasma membrane above it. The comparison of plasmid holding back rates by sperms from Figure 8 revealed a significant (P < 0.01) difference between electroporation in M medium (6.5 and 3.8% for 1 and 25 pFarads, 100 V) and control (1.0%).Also, with electroporation at capacitance of 25 KFarads, spermatozoa retained the same amount of
ELECTROPORATION OF BOVINE SPERMATOZOA
11
plasmids in MT than in M alone while at 1 pFarads, M has over twice the efficiency of MT (6.2 vs. 2.5%, respectively). On the other hand, M medium (at 100 V, 1 pFarads) allow sperms to retain as much plasmids than TALP (1and 25 pFarads, 500 V) (P < 0.01) and little less than TALP (1 and 25 pFarads, 1,000 V) (P > 0.25).
DNase Treatment of Electroporated Spermatozoa Electroporated sperm cells in TALP retained 35 and 28% (1,000 V, 1and 25 pFarads) of the initial radioactivity, and 54 and 58%when electroporated in M (100 V, 1 and 25 pFarads). Sperm cells in contact with the plasmids but not submitted to the electroporation treatment did not retain large amount of DNA (3%) when co-incubated with DNase-I mixture (Fig. 9).
Autoradiography The analysis of autoradiography of zygotes indicate that the electroporated spermatozoa can carry the radiolabelled plasmids into the oocytes. In Figure 10A, sperm head carrying plasmids is under the zona pellucida during fertilization, while sperm head is forming a pronucleus in Figure 10B. Note that Figures A and B do not show dispersed plasmids in oocyte cytoplasm. In this third oocytes, the radiolabeled DNA is dispersed in the cytoplasm (Fig. 1OC). If spermatozoa are mixed with the plasmids without electroporation, most marked DNA molecules seems to be retained by the zona pellucida during the fertilization (Fig. lOD), while some quantity can be carried into the cytoplasm.
Development of Embryos A total of 276 embryos were used as control and 479 embryos obtained from oocyte fertilized with electroporated spermatozoa were transfered for in vivo development. The embryos obtained with the treated spermatozoa showed a significantly (P< 0.05) lower developmental (15% vs. 19% for control) rate to the morulae-blastocysts stages. The fertilization rate (18 h postinsemination) was 85% for control and 55% for electroporated sperm, which is significantly decreased too (P< 0.01). In vitro development resulted in a good success rate 25, 28, 22, and 20% of embryos developing to the morula stage for control (n = 118), treated in TALP medium (1,000 V, 25 pFarads, n = 5791, in MT (100 V, 25 pFarads, n = 132) and in M (100 V, 1 pFarads, n = 105), respectively. In vitro developmental rates of the four groups were not significantly different (P< 0.01).
controlTALPITALP25 M 1
M 25 lugDNA
Conditions
Fig. 9. Digestion of plasmids of sperms by DNsaeI. This figure shows that after treatment with DNase, plasmids were remaining in sperm cells at the proportion of 3,1,35.9,27.5,53.8, and 58.4%of the initial amounts for control, electroporated cells in TALP (1 or 25 FFarads, 1,000 V) and mannitol (MI (1 or 25 FFarads, 100 V), respectively. Plasmid DNA was significantly less digested in TALP and M (P< 0.005, Fisher-Snedecor test) than in control (*I. (Five replicates.)
rated sperms were tested for the presence of foreign DNA. In four cases (lanes 4, 13, 14, and 15) the intact targeted sequence is present on the zona pellucida since it is reflected by the fragment of 500 bp in electrophoretic gel. In other cases, different length of target sequence were forming the smears (lanes 6, 7, 9, and 10).This Figure shows only five amplifications for each electroporation medium. The amplification of plasmids in embryonic cells at the morula-blastocyst stage is shown in Figure 11B [lanes 7, 8 for diped spermsplasmids (lanes 6 to lo), 11, 12, and 14 for electroporated in TALP (lanes 11 to 15), 16, 18, and 19 in MT (lanes 16 to 20), and 21, 22, 23, and 25 in M medium (lanes 21 to 2511. In this experiment 12% (8/67) of the embryos were positives for the presence of plasmids. The combination of all experiments revealed morulae and blastocysts with a positive response after PCR amplification at a rate of 22% (41/188), 17% (5/29), and 19% (4/21) for electroporated sperms in TALP (25 pFarads, 1,000 V), mannitol-TALP (1/1)(25 pFarads, 100 V), and mannitol(25 pFarads, 100 V), respectively. The electrical parameters were selected for optimum efficiency determined in previous experiments of this work.
DISCUSSION
The present studies clearly demonstrate that foreign DNA can be stably captured by bovine spermatozoa following electroporation treatment to be carried into oocytes during fertilization. The incubation of spermaPCR tozoa with DNA construct seems to be sufficient to The molecular analysis of DNA from morulae and make sperm cells carriers of plasmids, as already blastocysts by enzymatic amplification (PCR) revealed mentioned by Lavitrano et al. (1989)and Azerro (19891, that some traces of target sequence of plasmid but success with this technique has not been yet pRGH527 were present at the surface of the zonae published by other groups. In our work, several combipellucidae. In Figure 11A, 12 zonae pellucidae of em- nations of capacitance and voltage were evaluated to bryos obtained following fertilization with electropo- obtain efficient incorporation of plasmids in spermato-
Fig. 10. Autoradiography of bovine oocyte fertilized by electroporated spermatozoa. Sperm head (large arrow) (representing radiolabeled plasrnids) under the zona pellucida (thin arrow) (A). Early male pronucleus with foreign DNA (B). One cell embryo with dispersed radiolabeled plasmids (arrows) in cytoplasm (C). In D, bovine oocyte has been fertilized with spermatozoa (107/ml)incubated (12 rnin) with radiolabeled plasmids (1 p,g/ml) (thin arrows) without electroporation ( x 1,000).
ELECTROPORATION OF BOVINE SPERMATOZOA
13
A
Fig. 11. Detection of plasmids pRGH527 in embryos by PCR. In upper photography (A), 12 zonae pellucidae were assayed to verify the presence of plasmids. The corresponding lanes are positive control (lane 1,500 copies of plasmid), zero negative control (lane 2), zona pellucida of plasmid-unexposed embryo as negative control for cross contamination (lane 31, and zonae pellucidae of embryos derived from fertilization of oocytes by electroporated spermatozoa (lanes 4 to 15). Plasmids were weakly detected in four zona pellucida (lanes 4,13,14, and 15). Lane M is 1 kb DNA ladder. The 500 bp target fragment specific to the CAT gene is indicated by arrow. Photography a t bottom (B) show the migrating agarose gel of 23 PCR-amplified embryos
(without zonae pellucidae). Lanes 1 and 2 are a zero negative control, lanes 3 to 5 are nontreated embryos negative controls, lane 26 is a positive control (500 copies of plasmid), and lane M is a 1 kb DNA ladder. Bands of 500 bp in lanes 7,8,11,12, 14, 16, 18,19,21,22,23, and 25 revealed that plasmid DNA is still present in embryonic cells at the morula-blastocyst stage. Amplification of embryos produced with soaked sperms with plasmids, without electroporation are represented by lanes 6 to 10. Then proceeding from electroporated spermatozoa in TALP by lanes 11to 15, in mannitol-TALP by lanes 16 to 20 and in mannitol alone by lanes 21 to 15.
zoa following treatment by electrical field. We have observed that electroporated sperm cells retain DNA molecules more efficiently than spermatozoa not submitted to the electrical field, and we estimate that each electroporated sperm cell retains about 3,000 copies of plasmids, which is similar to the observations of Azerro (1989). Acrosome reaction was not increased for electroporated spermatozoa compared to the controls, but contrarily to human sperm cells (Tomkins et al., 19881, for which electroporation induces that in a rate of 70% AR at 1,000 V. Decrease of fertilization rate cannot be explained by a premature acrosome reaction in our experiment. The lower fertilization and developmental rate could be explained by the probable damages inflicted by the rapid warming of the solution since the solution (TALP) used for electroporation is an isoosmotic ionic solution, though mannitol solution, a conductive medium, seemed to have the same effects. The
mannitol solution was tried for its nonelectrolytic characteristic and because experiments with plant protoplasts, mammalian cells, and vesicles have shown no severe side effects on membrane integrity or on the viability of the cells at room temperature (Zimmerman and Vienken, 1982). Another hypothesis is the possible damage launched into nuclear structure or directly in DNA of spermatozoa. It is well known that fertilization and subsequent developmental rate may change between different sources of the semen (Leibfried-Rutledge et al., 1987; Pavlok et al., 1988). Consequently, it is possible that electroporation could have a selective pressure on our pool of spermatozoa from five bulls and than the more resistant sperm cells were not necessary the more efficient for development. Induction of cell membrane pore formation by an electrical current has been used to induce foreign DNA insertion into a variety of plant and animal cells (Chu et al., 1987). In
14
M.B. G A G N ~ET AL.
agreement with that, following DNase digestion, the present results showed that plasmids were partly incorporated into the plasma membrane. The method using calcium ionophore A23187 to remove the acrosome indicate that about 15%of plasmids were linked at this level, and in our experiment, at least 93% of sperm cells were acrosome reacted following ionophore treatment. Based on these results, it is not possible to conclude if plasmids were inside the plasma membrane or strongly bounded and embedded in it. We have also found that constructscarried by spermatozoa might be retained by zona pellucida during the penetration because four of 12 zonae pellucidae showed residual DNA following enzymatic amplification. This confirms the experiment of autoradiography where plasmids were seen in and on zona pellucida. The conventional method to evaluate transgenic animals is DNA extraction and Southern blot. This procedure requires more DNA than is contained in a bovine blastocyst and therefore requires the use of recipients and foetuses. Recently, PCR technique was used to evaluate the transgenic mice at the blastocyst level (Ninomya et al., 1989). We are well aware that blastocyst evaluation may lead to a false positive due to amplification of free copies as mentioned by Ninomiya et al. (1989) and Lo et al. (1989) and for parental diagnosis of diseases (West, 1989). After incorporation in oocytes, foreign DNA could stay free for several cell cycles and the episomal replication has been observed in the sea urchin or the chicken embryos (McMahon et al., 1985; Flytzanis et al., 1985; Sang and Perry, 1989). Nevertheless, the present experiment demonstrates that pRGH527 DNA was carried into oocytes by sperm cells and persist in denuded embryonic cells until the blastocyst stage. In summary, the electroporation of bovine sperm cells allow to carry foreign interested DNA in oocytes and could provide transgenic bovine embryos by a less traumatic process than microinjection. However, at this stage, it is still requisite to let embryos grow into recipient to analyze complete genomic DNA.
ACKNOWLEDGMENTS We gratefully acknowledge Dr. Sylvain Guerin for his technical help and for his generous gift of plasmids. We also thank Mrs. Josee Poulin for typing. This work was supported by the Conseil des Recherches en Production Animale du Quebec (2194) and National Science and Energy Council of Canada in collaboration with Semex Canada and Agriculture Canada. REFERENCES Andres AC, Schonenberger CA, Groner B, Hennighausen L, Lemeur M, Gerlinger P (1987): Haras oncogene expression directed by a milk protein gene promoter: tissue specificity, hormonal regulation and tumor induction in transgenic mice. Proc Natl Acad Sci USA 84:1299-1303. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1987): “Current Protocols in Molecular Biology.” New York: Greene Publishing, Wiley Interscience, pp 3.13.1-3.13.2. Azerro F (1989): Sea urchin sperm as a vector of foreign genetic information. Cells Biol Inter Rep 13:391404.
Bavister RD, Leibfried ML, Lieberman G (1983): Development of preimplantation embryos of the golden hamster in a defined culture medium. Biol Reprod 28:235-247. Bavister BD, Yanagimachi R (1977): The effect of sperm extract and energy source on the motility and acrosome reaction of hamster sperm in vitro. Biol Reprod 16:228-237. Ben-Av P, Rubinstein S, Breitbart H (1988): Induction of acrosomal reaction and calcium uptake in ram spermatozoa by ionophores. Biochemica et Biophysica Acta 939:214-222. Bennet PJ, Moatti J P , Mansat A, Ribbes H, Cayrac JC, Pantonnier F, Chap H, Douste-Blazy L (1987): Evidence for the activation of phospholipases during acrosome reaction of human sperm elicited by calcium ionophore A23187. Biochemica Biophysica Acta 919: 255-265. Biery KA, Bondioly KR, De Mayo FJ (1988): Gene transfer by pronuclear injection in the bovine. Theriogenology 29:224. Boland MP (1984):Use of the rabbit oviduct as a screening tool for the viability of mammalian eggs. Theriogenology 21:127-137. Brinster RL, Sandgren EP, Behringer RR, Palmiter RD (1989): No simple solution for making transgenic mice. Letters to the editor. Cell 59:239-241. Brinster RL, Chen HY, Trumbauer ME, Yagle MK, Palmiter RD (1985): Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci USA 82:44384442. Bryan JHD, Akruk SR (1977): A naphtol yellow S and erythrosin B staining procedure for use in studies in the acrosome reaction of rabbit spermatozoa. Stain Tech 52:47-51. Byrd W (1981): In vitro capacitation and the chemically induced acrosome reaction in bovine spermatozoa. J Exp Zoo 215:35&6. Chu G, Hayakawa H, Berg P (1987): Electroporation for the efficient transfection of mammalian cells with DNA. Nucleic Acids Res 3~1311-1326. Davis LG, Dibner MD, Battey JF (1986): “Basic Method in Molecular Biology.” New York: Elsevier Science Publishing Co., Inc., pp 72-74. Evans GA, Ingraham HA, Lewis K, Cunningham K, Seki T, Moriuchi T, Chang HC, Silver J, Hyman R (1984): Expression of the thy1-glycoproteingene by DNA-mediated gene transfer. Proc Natl Acad Sci USA 81:5532-5536. Eyestone WH, First NL (1989): Co-culture of early cattle embryos to the blastocyst stage with oviductal tissue or in conditioned medium. J Reprod Fertil 85:715-720. Flytzanis CN, McMahon AP, Hough-Evans BR, Katula KS, Britten RJ, Davidson EH (1985):Persistance and integration of cloned DNA in postembryonic sea urchins. Dev Biol 108:431-442. Gagn6 M, Pothier FP, Sirard MA (1990): Developmental potential of early bovine zygotes submitted to centrifugation and microinjection following in vitro maturation of oocytes. Theriogenology 34:417425. Hogan B, Costantini F, Lacy E (1986): “Manipulating the Mouse Embryo: A Laboratory Manual.” 1st edition. New York: Cold Spring Harbor Laboratory, pp 153-197. Knutson JC, Yee D (1987): Electroporation: Parameters affecting transfer of DNA into mammalian cells. Anal Biochem 164:44-52. Land RB, Wilmut I (1987): Gene transfer and animal breeding. Theriogenology 27:169-178. Lavitrano M, Camaioni A, Fazio VM, Dolci S, Farace MG, Spadafora C (1989): Sperm cells as vectors for introducing foreign DNA into eggs: Genetic transformation of mice. Cell 57:717-723. Leibfried L and First NL (1979): Characterization of bovine follicular oocytes and their ability to mature in vivo. J Anim Sci 48:76-86. Leibfried-Rutledge ML, Critser ES, Eyestone WH, Northey DL and First NL (1987):Developmental potential of bovine oocytes matured in vitro or in vivo. Biol Reprod 36:376-383. Leonard JM, Abramczuk JW, Pezen DS, Rutledge R, Belcher JH, Hakim F, Shearer G, Lamperth L, Travis W, Fredrickson T, Notkins AL, Martin MA (1988): Development of disease and virus recovery in transgenic mice containing HIV proviral DNA. Science 242: 1665-1670. Lo YMD, Mehal WZ, Fleming KA (1989): False positive results and the polymerase chain reaction. Lancet 1:679. Maddox J (1989): Transgenic routes runs into sand. Nature 341:686.
ELECTROPORATION OF BOVINE SPERMATOZOA McMahon AP, Flytzanis CN, Hough-Evans BR, Katula KS, Britten RJ, Davidson EH (1985):Introduction of cloned DNA into sea urchin egg cytoplasms replication and persistance during embryogenesis. Dev Biol 108:420430. Miller JF, Dower WJ, Thompkins LS (1988): High-voltage electroporation of bacteria: genetic transformation of campylobacter jejuni with plasmid DNA. Proc Natl Acad Sci USA 85:856-860. Neumann E, Schaefer-Rider M, Wang Y, Hofschneider PH (1982): Gene transfer into mouse lyoma cells by electroporation in high electric field. EMBO J 7:841-845. Ninomiya T, Hoshi M, Mizumo A, Magao M, Yuki A (1989): Selection of mouse preimplantation embryos carrying exogenous DNA by polymerase chain reaction. Mol Reprod Dev 1:242-248. Parrish J J , Susko-Parrish JL, First NL (1985): Effect of heparin and chondroitin sulfate on the acrosome reaction and fertility of bovine sperm in vitro. Theriogenology 24:537-549. Parrish JJ, Susko-Parrish J , Winer MA, First NL (1988):Capacitation of bovine sperm by heparin. Biol Reprod 38:1171-1180. Pavlok A, Torner H, Motlik J, Fulka J, Kauffold D, Duschinski U (1988): Fertilization of bovine oocytes in vitro: Effect of different sources of gametes on fertilization rate and frequency. Anim Reprod Sci 16:207-213. Rexroad Jr CE, Hammer RE, Dolt DJ, Mayo KE, Frohman LA, Palmiter RD, Brinster RL (1989): Production of transgenic sheep with growth regulating genes. Mol Reprod Dev 1:164-169. Roschlau K, Pommel D, Andreewa L, Zackel M, Roschlau D, Zackel B, Schwerin M, Huhn R, Gazarjan KG (1989): Gene transfer experiments in cattle. J Reprod Fertil 38 (Suppl):153-160. Saiki RK, Gelfand GH, Stoffel S, Scharf SJ, Higuehi R, Horn GT, Mullis KB, Erlish HA (1988): Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491.
15
Sang H, Perry MM (1989): Episomal replication of cloned DNA injected into the fertilized ovum of the hen, Gallus domesticus. Mol Reprod Dev 1:98-106. Sinn E, Muller W, Pattengale P, Tepler I, Wallace R, Leder P (1987): Coexpression of MMTVN Ha-Ras and MMTVlc-myc genes in transgenic mice: Synergistic action of oncogenes in vivo. Cell 49:465-475. Sirard MA, Leibfried-Rutledge L., Parrish J, Ware C, First NL (1988): The culture of bovine oocytes to obtain developmentally competant embryos. Bio Reprod 39:546-552. Sirard MA, Lambert RD, Menard DP, Bedoya M (1985): Pregnancies after in vitro fertilization of cow follicular oocytes, their incubation in rabbit oviduct and their transfer to the cow uterus. J Reprod Fertil 75551-556. Small JA, Scangos GA, Cork L, Jay G, Khoury G (1986): The early region of human papovavirus J C induces dysmyelination in transgenic mice. Cell 46:13-18. Thomkins PT, Houghton J A (1988): The rapid induction of the acrosome reaction of human spermatozoa by electropermabilization. Fert and Ster 50:329-336. Tripputi P, Guerin SL, Moore DD (1988): Two mechanisms for the extinction of gene expression in hybrid cells. Science 241:12051207. Wagner TE (1984): The possibility of transgenic livestock. Theriogenology 21:29-44. West J D (1989): The use of DNA probes in preimplantation and prenatal diagnosis. Mol Reprod Dev 1:138-145. Whittingham DG (1971): Survival of mouse embryos after freezing and thawing. Nature 233:125-126. Zimmerman U, Vienken J (1982): Electric field-induced cell-to-cell fusion. Memb Biol 67:165-182.
(1991)
ElectroPoration of Bovine Spermatozoa to Carry Foreigi DNA in Oocytes MARC B. GAGN@,ly2FRANCOIS POTHIER,'v3 AND MARC-ANDRE SIRARD'-2 Unit6 de Recherche en Ontogdnie et Reproduction, 3Laboratoire d'endocrinologie moldculaire, CHUL Research Center and Lava1 University, and 'Ddpartement de Zootechnie, Pavillon Paul-Comtois, Citd Universitaire, Qutbec (Qudbec), Canada In the present study, electroporaABSTRACT tion was used to test the ability of spermatozoa to carry foreign DNA into the bovine oocytes. Frozen-thawed bovine spermatozoa (107/ml) were electroporated using six different combinations of voltge (500, 1,000, or 1,500 V) and capacitance (1 or 25 pFarads) in the presence of 1 mg/ml of plasmid pRGH527. The portions of plasmids retained by sperm cells after three washings (stable for ten washings) were 4.3, 5.5, 5.1, 6.0, 6.8, and 5.8% for 1 pfarad, 500, 1,000, and 1,500 V and 25 pFarads, 500, 1,000, and 1,500 V, respectively. Nonelectroporated cells have retained only 1%of plasmids. In the same experiment, electroporated spermatozoa were acrosome reacted by treatment with ionophore A23187 to evaluate the fraction of marked plasmids joined at the acrosomal membrane. The results show that 3.5, 5.0, 4.4, 5.0, 6.3, and 4.4% remain tied to the ionophore-treated sperm. Only 0.7%of plasmid was retained after removal of the acrosome of nonelectroporated cells. Acrosome reaction was not significantly induced by the electrical field (EF) (P < 0.005). EF decrease motility significantly for >lo0 V in 0.3 M mannitol (M) and mannitol-TALP (MT) (111) media and 2500 V (P < 0.05) in TALP medium. The retained plasmid rate was compared between TALP medium M and MT media and resulted in a percentage of 1.0, 2.5, 6.5 at 1 pFarads, 100 V, and 0.9, 3.8, and 3.8 at 25 pFarads, 100 V in TALP, MT, and M medium, respectively. Sperm cells electroporated at 1 pfarad, 500 or 1,000 V, 25 pfarad, 500 V or 1,000 in TALP medium hold plasmids in proportion of 5.2,5.4,7.4, and 6.0%. Electroporation above 100 V in M and MT killed the cells. In a part of this experiment, spermatozoa electroporated in the presence of radiolabeled plasmids have been treated with DNase I and results revealed that 35, 28, 54, 58, and 3%of marked DNA remains in sperm cells following digestion after electroporation in TALP (1,000 V, 1 and 25 pFarads), M medium (100 V, 1 and 25 pFarads), and control, respectively. Using in vitro matured bovine oocytes, the electroporation conditions were correlated with the fertilization rate (85%for control and 55% for electroporated spermatozoa). Autoradiography of embryos following fertilization indicated the presence of plasmids in the cytoplasm and in the zona pellucida. Finally, the use of Polymerase Chain Reaction (PCR) revealed the presence of plasmids in blastocyst cells in 12%for control (n = 67) and 22, 17, and 19%for electroporated spermatozoa in TALP (n = 188,25
1991 WILEY-LISS, INC.
pFarads, 1,000 V), MT (n = 29, 25 pFarads, 100 V) and M (n = 21, 25 pFarads, 100 V), respectively. In conclusion, our results indicate A) that electroporation results in an increase absorption of DNA by the spermatozoa, B) that the male gametes can carry foreing DNA in oocytes at fertilisation, and C) that an increased fraction of day 5 embryos is showing a positive response for the inserted gene with the polymerase chain reaction.
Key Words: Sperm, Bovine, Electroporation, PCR, Transgenic
INTRODUCTION T h e production of transgenic mice by microinjection o f DNA i n t o mouse embryos has rapidly gained importance as an experimental tool t o study t h e factors w h i c h determine t h e tissue-specificity of gene expression, t o generate models for human diseases (Leonard e t al., 1988; S m a l l e t al., 19861, as w e l l as t o look a t t h e consequences o f oncogene expressions (Andres e t al., 1987; S i n n et al., 1987). T h r o u g h t h i s technique, recombinant DNA molecules o f any type c a n be introduced i n t o zygotes (Hogan e t al., 1986) and t h u s can be used t o produce transgenic animals. T h e production o f transgenic animals by pronuclear microinjection i s s t i l l problematic in large domestic animals (Rexroad e t al., 1989; Roschlau e t al., 1989; B r i n s t e r e t al., 1985; B i e r y et al., 1988; Gagne e t al., 1990). Introduction of specific gene sequences i n t o early embryos, more particularly i n t o bovine embryos, may be a powerful tool t o obtain more valuable animals (Wagner, 1984). These applications include t h e modification o f several physiological processes such as growth, lactation, and wool production, t h e modification or creation o f n e w metabolic ways (Land and Wilmut, 1987), and possibly t h e genetic resistance t o specific diseases. Electroporation has previously been used b o t h for obtaining stable transformants in eucaryote cell lines ( K n u t s o n e t al., 1987; N e w m a n n e t al., 1982; Evans e t al., 1984) and t o introduce plasmids in bacteria ( M i l l e r e t al., 1988). M o r e recently, L a v i t r a n o e t al. (1989) reported the Received April 24, 1990; accepted December 17, 1990. Address reprint requests to Marc-Andre Sirard, Departement de Zootechnie, Pavillon Paul-Comtois, Citd Universitaire, Quebec (Quebec), G1K 7P4, Canada.
ELECTROPORATION OF BOVINE SPERMATOZOA successful transfer of foreign DNA into mouse oocytes by simple incubation of the spermatozoa with plasmid prior to in vitro fertilization. However, this approach seems restricted to some unknown conditions since so far no other groups have been able to produce transgenic mice using this method (Brinster et al., 1989; Maddox, 1989). The aim of this study was to evaluate the effect of electroporation pulse on bovine sperm cells physiology, to make them carriers of plasmid DNA, and to know if foreign nucleic sequences were persistent in embryonic cells following in vitro fertilization of in vitro matured bovine oocytes. Results show that foreign nucleic sequences can be introduced into bovine oocyte by electroporated spermatozoa.
7
ELMof the calcium ionophore A23187 (Sigma Chemical Co., St. Louis, MO) and incubated 2 h at 37°C with continuous agitation. Following incubation, the spermatozoa were washed once and radioactivity of supernatants and pellets (cells) were counted separately in Liquid Scintillation Counter (Beckman, Fullerton, CA). Samples of electroporated spermatozoa were washed ten times to verify the stability of plasmids anchorage.
Staining Procedure The induction of acrosome reaction was measured by light microscopy following a staining procedure of Bryan and Akruk (1977). At selected times (0, 30, 60, 120 and 240 min) of calcium ionophore treatment or after electroporation, 10 pl samples were taken, immeMATERIALS AND METHODS diately smeared on protamine covered slides, dried at Preparation of Plasmid DNA room temperature and stained with naphtol yellow S The plasmid pRGRH527 (provided by Dr. S. Guerin) and erythrosin B (Sigma Chemical Co., St. Louis, MO). contains the bacterial gene CAT (chloramphenicol Acrosomal caps stained cherry-red while the postacetyl transferase) placed under the control of the nuclear caps stained a pale pink. The loss of the 5'-527 bp rat growth hormone promoter (Tripputi et al., acrosomal caps was determined by phase-contrast mi1988). Prior to use, the construct was linearized by croscopy; 350 to 500 spermatozoa were counted for each single site BglII cleavage and when specified end- sample. labeled (5') with [a3,P]-ATP (Amersham Corp., OnDNase Incubation tario, Canada) as described by Davis et al. (1986). The electroporated DNA-sperm suspensions (in Sperm Preparation and Electroporation TALP, control or 1,000 V, or 25 pFarads, and in Frozen-thawed sperm was obtained from a pool of Mannitol, 100 V, 1or 25 pFarads) were washed once in five different bulls (frozen as a pool) donated by the TALP medium as described above and once in 5 ml of Centre #Insemination Artificielle du Quebec (C.I.A.Q., DNase 1buffer (consisting of 50 mM Tris-HCl, pH 7.5, Inc., St-Hyacinthe, Quebec, Canada). The straws were 10 mM MgCl,, 50 pg/ml BSAFAF) (Ausubel et al., thawed in water bath (35"C, 1 min), and used immedi- 1987) at 750g for 10 min at 20°C. Supernatant was ately; lo7 spermatozoa were added to 1 ml of TALP removed and pellet resuspended in 1 ml of the same medium (Parrish et al., 1985,1988)supplemented with buffer; 500 p1 of each suspension were kept as undi0.6% bovine serum albumin fatty acid free (BSAFAF) gested controls. Two units of DNaseI were added in the (Sigma Chemical Co., St. Louis, MO) or 1 ml of 0.3 M 500 pl suspension remnants and incubated 15 min at mannitol, 0.1 mM MgCl,, 0.05 mM CaCl, (Sigma 37°C. The reaction was arrested by addition of 25 pl of Chemical Co., St. Louis, MO) (Zimmerman et al., 1982) 0.5M EDTA. Digested and undigested electroporated or 1 ml of 50% TALP-medium-50% mannitol medium sperm were finally washed twice in 5 ml TALP medium (v/v),each one containing 1 pg of radiolabeled plasmid and assayed for radioactivity. Substraction of radioacpRGH527 in a 1.4 ml Gene Pulser Cuvette (Bio-Rad tivity of DNase-treated sperms from nonDNase-treated Laboratories, Richmond, CA) with a distance of 4 mm sperms give the fraction of plasmids removed from the between electrodes. Electroporation was accomplished surface of sperm cells. within different combinations of capacitance (1 or 25 pFarads) and voltage (100,500,1,000, or 1,500 V) using In Vitro Maturation and Fertilization of Oocytes Heifers or cow ovaries from cycling or pregnant a Gene Pulser Apparatus (Bio-Rad,Laboratories, Richmond, CA). EF was 0.4 second of duration. The ability animals were removed within 30 min after slaughter of electrical field (EF) to induce acrosome reaction was and transported to the laboratory at about 32°C in 0.9% assayed and the effect on motility was evaluated before NaCl aqueous solution containing 100,000 UI/1 peniand after electroporation. To evaluate the proportion of cilline, 100 mg/l streptomycin, and 250 pg/l amphoteriplasmid associated to the acrosome membrane, electro- cin B (Sigma Chemical Co., St. Louis, MO). Briefly, the porated sperm cells were treated with calcium iono- cumulus oocyte complex (COC)were aspirated from 1to phore and acrosome reacted (Ben-Avet al., 1988; Byrd, 5 mm follicles with 18 g needle, pooled, and selected in 1981; Bennet et al., 1987). To evaluate plasmid incor- accordance of cumulus appearance (Leibfried and First, poration, radiolabeled DNA was used during electropo- 1979). The COC were washed three times in hepes ration and then the sperm was washed twice in 5 ml of buffered tyrode's medium (TLH) (Bavister et al., 1983), TALP medium by centrifugation at 500g for 10 min at supplemented with 0.2 mM pyruvic acid (Sigma Chem20°C. Supernatant was then removed and assayed for ical Co., St. Louis, MO), 0.9 mg/ml glucose (Fisher radioactivity content. Remaining cells were resus- Scientific Co., NJ), 10% fetal calf serum (heat-treated pended in 500 pl of TALP medium with 3 mM CaCl,, 10 FCS, Gibco Lab., Grand Island, NY), and 0.05 mg/ml
8
M.B. GAGNE ET AL.
gentamycin (Sigma Chemical Co., St. Louis, MO). Oocyte maturation was carried out as described before (Sirard et al., 1988): ten oocytes were added in each 50 p1 droplets of maturation media consisting of TCM-199 with Earles salts and 220 mgilOO ml NaC03 (Gibco Lab, Grand Island, NY), 10%heat-treated FCS, 5 pgiml LH (National Institute of Diabetes and Digestive and Kidney Diseases), 0.5 pgiml FSH (NIDDK), 0.2 mM pyruvic acid, 1 pgiml estradiol 17p (Sigma Chemical Co., St. Louis, MO), and 0.05 mgiml gentamycin. The media and the mineral oil recovering droplets (Aldrich Chemical Co., Milwaukee, WI) were preexposed to the maturation conditions for a minimum of 2 h (38.5”C,5% C02, 95% air atmosphere with 100% humidity). In vitro fertilization was accomplished into fertilization medium droplets (45 pl) [composed of modified tyrode lactate medium (Bavister and Yanagimachi, 1977), 0.6% BSA FAF, 0.2 mM pyruvic acid, 10 pgiml heparin (Sigma Chemical Co., St. Louis, MO), and 0.05 mgiml gentamycinl containing 5 COC previously washed two times for 5 min in glucose free TLH (Parrish et al., 1988). The fertilization media droplets were placed in sterile Petri dishes under mineral oil and equilibrated for 2 h in culture conditions prior to use. Five microliters of electroporated sperm (50,000 sperm cells) suspension were directly added into each droplet.
Autoradiography Eighteen hours following fertilization, zygotes were washed and prepared for autoradiography. Embryos were embedded in agar (1%)(Sigma Chemical Co., St. Louis, MO), fixed in paraformaldehyde (4%), dehydrated in ethanol (70%) for up to 2 h, and followed by ethanol (100%) for 15 min. The same day, these embryos were mounted in paraffin and cut in 10 pm slices. Slices were fixed on the pregelatinized glass slides. Following soaking in emulsion NTB2 solution (Kodak Canada, Ontario, Canada), the slides were exposed during 3 weeks at 4°C. Finally, slices of embryos were examined under phase-contrast microscope. Development of Embryos to Blastocyst Stage In the third part of this experiment, oocytes fertilized with electroporated spermatozoa were transferred to the ligated oviducts of pseudopregnant rabbit (Boland, 1984) 48 h after an i.v. injection of 75 UI of HCG (Pharma Science, Inc., Montreal, Canada) (Sirard et al., 1985). Embryos were transferred with 1 mm diameter polypropylene tubing (Fisher Sci. Co., NJ) by midventral laparatomy in oviducts of the anaesthetized rabbits. A mean number of 16 control embryos and 28 “treated” were transferred in 17 rabbits; 120 hours later, the oviducts were excised and flushed with phosphate-buffered saline (PBS, Whittingham, 19711, 0.4% BSAFAF, and 0.05 mgiml gentamycin at 35°C. The recovered blastocysts were kept individually in 20 pl of PBS’CA2+Mg2+free and stored at -20°C before PCR analysis. Additionally, in vitro development of embryos was obtained with a coculture of bovine ovi-
ductal cells have been prepared according to the procedures of Eyestone and First (1989) with some changes. The mucosal tissue was transferred in a 50 ml conical tube with 20 ml Hank’s medium (containing 5% FCS and 5 pg/ml gentamycine); 40 p1 of the decanted tissues were incubated 24 h at 39”C, 5% C02, 95% air atmosphere, and 100% humidity in a 50 ml culture bottle with 10 ml of preequilibrated TCM-199FCS lo%, 0.2 mM pyruvic acid, and 50 pgiml gentamycine. After culture, oviductal tissue forming very small vesicles were chosen. Between 50 to 100 selected vesicles were put in a 50 pl TCM-199FCS droplets under mineral oil [with 20 to 25 (two to four cells) embryos per droplet] in a 60 mm Petri dishes. Culture medium was replenished every 48 h by adding 50 pl of fresh TCM-199FCS.After 5 days, embryos were evaluated for development to the compact morula or blastocyst stage.
Oligonucleotide Primers Oligonucleotide primers were synthesized using a Biosearch 8700 DNA synthesizer (A New Brunswick Scientific Company, NB, Canada). The sequences of the primer were chosen in such a manner to amplify a fragment specific to the CAT gene. Localization and orientation of each primer are shown in Figure 1. Preparation of Embryonic DNA and PCR Zona pellucida of each thawed embryo was microsur ’cally opened with 22-guage needles in PBS (Ca’Mg2+ free), 0.4% BSAFAF and embryonic cells were extracted, washed twice with pipette change, put in 60 p1 of H20 super Q sterile, and boiled 10 min at 100°C (Ninomiya et al., 1989). DNA amplification was immediately carried out by the method of Saiki et al. (1988) with minor modifications. Each amplification mixture contained (in 100 p1) the boiled blastocyst cells (in 60 p1 H20), 0.2 pg of each purified oligonucleotide primer, 200 pM each dNTPs (dATP, dCTP, dTTP, and dGTP), 50 mM KCI, 10 mM Tris-HC1 (pH 8.3),1.5 mM MgCl,, 1% (w/v) gelatin, 10% dimethyl sulfoxide (DMSO), and 2.5 units of Taq polymerase (PerkinElmer Cetus, Norwalk, CT). PCR amplification was performed with a DNA Thermal Cycler (Perkin-Elmer Cetus, Norwalk, CT). It consists in 35 cycles of denaturing at 95°C for 1min, annealing at 55°C for 1 min, and extension at 72°C for 1 min with 2 sec “Auto Seg Extension” per cycle at the extension step. Each PCR samples was subjected to electrophoresis on a 1.4% agarose gel (ICN Biomedicals Inc., Irvine, CA). Statistical analysis was by x2 test with the Yates discontinuity correction and by Fisher-Snedecor test. RESULTS Serial Washings Figure 2 shows that radiolabeled plasmids were strongly captured by spermatozoa. After ten successive washings, the proportion of plasmids carried by the spermatozoa is almost unchanged (P < 0.025). Eight percent of radiolabeled DNA was retained compara-
ELECTROPORATION OF BOVINE SPERMATOZOA
_I
pRGH527
1 ORi
TK
CAT
prGH
H
ti
n
Amp
+
*
10
CCCGTTTATTCACAlTCTTGCCC d ..... ..
...
9
..........
+GACGCTACTCACCGTCCCGCCCCGC primer SIR 2
2480
2
3
2&9
5
10
Washings
100
-
9080
-
70
-
--O- 0.290EtOH
* 20uMio. 0.49bEtOH
6050 40 30
-
--t
-
-
m10 -
0:
I
0 Washings
.
I
.
30
,
60
. , 120
.
,
0.05) was observed between capacitances 1 and 25 pFarads when spermatozoa were subjected to a 500, 1,000, or 1,500 V EF. Results also indicate no significant differ-
ence in retaining rates when electroporation was executed at 1,000 V (6.8 and 6.3% for 1 and 25 pFarads, respectively) compare to 500 (4.3 and 6.0%) or 1,500 V (5.1 and 5.8%) (P > 0.05). In addition, in the same figure, the electroporated spermatozoa were treated with the ionophore A23187 to determine the portion of plasmids associated with the acrosome and the plasma membrane above it. The comparison of plasmid holding back rates by sperms from Figure 8 revealed a significant (P < 0.01) difference between electroporation in M medium (6.5 and 3.8% for 1 and 25 pFarads, 100 V) and control (1.0%).Also, with electroporation at capacitance of 25 KFarads, spermatozoa retained the same amount of
ELECTROPORATION OF BOVINE SPERMATOZOA
11
plasmids in MT than in M alone while at 1 pFarads, M has over twice the efficiency of MT (6.2 vs. 2.5%, respectively). On the other hand, M medium (at 100 V, 1 pFarads) allow sperms to retain as much plasmids than TALP (1and 25 pFarads, 500 V) (P < 0.01) and little less than TALP (1 and 25 pFarads, 1,000 V) (P > 0.25).
DNase Treatment of Electroporated Spermatozoa Electroporated sperm cells in TALP retained 35 and 28% (1,000 V, 1and 25 pFarads) of the initial radioactivity, and 54 and 58%when electroporated in M (100 V, 1 and 25 pFarads). Sperm cells in contact with the plasmids but not submitted to the electroporation treatment did not retain large amount of DNA (3%) when co-incubated with DNase-I mixture (Fig. 9).
Autoradiography The analysis of autoradiography of zygotes indicate that the electroporated spermatozoa can carry the radiolabelled plasmids into the oocytes. In Figure 10A, sperm head carrying plasmids is under the zona pellucida during fertilization, while sperm head is forming a pronucleus in Figure 10B. Note that Figures A and B do not show dispersed plasmids in oocyte cytoplasm. In this third oocytes, the radiolabeled DNA is dispersed in the cytoplasm (Fig. 1OC). If spermatozoa are mixed with the plasmids without electroporation, most marked DNA molecules seems to be retained by the zona pellucida during the fertilization (Fig. lOD), while some quantity can be carried into the cytoplasm.
Development of Embryos A total of 276 embryos were used as control and 479 embryos obtained from oocyte fertilized with electroporated spermatozoa were transfered for in vivo development. The embryos obtained with the treated spermatozoa showed a significantly (P< 0.05) lower developmental (15% vs. 19% for control) rate to the morulae-blastocysts stages. The fertilization rate (18 h postinsemination) was 85% for control and 55% for electroporated sperm, which is significantly decreased too (P< 0.01). In vitro development resulted in a good success rate 25, 28, 22, and 20% of embryos developing to the morula stage for control (n = 118), treated in TALP medium (1,000 V, 25 pFarads, n = 5791, in MT (100 V, 25 pFarads, n = 132) and in M (100 V, 1 pFarads, n = 105), respectively. In vitro developmental rates of the four groups were not significantly different (P< 0.01).
controlTALPITALP25 M 1
M 25 lugDNA
Conditions
Fig. 9. Digestion of plasmids of sperms by DNsaeI. This figure shows that after treatment with DNase, plasmids were remaining in sperm cells at the proportion of 3,1,35.9,27.5,53.8, and 58.4%of the initial amounts for control, electroporated cells in TALP (1 or 25 FFarads, 1,000 V) and mannitol (MI (1 or 25 FFarads, 100 V), respectively. Plasmid DNA was significantly less digested in TALP and M (P< 0.005, Fisher-Snedecor test) than in control (*I. (Five replicates.)
rated sperms were tested for the presence of foreign DNA. In four cases (lanes 4, 13, 14, and 15) the intact targeted sequence is present on the zona pellucida since it is reflected by the fragment of 500 bp in electrophoretic gel. In other cases, different length of target sequence were forming the smears (lanes 6, 7, 9, and 10).This Figure shows only five amplifications for each electroporation medium. The amplification of plasmids in embryonic cells at the morula-blastocyst stage is shown in Figure 11B [lanes 7, 8 for diped spermsplasmids (lanes 6 to lo), 11, 12, and 14 for electroporated in TALP (lanes 11 to 15), 16, 18, and 19 in MT (lanes 16 to 20), and 21, 22, 23, and 25 in M medium (lanes 21 to 2511. In this experiment 12% (8/67) of the embryos were positives for the presence of plasmids. The combination of all experiments revealed morulae and blastocysts with a positive response after PCR amplification at a rate of 22% (41/188), 17% (5/29), and 19% (4/21) for electroporated sperms in TALP (25 pFarads, 1,000 V), mannitol-TALP (1/1)(25 pFarads, 100 V), and mannitol(25 pFarads, 100 V), respectively. The electrical parameters were selected for optimum efficiency determined in previous experiments of this work.
DISCUSSION
The present studies clearly demonstrate that foreign DNA can be stably captured by bovine spermatozoa following electroporation treatment to be carried into oocytes during fertilization. The incubation of spermaPCR tozoa with DNA construct seems to be sufficient to The molecular analysis of DNA from morulae and make sperm cells carriers of plasmids, as already blastocysts by enzymatic amplification (PCR) revealed mentioned by Lavitrano et al. (1989)and Azerro (19891, that some traces of target sequence of plasmid but success with this technique has not been yet pRGH527 were present at the surface of the zonae published by other groups. In our work, several combipellucidae. In Figure 11A, 12 zonae pellucidae of em- nations of capacitance and voltage were evaluated to bryos obtained following fertilization with electropo- obtain efficient incorporation of plasmids in spermato-
Fig. 10. Autoradiography of bovine oocyte fertilized by electroporated spermatozoa. Sperm head (large arrow) (representing radiolabeled plasrnids) under the zona pellucida (thin arrow) (A). Early male pronucleus with foreign DNA (B). One cell embryo with dispersed radiolabeled plasmids (arrows) in cytoplasm (C). In D, bovine oocyte has been fertilized with spermatozoa (107/ml)incubated (12 rnin) with radiolabeled plasmids (1 p,g/ml) (thin arrows) without electroporation ( x 1,000).
ELECTROPORATION OF BOVINE SPERMATOZOA
13
A
Fig. 11. Detection of plasmids pRGH527 in embryos by PCR. In upper photography (A), 12 zonae pellucidae were assayed to verify the presence of plasmids. The corresponding lanes are positive control (lane 1,500 copies of plasmid), zero negative control (lane 2), zona pellucida of plasmid-unexposed embryo as negative control for cross contamination (lane 31, and zonae pellucidae of embryos derived from fertilization of oocytes by electroporated spermatozoa (lanes 4 to 15). Plasmids were weakly detected in four zona pellucida (lanes 4,13,14, and 15). Lane M is 1 kb DNA ladder. The 500 bp target fragment specific to the CAT gene is indicated by arrow. Photography a t bottom (B) show the migrating agarose gel of 23 PCR-amplified embryos
(without zonae pellucidae). Lanes 1 and 2 are a zero negative control, lanes 3 to 5 are nontreated embryos negative controls, lane 26 is a positive control (500 copies of plasmid), and lane M is a 1 kb DNA ladder. Bands of 500 bp in lanes 7,8,11,12, 14, 16, 18,19,21,22,23, and 25 revealed that plasmid DNA is still present in embryonic cells at the morula-blastocyst stage. Amplification of embryos produced with soaked sperms with plasmids, without electroporation are represented by lanes 6 to 10. Then proceeding from electroporated spermatozoa in TALP by lanes 11to 15, in mannitol-TALP by lanes 16 to 20 and in mannitol alone by lanes 21 to 15.
zoa following treatment by electrical field. We have observed that electroporated sperm cells retain DNA molecules more efficiently than spermatozoa not submitted to the electrical field, and we estimate that each electroporated sperm cell retains about 3,000 copies of plasmids, which is similar to the observations of Azerro (1989). Acrosome reaction was not increased for electroporated spermatozoa compared to the controls, but contrarily to human sperm cells (Tomkins et al., 19881, for which electroporation induces that in a rate of 70% AR at 1,000 V. Decrease of fertilization rate cannot be explained by a premature acrosome reaction in our experiment. The lower fertilization and developmental rate could be explained by the probable damages inflicted by the rapid warming of the solution since the solution (TALP) used for electroporation is an isoosmotic ionic solution, though mannitol solution, a conductive medium, seemed to have the same effects. The
mannitol solution was tried for its nonelectrolytic characteristic and because experiments with plant protoplasts, mammalian cells, and vesicles have shown no severe side effects on membrane integrity or on the viability of the cells at room temperature (Zimmerman and Vienken, 1982). Another hypothesis is the possible damage launched into nuclear structure or directly in DNA of spermatozoa. It is well known that fertilization and subsequent developmental rate may change between different sources of the semen (Leibfried-Rutledge et al., 1987; Pavlok et al., 1988). Consequently, it is possible that electroporation could have a selective pressure on our pool of spermatozoa from five bulls and than the more resistant sperm cells were not necessary the more efficient for development. Induction of cell membrane pore formation by an electrical current has been used to induce foreign DNA insertion into a variety of plant and animal cells (Chu et al., 1987). In
14
M.B. G A G N ~ET AL.
agreement with that, following DNase digestion, the present results showed that plasmids were partly incorporated into the plasma membrane. The method using calcium ionophore A23187 to remove the acrosome indicate that about 15%of plasmids were linked at this level, and in our experiment, at least 93% of sperm cells were acrosome reacted following ionophore treatment. Based on these results, it is not possible to conclude if plasmids were inside the plasma membrane or strongly bounded and embedded in it. We have also found that constructscarried by spermatozoa might be retained by zona pellucida during the penetration because four of 12 zonae pellucidae showed residual DNA following enzymatic amplification. This confirms the experiment of autoradiography where plasmids were seen in and on zona pellucida. The conventional method to evaluate transgenic animals is DNA extraction and Southern blot. This procedure requires more DNA than is contained in a bovine blastocyst and therefore requires the use of recipients and foetuses. Recently, PCR technique was used to evaluate the transgenic mice at the blastocyst level (Ninomya et al., 1989). We are well aware that blastocyst evaluation may lead to a false positive due to amplification of free copies as mentioned by Ninomiya et al. (1989) and Lo et al. (1989) and for parental diagnosis of diseases (West, 1989). After incorporation in oocytes, foreign DNA could stay free for several cell cycles and the episomal replication has been observed in the sea urchin or the chicken embryos (McMahon et al., 1985; Flytzanis et al., 1985; Sang and Perry, 1989). Nevertheless, the present experiment demonstrates that pRGH527 DNA was carried into oocytes by sperm cells and persist in denuded embryonic cells until the blastocyst stage. In summary, the electroporation of bovine sperm cells allow to carry foreign interested DNA in oocytes and could provide transgenic bovine embryos by a less traumatic process than microinjection. However, at this stage, it is still requisite to let embryos grow into recipient to analyze complete genomic DNA.
ACKNOWLEDGMENTS We gratefully acknowledge Dr. Sylvain Guerin for his technical help and for his generous gift of plasmids. We also thank Mrs. Josee Poulin for typing. This work was supported by the Conseil des Recherches en Production Animale du Quebec (2194) and National Science and Energy Council of Canada in collaboration with Semex Canada and Agriculture Canada. REFERENCES Andres AC, Schonenberger CA, Groner B, Hennighausen L, Lemeur M, Gerlinger P (1987): Haras oncogene expression directed by a milk protein gene promoter: tissue specificity, hormonal regulation and tumor induction in transgenic mice. Proc Natl Acad Sci USA 84:1299-1303. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1987): “Current Protocols in Molecular Biology.” New York: Greene Publishing, Wiley Interscience, pp 3.13.1-3.13.2. Azerro F (1989): Sea urchin sperm as a vector of foreign genetic information. Cells Biol Inter Rep 13:391404.
Bavister RD, Leibfried ML, Lieberman G (1983): Development of preimplantation embryos of the golden hamster in a defined culture medium. Biol Reprod 28:235-247. Bavister BD, Yanagimachi R (1977): The effect of sperm extract and energy source on the motility and acrosome reaction of hamster sperm in vitro. Biol Reprod 16:228-237. Ben-Av P, Rubinstein S, Breitbart H (1988): Induction of acrosomal reaction and calcium uptake in ram spermatozoa by ionophores. Biochemica et Biophysica Acta 939:214-222. Bennet PJ, Moatti J P , Mansat A, Ribbes H, Cayrac JC, Pantonnier F, Chap H, Douste-Blazy L (1987): Evidence for the activation of phospholipases during acrosome reaction of human sperm elicited by calcium ionophore A23187. Biochemica Biophysica Acta 919: 255-265. Biery KA, Bondioly KR, De Mayo FJ (1988): Gene transfer by pronuclear injection in the bovine. Theriogenology 29:224. Boland MP (1984):Use of the rabbit oviduct as a screening tool for the viability of mammalian eggs. Theriogenology 21:127-137. Brinster RL, Sandgren EP, Behringer RR, Palmiter RD (1989): No simple solution for making transgenic mice. Letters to the editor. Cell 59:239-241. Brinster RL, Chen HY, Trumbauer ME, Yagle MK, Palmiter RD (1985): Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci USA 82:44384442. Bryan JHD, Akruk SR (1977): A naphtol yellow S and erythrosin B staining procedure for use in studies in the acrosome reaction of rabbit spermatozoa. Stain Tech 52:47-51. Byrd W (1981): In vitro capacitation and the chemically induced acrosome reaction in bovine spermatozoa. J Exp Zoo 215:35&6. Chu G, Hayakawa H, Berg P (1987): Electroporation for the efficient transfection of mammalian cells with DNA. Nucleic Acids Res 3~1311-1326. Davis LG, Dibner MD, Battey JF (1986): “Basic Method in Molecular Biology.” New York: Elsevier Science Publishing Co., Inc., pp 72-74. Evans GA, Ingraham HA, Lewis K, Cunningham K, Seki T, Moriuchi T, Chang HC, Silver J, Hyman R (1984): Expression of the thy1-glycoproteingene by DNA-mediated gene transfer. Proc Natl Acad Sci USA 81:5532-5536. Eyestone WH, First NL (1989): Co-culture of early cattle embryos to the blastocyst stage with oviductal tissue or in conditioned medium. J Reprod Fertil 85:715-720. Flytzanis CN, McMahon AP, Hough-Evans BR, Katula KS, Britten RJ, Davidson EH (1985):Persistance and integration of cloned DNA in postembryonic sea urchins. Dev Biol 108:431-442. Gagn6 M, Pothier FP, Sirard MA (1990): Developmental potential of early bovine zygotes submitted to centrifugation and microinjection following in vitro maturation of oocytes. Theriogenology 34:417425. Hogan B, Costantini F, Lacy E (1986): “Manipulating the Mouse Embryo: A Laboratory Manual.” 1st edition. New York: Cold Spring Harbor Laboratory, pp 153-197. Knutson JC, Yee D (1987): Electroporation: Parameters affecting transfer of DNA into mammalian cells. Anal Biochem 164:44-52. Land RB, Wilmut I (1987): Gene transfer and animal breeding. Theriogenology 27:169-178. Lavitrano M, Camaioni A, Fazio VM, Dolci S, Farace MG, Spadafora C (1989): Sperm cells as vectors for introducing foreign DNA into eggs: Genetic transformation of mice. Cell 57:717-723. Leibfried L and First NL (1979): Characterization of bovine follicular oocytes and their ability to mature in vivo. J Anim Sci 48:76-86. Leibfried-Rutledge ML, Critser ES, Eyestone WH, Northey DL and First NL (1987):Developmental potential of bovine oocytes matured in vitro or in vivo. Biol Reprod 36:376-383. Leonard JM, Abramczuk JW, Pezen DS, Rutledge R, Belcher JH, Hakim F, Shearer G, Lamperth L, Travis W, Fredrickson T, Notkins AL, Martin MA (1988): Development of disease and virus recovery in transgenic mice containing HIV proviral DNA. Science 242: 1665-1670. Lo YMD, Mehal WZ, Fleming KA (1989): False positive results and the polymerase chain reaction. Lancet 1:679. Maddox J (1989): Transgenic routes runs into sand. Nature 341:686.
ELECTROPORATION OF BOVINE SPERMATOZOA McMahon AP, Flytzanis CN, Hough-Evans BR, Katula KS, Britten RJ, Davidson EH (1985):Introduction of cloned DNA into sea urchin egg cytoplasms replication and persistance during embryogenesis. Dev Biol 108:420430. Miller JF, Dower WJ, Thompkins LS (1988): High-voltage electroporation of bacteria: genetic transformation of campylobacter jejuni with plasmid DNA. Proc Natl Acad Sci USA 85:856-860. Neumann E, Schaefer-Rider M, Wang Y, Hofschneider PH (1982): Gene transfer into mouse lyoma cells by electroporation in high electric field. EMBO J 7:841-845. Ninomiya T, Hoshi M, Mizumo A, Magao M, Yuki A (1989): Selection of mouse preimplantation embryos carrying exogenous DNA by polymerase chain reaction. Mol Reprod Dev 1:242-248. Parrish J J , Susko-Parrish JL, First NL (1985): Effect of heparin and chondroitin sulfate on the acrosome reaction and fertility of bovine sperm in vitro. Theriogenology 24:537-549. Parrish JJ, Susko-Parrish J , Winer MA, First NL (1988):Capacitation of bovine sperm by heparin. Biol Reprod 38:1171-1180. Pavlok A, Torner H, Motlik J, Fulka J, Kauffold D, Duschinski U (1988): Fertilization of bovine oocytes in vitro: Effect of different sources of gametes on fertilization rate and frequency. Anim Reprod Sci 16:207-213. Rexroad Jr CE, Hammer RE, Dolt DJ, Mayo KE, Frohman LA, Palmiter RD, Brinster RL (1989): Production of transgenic sheep with growth regulating genes. Mol Reprod Dev 1:164-169. Roschlau K, Pommel D, Andreewa L, Zackel M, Roschlau D, Zackel B, Schwerin M, Huhn R, Gazarjan KG (1989): Gene transfer experiments in cattle. J Reprod Fertil 38 (Suppl):153-160. Saiki RK, Gelfand GH, Stoffel S, Scharf SJ, Higuehi R, Horn GT, Mullis KB, Erlish HA (1988): Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491.
15
Sang H, Perry MM (1989): Episomal replication of cloned DNA injected into the fertilized ovum of the hen, Gallus domesticus. Mol Reprod Dev 1:98-106. Sinn E, Muller W, Pattengale P, Tepler I, Wallace R, Leder P (1987): Coexpression of MMTVN Ha-Ras and MMTVlc-myc genes in transgenic mice: Synergistic action of oncogenes in vivo. Cell 49:465-475. Sirard MA, Leibfried-Rutledge L., Parrish J, Ware C, First NL (1988): The culture of bovine oocytes to obtain developmentally competant embryos. Bio Reprod 39:546-552. Sirard MA, Lambert RD, Menard DP, Bedoya M (1985): Pregnancies after in vitro fertilization of cow follicular oocytes, their incubation in rabbit oviduct and their transfer to the cow uterus. J Reprod Fertil 75551-556. Small JA, Scangos GA, Cork L, Jay G, Khoury G (1986): The early region of human papovavirus J C induces dysmyelination in transgenic mice. Cell 46:13-18. Thomkins PT, Houghton J A (1988): The rapid induction of the acrosome reaction of human spermatozoa by electropermabilization. Fert and Ster 50:329-336. Tripputi P, Guerin SL, Moore DD (1988): Two mechanisms for the extinction of gene expression in hybrid cells. Science 241:12051207. Wagner TE (1984): The possibility of transgenic livestock. Theriogenology 21:29-44. West J D (1989): The use of DNA probes in preimplantation and prenatal diagnosis. Mol Reprod Dev 1:138-145. Whittingham DG (1971): Survival of mouse embryos after freezing and thawing. Nature 233:125-126. Zimmerman U, Vienken J (1982): Electric field-induced cell-to-cell fusion. Memb Biol 67:165-182.
