ORIGINAL ARTICLE
Effect of NRG-1/ErbB Signaling Intervention on the Differentiation of Bone Marrow Stromal Cells Into Sinus Node–like Cells Yong Li, MD,* Bingong Li, PhD,* Changlie Zhang, MD,† Jian Zhang, MD,* Minghui Zeng, MD,* and Zeqi Zheng, MD*
Abstract: The neuregulin-1 (NRG-1)/ErbB signaling pathway is a crucial regulator of cardiac development and plays an important role in the formation of the cardiac special conduction system. To establish a rat bone marrow stromal cell (BMSC) cardiomyocyte (CM)-like differentiation model, BMSCs were treated with 5-azacytidine and fibroblast growth factor basic (FGF-basic) for 24 hours and then cocultured with neonatal rat CMs in a Transwell culture system. The feasibility of regulating the differentiation of BMSCs into sinoatrial node cells by manipulating the NRG-1/ErbB pathway was investigated. Three weeks after induction, reverse transcription-polymerase chain reaction analysis revealed that inhibition of NRG-1/ErbB signaling (using AG1478) greatly enhanced the expression of HCN4, Tbx3, and Tbx2. Additionally, Tbx3 protein levels were higher than in the control group and even produced distinct nodal-type action potentials. The expression of Nkx2.5 in the NRG-1 group (treated with exogenous NRG-1) was higher than the other 2 groups. The expression of phospho-Akt was also increased in the NRG-1 group but decreased in the AG1478 group. Together, these data demonstrate that inhibiting the endogenous NRG-1/ErbB signaling pathway when rat BMSCs differentiate into CMs can greatly enhance the pacemaker phenotype. Akt signaling may be one of the underlying molecular mechanisms responsible for these results. Key Words: bone marrow stromal cells, NRG-1, sinus node–like cells (J Cardiovasc Pharmacol 2014;63:434–440)
INTRODUCTION Biological pacemaker cell–based therapy is taking advantage of the multiple differentiation potential of stem cells. Therapies repairing or replacing damaged special conduction system are potentially valuable. Several research groups have reported that stem cell–derived cardiomyocyte (CM) populations included nodal- and working-type
myocytes (atrial and ventricular myocytes).1–3 Enriching the number of nodal cells would be helpful for the development of a biological pacemaker. Bone marrow stromal cells (BMSCs) are a particular type of somatic stem cells characterized by self-renewal and the ability to differentiate into various types of tissues4 and have been considered a new therapeutic tool in regenerative medicine. A number of studies indicate that treatment of BMSCs with 5-azacytidine (5-aza) can induce CMs to differentiate in vitro,3,5 providing a powerful model for heart tissue engineering research. At the same time, other studies have shown that cell-to-cell contact with neonatal CMs induces BMSCs to differentiate into CMs6,7 and the coculture of BMSCs with CMs after treatment with 5-aza enhances the possibility of CM differentiation.8 In recent years, researchers discovered a number of signaling molecules that participate in the development of the specialized cardiac conduction system. Neuregulin-1 (NRG-1), a member of the excitomotor tyrosine kinase receptor (ErbB) family, is an important signal-regulated protein in the cardiovascular system.9 Studies employing animal models have found that the NRG-1/ErbB signaling pathway is a crucial regulator of cardiac development and maintenance postnatal function10,11 and participates in the formation of the cardiac special conduction system.12 Targeting the NRG-1/ErbB pathway is a new approach for producing differentiated myocardial stem cells in vitro.12 Based on these previous studies, BMSCs were employed in this study, and a rat BMSC CM-like differentiation model was established. The feasibility of regulating the differentiation of BMSCs into sinoatrial node cells through the manipulation of the NRG-1/ErbB pathways was explored.
MATERIALS AND METHODS Isolation and Culture of BMSCs
Received for publication July 15, 2013; accepted December 13, 2013. From the *Department of Cardiology, First Affiliated Hospital, Nanchang University, Nanchang, China; and †Department of Vascular Surgery, Linyi People’s Hospital, Shandong, China. Supported by National Natural Science Foundation of China (30860101, 81041097) and Natural Science Foundation of Jiangxi Province (2008GZY0045). The authors report no conflicts of interest. Reprints: Bingong Li, PhD, Department of Cardiology, First Affiliated Hospital, Nanchang University, 17 Yongwaizheng St, Nanchang 330006, China (e-mail: [email protected]). Copyright © 2013 by Lippincott Williams & Wilkins
All procedures were approved by the Nanchang University Ethical Committee on Animal Care. BMSCs were obtained from 4-week-old Sprague Dawley rats as previously described.13 Rats were anesthetized with 4% chloral hydrate solution (1 mL/100 g) by intraperitoneal injection. The tibia and femur were separated under sterile conditions, and the bone marrow was collected by flushing with serum-free Dulbecco modified Eagle medium (Gibco, Boston, MA) containing 10% fetal bovine serum (Hyclone, South America). The cells were plated at a density of 3 · 106 cells per square
434
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
| www.jcvp.org
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
centimeter. The medium was replaced every 2–3 days, with the nonadherent cells discarded.
Flow Cytometry The 3 generations of adherent cells were digested with 0.25% trypsin and washed 3 times with phosphate-buffered saline (PBS) and a cell suspension with a density of 1 · 1010 cells per liter. Cells were incubated at 48C for 30 minutes with the relevant test antibodies (CD29, CD45, CD90, and CD45) (Biolegend, San Diego, CA). Labeled BMSCs were then analyzed with a flow cytometer, using unstained cells as the control.
Myogenic Differentiation of BMSCs First, BMSCs were seeded in the lower compartment of a Transwell culture system (Corning) at a density of 5 · 104 cells per well, with the insert membrane with 0.4 mm pore size. Twenty-four hours after seeding, 10 mM 5-aza (Sigma, Saint Louis, MO) and 10 mg/L fibroblast growth factor basic (FGFbasic) (Recombinant Rat FGF-basic; PeproTech, Princeton) were added to the medium and incubated for an additional 24 hours. Subsequently, the cells were washed 3 times with PBS, and a total of 2.5 · 105 neonatal rat CMs were plated in the upper compartment of the Transwell culture system. Primary neonatal rat CMs were isolated from 2-day-old newborn rats as described previously.14 The expression of cardiac early transcription factors and proteins was analyzed by reverse transcription-polymerase chain reaction (RT-PCR) and immunofluorescence.
RNA Extraction and Semiquantitative RT-PCR Analysis Cardiac early transcription factor Nkx2.5 was analyzed by RT-PCR at different stages of 10, 14, 21, and 24 days during in vitro differentiation. Total RNA was extracted from induced cells using TRIzol Reagent (Invitrogen, Grand Island) according to the manufacturer’s instructions. Complementary (cDNA) was synthesized in a 20-mL reaction volume using the RevertAid First Strand cDNA Synthesis Kit (Fermentas, Burlington, Canada), and the PCR was performed with Taq DNA Polymerase (TransGen Biotech, Beijing, China) according to the manufacturer’s protocol. The PCR products were separated by electrophoresis in 1.5% agarose gels. Expression was normalized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. The primers employed in this study are given in Table 1.
NRG-1/ErbB Signaling on the Differentiation of BMSCs
Immunofluorescence Analysis Immunocytochemical analyses were carried out as previously described.13 Induced BMSCs were plated on 1% gelatin-coated culture plates. After 24 hours of culture, single cell was fixed with 4% paraformaldehyde for 20 minutes at 208C and then cells were permeabilized in 0.1% Tween-20 for 10 minutes. After cells were blocked in 1% bovine serum albumin for 30 minutes at 378C, an anti-rat antibody against cardiac troponin-I (Abcam, Cambridge, England) was incubated overnight at 48C, followed by incubation with the relevant tetramethylrhodamineisothiocyanate-conjugated secondary antibody at 378C for 60 minutes. 40 ,6-diamidino-2phenylindole (DAPI) was used to stain nuclei.
Targeting the NRG-1/ErbB Pathway to Examine Its Role in CMs To establish a rat BMSC CM-like differentiation model, BMSCs (in the lower compartment of the Transwell culture system) were induced by 5-aza and bFGF for 24 hours and then cocultured with neonatal rat CMs (indirect contact, in the upper compartment of the Transwell culture system) on Transwell plates. On days 5, 8, and 11, BMSCs in the lower compartment were treated with 10 mmol/L of AG1478 (Sigma), an ErbB receptor antagonist, 100 mg/L of NRG-1 (PeproTech), or Dulbecco modified Eagle medium, respectively. On the day of treatment, cells were incubated with the drug for only 12 hours. During the 12-hour treatment, the upper compartment of the Transwell with neonatal rat CMs was set apart to avoid the effect of the drugs on CMs. After the 12-hour treatment, the upper compartment with new CMs was placed back. The cells without the treatment of drugs were used as control. On day 21, the messenger RNA levels of NKx2.5, HCN4, Tbx3, and Tbx2 were detected by quantitative RT (qRT)-PCR, whereas the protein levels of TBX3, Akt, and phospho-Akt (p-Akt) were detected by western blotting. BMSCs without coculture with CMs were employed as a blank control.
Real-Time qRT-PCR Analysis Total RNA was isolated from induced BMSCs in which the NRG-1/ErbB pathway was manipulated and induced for 3 weeks. The qRT-PCR was performed with a 7500 Real-Time PCR System (Applied Biosystems, Carlsbad, CA), using Allin-one qPCR Mix (Gene Copoeia, Rockville). The reaction
TABLE 1. Primer Sets Used for qRT-PCR Analysis Gene Tbx2 Tbx3 Nkx2.5 HCN4 GAPDH
Primer Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
2013 Lippincott Williams & Wilkins
AGCCCGTGGCCTTCCACAAA TGGAAGCGCGGCTGGTACTT GTCTCCTTCTTG GCCTCTCATC CATCGCCGTGACTGCCTATC ACCGCCCCTACATTTTATCC GACAGGTACCGCTGTGCTT CTAAGGGCAACAAGGAGACCA CAGTGAGTAGAGGCGGCAGTAAG GCAAGTTCAACGGCACAG GCCAGTAGACTCCACGACAT
Product Size
Annealing Point
100
62
165
60
230
63
122
63
140
60
www.jcvp.org |
435
Li et al
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
volume was 20 mL and contained 2 mL of cDNA. Relative messenger RNA expression was calculated using the comparative threshold cycle number of each sample. Expression was normalized by GAPDH expression. The primers employed in this study are given in Table 1.
in current-clamp mode by an Axopatch 200B patch-clamp amplifier (Molecular Devices Corporation, Sunnyvale). pClamp 9.0 software was used to regulate APs elicited and for data acquisition, whereas AP duration at 50%, 90% repolarization (APD50/APD90), and AP amplitude (APA) were measured by Campfit 9.0.
Western Blot Analysis Induced BMSCs were collected on week 3 after induction and washed 3 times with ice-cold PBS. Cells were lysed with extraction buffer (Lysis Buffer:Protease Inhibitor Mix = 500:1; Vazyme Biotech Co, Nanjing, China) on ice, and 50 mg of each protein sample was analyzed by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis under reducing conditions. The separated proteins were transferred to a nitrocellulose membrane (Millipore, Billerica) and blocked with 5% bovine serum albumin. The antibodies used included anti-TBX3 (diluted 1:500; Boisynthesis Biotechnology, Beijing, China), anti-p-Akt (diluted 1:100; Cell Signaling Technology), anti-Akt (diluted 1:250; Cell Signaling Technology), and anti-b-actin (diluted 1:1000; ZGGB-BIO, Beijing, China), which were incubated overnight at 48C and then incubated with corresponding horseradish peroxidase–conjugated secondary antibodies (goat anti-rabbit; ZGGB-BIO). The blots were visualized using the enhanced chemiluminescence method (Thermo) with a chemiluminescence imaging system (GE).
Statistical Analyses
Experimental data were expressed as mean 6 SD. Comparisons between groups were made by 1-way analysis of variance with Fisher protected least significant difference post hoc comparison. Results were considered statistically significant if P , 0.05.
RESULTS Morphology and Identification of BMSCs After 4–6 hours in primary culture, BMSCs began to adhere on the plastic surface, initially appearing as a small dot and later becoming spindle shaped. After 5–7 days of culture, cells covered approximately 80%–85% of the surface. Flow cytometric analysis of BMSC surface antigens demonstrated that more than 95% of the cells were positive for stem cell surface markers CD29, CD90, and CD105, whereas the hematopoietic lineage marker CD45 was absent (Fig. 1).
Action Potential Recording
Myogenic Differentiation
Action potentials (APs) were recorded at 378C from single cells 3 weeks after induction. The APs were recorded
After exposure to 5-aza and FGF-basic, some adherent cells died, their shape underwent significant changes, and
FIGURE 1. Detection of cell surface antigens of BMSCs using flow cytometry found that BMSCs highly expressed mesenchymal cell surface markers CD29, CD90, and CD105 and negatively expressed the hematopoietic cell surface of CD45.
436
| www.jcvp.org
2013 Lippincott Williams & Wilkins
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
NRG-1/ErbB Signaling on the Differentiation of BMSCs
expression of p-Akt was increased in the NRG-1 group while decreased in the AG1478 group (Fig. 5).
Detection of AP
FIGURE 2. RT-PCR analysis of the expression of NKx2.5 in BMSCs induced cells. Diagrams of the quantifications of NKx2.5 expression in 5-aza–treated cells.
growth became slower. After indirect contact coculture with neonatal rat CMs in a Transwell system, the cells became larger and assumed ball-like or stick-like morphologies. In some cases, the formation of new branches was observed. RT-PCR was employed to detect the expression of CM marker NKx2.5. No expression of NKx2.5 was detected in the BMSCs, whereas NKx2.5 was detected in the induced BMSCs at day 10, with expression increasing over time, and the expression of NKx2.5 was peaked at day 21 (Fig. 2). Immunofluorescence analysis revealed that 30%–40% of the induced BMSCs stained positive for CTnI after differentiating for 3 weeks, whereas none of the BMSCs displayed positive expression (Fig. 3).
Effect of NRG-1/ErbB Pathway on Differentiation of CMs From BMSCs Three weeks after induction, qRT-PCR analysis revealed that the differentiated BMSCs expressed cardiac early transcription factor Nkx2.5 after being treated with 5-aza and cocultured with neonatal rat CMs. As expected, expression was negative in the blank control group. The inhibition of NRG-1/ErbB signaling (used AG1478) greatly enhanced the gene expression of HCN4, Tbx3, and Tbx2 as compared with the control and NRG-1 groups (P , 0.05). The expression of Nkx2.5 in the NRG-1 group was higher than that of the other 2 groups (P , 0.05) (Fig. 4). Western blot analysis of the protein expression of Tbx3 and p-Akt revealed that Tbx3 levels were higher in the AG1478 group than the control group (P , 0.05) and the
Three weeks after induction, in whole-cell currentclamp mode, we could detect typical cardiac-type APs with sinus-like APs (Fig. 6A) or ventricular muscle–like APs (Fig. 6B) in the AG1478, NRG-1, and control groups, whereas none was observed in the BMSC group. Sinus-like APA was 68 6 4 mV, APD50/APD90 was 117 6 9.5/188 6 13.3 ms, ventricular muscle–like APA was 108 6 5 mV, and APD50/APD90 was 163.7 6 19/281 6 27 ms.
DISCUSSION Marrow stromal cells (MSCs) are a population of selfrenewing and multipotent cells, according to the minimum standards provided by the International Society for Cellular Therapy. MSCs isolated from various origins should meet the following 3 criteria15: (1) isolated MSCs should adhere to plastic when maintained in standard culture conditions, (2) display specific markers of mesenchymal stem cells, which includes more than 95% of the cells expressing the surface markers CD73, CD90, and CD105 and less than 2% of cells expressing the surface antigens CD14, CD34, and CD45, and (3) have the potential to differentiate into various types of tissue cells in vitro. In this study, MSCs were obtained from rat bone marrow and meet these requirements. Compared with other stem cells, it has obvious advantages in autologous transplantation as rich contents and easy and wide availability. At present, no uniform effective genetic markers of early sinus node cells are known.12 A large body of evidence indicates that early working-type CMs are characterized by higher expression of transcription factor NKx2.5, ANF, and high-conductance gap junction proteins (cx-40 and cx-43) than sinoatrial node cells.16,17 The early sinus node cell expression markers include elevated levels of the transcription factors Tbx2 and Tbx3, the pacing gene HCN4, and lowconductance gap junction proteins (cx-45)18,19; further, they also have lower proliferative activity and greater automaticity than working-type CMs.18,19 In our study, BMSCs expressed cardiac early transcription factor Nkx2.5 and troponin-I after treatment with 5-aza and coculture with neonatal rat CMs in
FIGURE 3. Immunofluorescence analysis of the expression of CTnI in BMSCs induced cells. A, BMSCs expressed the cardiac marker CTnI (red) and DAPI for nucleolus (blue) visualization after treating with 5-aza for 24 hours and coculture with CMs for 3 weeks. B, BMSCs did not express CTnI. 2013 Lippincott Williams & Wilkins
www.jcvp.org |
437
Li et al
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
FIGURE 4. qRT-PCR analysis of the expression of pacemaker-related genes after intervening NRG-1/ ErbB signaling pathway in certain period when rat BMSCs differentiate into CMs. BMSCs expressed Nkx2.5 after induction for 3 weeks, whereas it was negative in blank control group (*P , 0.05 vs. BMSC group). The relative messenger RNA expression of Tbx3, Tbx2, and HCN4 in AG1478 group was significantly higher than control group and NRG-1 group (#P , 0.05 vs. control group; DP , 0.05 vs. AG1478 group), whereas the relative expression of Nkx2.5 in NRG-1 group was higher than the other 2 groups (#P , 0.05 vs. control group; DP , 0.05 vs. AG1478 group).
a Transwell culture system for 3 weeks. The inhibition of NRG-1/ErbB signaling at certain periods of BMSC differentiation into CMs greatly enhanced some markers associated with differentiating CM sinus node precursors (HCN4, Tbx3, Tbx2). Furthermore, distinct nodal-type APs could be detected. Together, these data suggest that targeting the NRG1/ErbB signaling may induce cardiomyogenic differentiation of BMSCs to a nodal phenotype. On the other hand, the expression of Nkx2.5 in NRG-1 group cells was higher than the other 2 groups. Tbx3 is a transcriptional repressor required for the development of the mammalian heart. This factor plays an important role during heart embryogenesis, especially in the development and maturation of the early cardiac sinus node cells.20,21 Some researchers reported that in the early developing heart, Tbx2 and Tbx3 repress the expression of cardiac work-related genes and impose the pacemaker phenotype, promoting the differentiation and maturation of the sinoatrial node cells.20,22 Usually, Tbx3 and HCN4 are regarded as markers of pacemaker tissue in the heart,18,23 whereas the expression of NKx2.5 is detrimental for the development of nodal cells for a certain period during early heart development,24 as this can suppress the expression of nodal phenotypes, such as Tbx3 and HCN4 expression, and lead to cardiac abnormalities, including hypoplastic sinus node.25
NRG-1 operates as a signaling transduction protein between cells,9 and its biological function is mediated by binding the tyrosine kinase receptor to activate multiple signal transduction pathways, including phosphatidylinositol-3kinase (PI3K)/Akt and mitogen-activated protein kinase/ extracellular signal-regulated kinase (MAPK-ERK) signaling pathways. PI3K/Akt signaling is regarded as the central regulator of the NRG/ErbB signaling network and is involved in mediating survival signals in a variety of cells.26 Previous studies demonstrated that NRG-1/ErbB signaling plays indispensable roles in cardiac and neuronal development by regulating the proliferation and differentiation of multiple cell types, including epithelial cells, neurons, and CMs.27 Recently, multiple biological functions of the NRG-1/ErbB signaling pathway in the developing and mature hearts have been discovered. Multiple laboratories have reported that NRG-1 acts as a protective growth factor,28 injecting exogenous NRG-1 in adult rat models of systolic heart failure,29 ischemic, dilated, and viral cardiomyopathies,30 diabetic cardiomyopathy,31 and myocardial infarction.32 Furthermore, investigations of the function of NRG-1 indicate that it inhibits cardiac apoptosis and fibrosis, improving ventricular function. The maturation of the heart is a very complicated and highly regulated process involving a variety of signaling pathways. Recent studies have determined that the NRG-1/ ErbB signaling pathway is indispensable in early myocardial
FIGURE 5. Western blot analysis of the expression of Akt, p-Akt, and Tbx3 in each group after differentiation for 3 weeks. A, The original gels of Akt, p-Akt, and Tbx3. B, The mean density of Akt, p-Akt, and Tbx3 in control group was defined as 100%, *P , 0.05 versus BMSC group, #P , 0.05 versus control group, DP , 0.05 versus AG1478 group.
438
| www.jcvp.org
2013 Lippincott Williams & Wilkins
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
FIGURE 6. Interference with NRG-1/ErbB signaling regulated the ratio of nodal- versus working-type cells in differentiating BMSC-derived CM cultures. A, BMSCs derived cells exhibit distinct nodal-type (a) and working-type (b) APs. B, Histogram plots indicating the percentage of BMSCs derived cells exhibiting either the working (black) or the nodal (white) AP phenotype in control group (n = 13 cells), NRG-1 group (n = 16 cells), and AG1478 group (n = 14 cells). Note that inhibiting endogenous NRG-1/ErbB signaling enhanced the proportion of pacemaker phenotype.
cell differentiation and maturation. However, how NRG-1 signaling affects heart morphogenesis and gene expression is not entirely clear at present. The first evidence of the NRG-1/ ErbB signaling pathway participating in the development of the heart was revealed investigating NRG-12/2 null mice. Meyer27 reported that NRG-12/2 mice die during embryogenesis (10.5 days) because of the absence of normal trabeculation of the ventricles. Furthermore, Lai33 used NRG-1 and ErbB4 mutant mice to demonstrate that NRG-1 is essential for ventricular morphogenesis but is not a required factor in the initial stages of chamber specification, with the expression of Tbx2 found to be normal in NRG-1 mutant mice. These data indicate that NRG-1 is a critical regulator in the maturation of the ventricular node, but not the sinus node. Current research indicates that NRG-1 induces CM cell cycle activity, promotes myocardial regeneration,34 and induces CM differentiation of embryonic stem cells at an early stage of development.35 In our study, we also observed that exogenous NRG-1 could promote the expression of Nkx2.5, which may contribute to promoting the working-type phenotype, whereas inhibiting endogenous NRG-1/ErbB signaling enhanced the pacemaker phenotype. However, the downstream molecular mechanism is poorly understood. In this study, Western blot analysis revealed that the levels of p-Akt were significantly increased in the NRG-1–treated group and decreased in the AG1478-treated group. Akt, 2013 Lippincott Williams & Wilkins
NRG-1/ErbB Signaling on the Differentiation of BMSCs
a downstream effector of the PI3K signaling cascade, is phosphorylated and activated by PI3K and plays a pivotal role in cell proliferation and differentiation.36 Relevant to this study, others have recently speculated that the molecular mechanisms underlying induction of CM proliferation by NRG-1 may involve the activation of PI3K/Akt signaling.34,35 Interestingly, a recent study employed animal models to demonstrate that automatic rhythmicity in PI3K2/2 mice was greater than PI3K+/+ mice.37,38 Thus, we speculate that PI3K/Akt signaling may be a target of NRG-1, regulating cardiac subtype specification in differentiating rat BMSCs. In summary, this study showed that the expression of pacemaker-related genes and proteins could be greatly enhanced by intervening endogenous NRG-1/ErbB pathway in certain period when rat BMSCs differentiated into CMs. The mechanisms underlying this function may be closely related with the intervention of the PI3K/Akt signaling system. This provides a good model for the development of biological pacemaker. However, because of our limited conditions, no spontaneous beating cells were observed in this study. This may be because of the low differentiation efficiency of induction or limit of induction time. The mechanism and the optimal conditions for inducing differentiation require further investigation. REFERENCES 1. He JQ, Ma Y, Lee Y, et al Human embryonic stem cells develop into multiple types of cardiac myocytes: action potential characterization. Circ Res. 2003;93:32–39. 2. Moore JC, Fu J, Chan YC, et al. Distinct cardiogenic preferences of two human embryonic stem cell (hESC) lines are imprinted in their proteomes in the pluripotent state. Biochem Biophys Res Commun. 2008; 372:553–558. 3. Makino S, Fukuda K, Miyoshi S, et al. Cardiomyocytes can be generated from marrow stromal cells in vitro. J Clin Invest. 1999;103:697–705. 4. Pittenger MF, Mackay AM, Beck SC, et al. Multilineage potential of adult human mesenchymal stem cells. Science. 1999;284:143–147. 5. Meligy FY, Shigemura K, Behnsawy HM, et al. The efficiency of in vitro isolation and myogenic differentiation of MSCs derived from adipose connective tissue, bone marrow, and skeletal muscle tissue. In Vitro Cell Dev Biol Anim. 2012;48:203–215. 6. Yoon J, Shim WJ, Ro YM, et al. Transdifferentiation of mesenchymal stem cells into cardiomyocytes by direct cell-to-cell contact with neonatal cardiomyocyte but not adult cardiomyocytes. Ann Hematol. 2005;84: 715–721. 7. Wang T, Xu Z, Jiang W, et al. Cell-to-cell contact induces mesenchymal stem cell to differentiate into cardiomyocyte and smooth muscle cell. Int J Cardiol. 2006;109:74–81. 8. Garbade J, Schubert A, Rastan AJ, et al. Fusion of bone marrow-derived stem cells with cardiomyocytes in a heterologous in vitro model. Eur J Cardiothorac Surg. 2005;28:685–691. 9. Pentassuglia L, Sawyer DB. The role of Neuregulin-1beta/ErbB signaling in the heart. Exp Cell Res. 2009;315:627–637. 10. Odiete O, Hill MF, Sawyer DB. Neuregulin in cardiovascular development and disease. Circ Res. 2012;111:1376–1385. 11. Lemmens K, Doggen K, De Keulenaer GW. Role of neuregulin-1/ErbB signaling in cardiovascular physiology and disease: implications for therapy of heart failure. Circulation. 2007;116:954–960. 12. Zhu WZ, Xie Y, Moyes KW, et al. Neuregulin/ErbB signaling regulates cardiac subtype specification in differentiating human embryonic stem cells. Circ Res. 2010;107:776–786. 13. Zhang J, Chatterjee K, Alano CC, et al. Vincristine attenuates N-methylN’-nitro-N- nitrosoguanidine-induced poly-(ADP) ribose polymerase activity in cardiomyocytes. J Cardiovasc Pharmacol. 2010;55:219–226. 14. Sayed D, Rane S, Lypowy J, et al. MicroRNA-21 targets Sprouty2 and promotes cellular outgrowths. Mol Biol Cell. 2008;19:3272–3282.
www.jcvp.org |
439
Li et al
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
15. Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8:315–317. 16. Christoffels VM, Burch JB, Moorman AF. Architectural plan for the heart: early patterning and delineation of the chambers and the nodes. Trends Cardiovasc Med. 2004;14:301–307. 17. Evans SM, Yelon D, Conlon FL, et al. Myocardial lineage development. Circ Res. 2010;107:1428–1444. 18. Wiese C, Grieskamp T, Airik R, et al. Formation of the sinus node head and differentiation of sinus node myocardium are independently regulated by Tbx18 and Tbx3. Circ Res. 2009;104:388–397. 19. Jensen B, Boukens BJ, Postma AV, et al. Identifying the evolutionary building blocks of the cardiac conduction system. PLoS One. 2012;7: e44231. 20. Hoogaars WM, Engel A, Brons JF, et al. Tbx3 controls the sinoatrial node gene program and imposes pacemaker function on the atria. Genes Dev. 2007;21:1098–1112. 21. McNally EM, Svensson EC. Setting the pace: Tbx3 and Tbx18 in cardiac conduction system development. Circ Res. 2009;104:285–287. 22. Singh R, Hoogaars WM, Barnett P, et al. Tbx2 and Tbx3 induce atrioventricular myocardial development and endocardial cushion formation. Cell Mol Life Sci. 2012;69:1377–1389. 23. DiFrancesco D. The role of the funny current in pacemaker activity. Circ Res. 2010;106:434–446. 24. Mommersteeg MT, Hoogaars WM, Prall OW, et al. Molecular pathway for the localized formation of the sinoatrial node. Circ Res. 2007;100: 354–362. 25. Espinoza-Lewis RA, Liu H, Sun C, et al. Ectopic expression of Nkx2.5 suppresses the formation of the sinoatrial node in mice. Dev Biol. 2011; 356:359–369. 26. Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network. Nat Rev Mol Cell Biol. 2001;2:127–137. 27. Meyer D, Birchmeier C. Multiple essential functions of neuregulin in development. Nature. 1995;378:386–390.
28. Hedhli N, Huang Q, Kalinowski A, et al. Endothelium-derived neuregulin protects the heart against ischemic injury. Circulation. 2011;123: 2254–2262. 29. Wang XH, Zhuo XZ, Ni YJ, et al. Improvement of cardiac function and reversal of gap junction remodeling by Neuregulin-1beta in volume-overloaded rats with heart failure. J Geriatr Cardiol. 2012; 9:172–179. 30. Liu X, Gu X, Li Z, et al. Neuregulin-1/ErbB-activation improves cardiac function and survival in models of ischemic, dilated, and viral cardiomyopathy. J Am Coll Cardiol. 2006;48:1438–1447. 31. Li B, Zheng Z, Wei Y, et al. Therapeutic effects of neuregulin-1 in diabetic cardiomyopathy rats. Cardiovasc Diabetol. 2011;10:69. 32. Xiao J, Li B, Zheng Z, et al. Therapeutic effects of neuregulin-1 gene transduction in rats with myocardial infarction. Coron Artery Dis. 2012; 23:460–468. 33. Lai D, Liu X, Forrai A, et al. Neuregulin 1 sustains the gene regulatory network in both trabecular and nontrabecular myocardium. Circ Res. 2010;107:715–727. 34. Bersell K, Arab S, Haring B, et al. Neuregulin1/ErbB4 signaling induces cardiomyocyte proliferation and repair of heart injury. Cell. 2009;138: 257–270. 35. Wang Z, Xu G, Wu Y, et al. Neuregulin-1 enhances differentiation of cardiomyocytes from embryonic stem cells. Med Biol Eng Comput. 2009;47:41–48. 36. Qiu FY, Song XX, Zheng H, et al. Thymosin beta4 induces endothelial progenitor cell migration via PI3K/Akt/eNOS signal transduction pathway. J of Cardiovasc Pharmacol. 2009;53:209–214. 37. Rose RA, Kabir MG, Backx PH. Altered heart rate and sinoatrial node function in mice lacking the cAMP regulator phosphoinositide 3-kinasegamma. Circ Res. 2007;101:1274–1282. 38. Alloatti G, Marcantoni A, Levi R, et al. Phosphoinositide 3-kinase gamma controls autonomic regulation of the mouse heart through Gi-independent downregulation of cAMP level. FEBS Lett. 2005;579: 133–140.
440
| www.jcvp.org
2013 Lippincott Williams & Wilkins
Effect of NRG-1/ErbB Signaling Intervention on the Differentiation of Bone Marrow Stromal Cells Into Sinus Node–like Cells Yong Li, MD,* Bingong Li, PhD,* Changlie Zhang, MD,† Jian Zhang, MD,* Minghui Zeng, MD,* and Zeqi Zheng, MD*
Abstract: The neuregulin-1 (NRG-1)/ErbB signaling pathway is a crucial regulator of cardiac development and plays an important role in the formation of the cardiac special conduction system. To establish a rat bone marrow stromal cell (BMSC) cardiomyocyte (CM)-like differentiation model, BMSCs were treated with 5-azacytidine and fibroblast growth factor basic (FGF-basic) for 24 hours and then cocultured with neonatal rat CMs in a Transwell culture system. The feasibility of regulating the differentiation of BMSCs into sinoatrial node cells by manipulating the NRG-1/ErbB pathway was investigated. Three weeks after induction, reverse transcription-polymerase chain reaction analysis revealed that inhibition of NRG-1/ErbB signaling (using AG1478) greatly enhanced the expression of HCN4, Tbx3, and Tbx2. Additionally, Tbx3 protein levels were higher than in the control group and even produced distinct nodal-type action potentials. The expression of Nkx2.5 in the NRG-1 group (treated with exogenous NRG-1) was higher than the other 2 groups. The expression of phospho-Akt was also increased in the NRG-1 group but decreased in the AG1478 group. Together, these data demonstrate that inhibiting the endogenous NRG-1/ErbB signaling pathway when rat BMSCs differentiate into CMs can greatly enhance the pacemaker phenotype. Akt signaling may be one of the underlying molecular mechanisms responsible for these results. Key Words: bone marrow stromal cells, NRG-1, sinus node–like cells (J Cardiovasc Pharmacol 2014;63:434–440)
INTRODUCTION Biological pacemaker cell–based therapy is taking advantage of the multiple differentiation potential of stem cells. Therapies repairing or replacing damaged special conduction system are potentially valuable. Several research groups have reported that stem cell–derived cardiomyocyte (CM) populations included nodal- and working-type
myocytes (atrial and ventricular myocytes).1–3 Enriching the number of nodal cells would be helpful for the development of a biological pacemaker. Bone marrow stromal cells (BMSCs) are a particular type of somatic stem cells characterized by self-renewal and the ability to differentiate into various types of tissues4 and have been considered a new therapeutic tool in regenerative medicine. A number of studies indicate that treatment of BMSCs with 5-azacytidine (5-aza) can induce CMs to differentiate in vitro,3,5 providing a powerful model for heart tissue engineering research. At the same time, other studies have shown that cell-to-cell contact with neonatal CMs induces BMSCs to differentiate into CMs6,7 and the coculture of BMSCs with CMs after treatment with 5-aza enhances the possibility of CM differentiation.8 In recent years, researchers discovered a number of signaling molecules that participate in the development of the specialized cardiac conduction system. Neuregulin-1 (NRG-1), a member of the excitomotor tyrosine kinase receptor (ErbB) family, is an important signal-regulated protein in the cardiovascular system.9 Studies employing animal models have found that the NRG-1/ErbB signaling pathway is a crucial regulator of cardiac development and maintenance postnatal function10,11 and participates in the formation of the cardiac special conduction system.12 Targeting the NRG-1/ErbB pathway is a new approach for producing differentiated myocardial stem cells in vitro.12 Based on these previous studies, BMSCs were employed in this study, and a rat BMSC CM-like differentiation model was established. The feasibility of regulating the differentiation of BMSCs into sinoatrial node cells through the manipulation of the NRG-1/ErbB pathways was explored.
MATERIALS AND METHODS Isolation and Culture of BMSCs
Received for publication July 15, 2013; accepted December 13, 2013. From the *Department of Cardiology, First Affiliated Hospital, Nanchang University, Nanchang, China; and †Department of Vascular Surgery, Linyi People’s Hospital, Shandong, China. Supported by National Natural Science Foundation of China (30860101, 81041097) and Natural Science Foundation of Jiangxi Province (2008GZY0045). The authors report no conflicts of interest. Reprints: Bingong Li, PhD, Department of Cardiology, First Affiliated Hospital, Nanchang University, 17 Yongwaizheng St, Nanchang 330006, China (e-mail: [email protected]). Copyright © 2013 by Lippincott Williams & Wilkins
All procedures were approved by the Nanchang University Ethical Committee on Animal Care. BMSCs were obtained from 4-week-old Sprague Dawley rats as previously described.13 Rats were anesthetized with 4% chloral hydrate solution (1 mL/100 g) by intraperitoneal injection. The tibia and femur were separated under sterile conditions, and the bone marrow was collected by flushing with serum-free Dulbecco modified Eagle medium (Gibco, Boston, MA) containing 10% fetal bovine serum (Hyclone, South America). The cells were plated at a density of 3 · 106 cells per square
434
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
| www.jcvp.org
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
centimeter. The medium was replaced every 2–3 days, with the nonadherent cells discarded.
Flow Cytometry The 3 generations of adherent cells were digested with 0.25% trypsin and washed 3 times with phosphate-buffered saline (PBS) and a cell suspension with a density of 1 · 1010 cells per liter. Cells were incubated at 48C for 30 minutes with the relevant test antibodies (CD29, CD45, CD90, and CD45) (Biolegend, San Diego, CA). Labeled BMSCs were then analyzed with a flow cytometer, using unstained cells as the control.
Myogenic Differentiation of BMSCs First, BMSCs were seeded in the lower compartment of a Transwell culture system (Corning) at a density of 5 · 104 cells per well, with the insert membrane with 0.4 mm pore size. Twenty-four hours after seeding, 10 mM 5-aza (Sigma, Saint Louis, MO) and 10 mg/L fibroblast growth factor basic (FGFbasic) (Recombinant Rat FGF-basic; PeproTech, Princeton) were added to the medium and incubated for an additional 24 hours. Subsequently, the cells were washed 3 times with PBS, and a total of 2.5 · 105 neonatal rat CMs were plated in the upper compartment of the Transwell culture system. Primary neonatal rat CMs were isolated from 2-day-old newborn rats as described previously.14 The expression of cardiac early transcription factors and proteins was analyzed by reverse transcription-polymerase chain reaction (RT-PCR) and immunofluorescence.
RNA Extraction and Semiquantitative RT-PCR Analysis Cardiac early transcription factor Nkx2.5 was analyzed by RT-PCR at different stages of 10, 14, 21, and 24 days during in vitro differentiation. Total RNA was extracted from induced cells using TRIzol Reagent (Invitrogen, Grand Island) according to the manufacturer’s instructions. Complementary (cDNA) was synthesized in a 20-mL reaction volume using the RevertAid First Strand cDNA Synthesis Kit (Fermentas, Burlington, Canada), and the PCR was performed with Taq DNA Polymerase (TransGen Biotech, Beijing, China) according to the manufacturer’s protocol. The PCR products were separated by electrophoresis in 1.5% agarose gels. Expression was normalized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. The primers employed in this study are given in Table 1.
NRG-1/ErbB Signaling on the Differentiation of BMSCs
Immunofluorescence Analysis Immunocytochemical analyses were carried out as previously described.13 Induced BMSCs were plated on 1% gelatin-coated culture plates. After 24 hours of culture, single cell was fixed with 4% paraformaldehyde for 20 minutes at 208C and then cells were permeabilized in 0.1% Tween-20 for 10 minutes. After cells were blocked in 1% bovine serum albumin for 30 minutes at 378C, an anti-rat antibody against cardiac troponin-I (Abcam, Cambridge, England) was incubated overnight at 48C, followed by incubation with the relevant tetramethylrhodamineisothiocyanate-conjugated secondary antibody at 378C for 60 minutes. 40 ,6-diamidino-2phenylindole (DAPI) was used to stain nuclei.
Targeting the NRG-1/ErbB Pathway to Examine Its Role in CMs To establish a rat BMSC CM-like differentiation model, BMSCs (in the lower compartment of the Transwell culture system) were induced by 5-aza and bFGF for 24 hours and then cocultured with neonatal rat CMs (indirect contact, in the upper compartment of the Transwell culture system) on Transwell plates. On days 5, 8, and 11, BMSCs in the lower compartment were treated with 10 mmol/L of AG1478 (Sigma), an ErbB receptor antagonist, 100 mg/L of NRG-1 (PeproTech), or Dulbecco modified Eagle medium, respectively. On the day of treatment, cells were incubated with the drug for only 12 hours. During the 12-hour treatment, the upper compartment of the Transwell with neonatal rat CMs was set apart to avoid the effect of the drugs on CMs. After the 12-hour treatment, the upper compartment with new CMs was placed back. The cells without the treatment of drugs were used as control. On day 21, the messenger RNA levels of NKx2.5, HCN4, Tbx3, and Tbx2 were detected by quantitative RT (qRT)-PCR, whereas the protein levels of TBX3, Akt, and phospho-Akt (p-Akt) were detected by western blotting. BMSCs without coculture with CMs were employed as a blank control.
Real-Time qRT-PCR Analysis Total RNA was isolated from induced BMSCs in which the NRG-1/ErbB pathway was manipulated and induced for 3 weeks. The qRT-PCR was performed with a 7500 Real-Time PCR System (Applied Biosystems, Carlsbad, CA), using Allin-one qPCR Mix (Gene Copoeia, Rockville). The reaction
TABLE 1. Primer Sets Used for qRT-PCR Analysis Gene Tbx2 Tbx3 Nkx2.5 HCN4 GAPDH
Primer Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
2013 Lippincott Williams & Wilkins
AGCCCGTGGCCTTCCACAAA TGGAAGCGCGGCTGGTACTT GTCTCCTTCTTG GCCTCTCATC CATCGCCGTGACTGCCTATC ACCGCCCCTACATTTTATCC GACAGGTACCGCTGTGCTT CTAAGGGCAACAAGGAGACCA CAGTGAGTAGAGGCGGCAGTAAG GCAAGTTCAACGGCACAG GCCAGTAGACTCCACGACAT
Product Size
Annealing Point
100
62
165
60
230
63
122
63
140
60
www.jcvp.org |
435
Li et al
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
volume was 20 mL and contained 2 mL of cDNA. Relative messenger RNA expression was calculated using the comparative threshold cycle number of each sample. Expression was normalized by GAPDH expression. The primers employed in this study are given in Table 1.
in current-clamp mode by an Axopatch 200B patch-clamp amplifier (Molecular Devices Corporation, Sunnyvale). pClamp 9.0 software was used to regulate APs elicited and for data acquisition, whereas AP duration at 50%, 90% repolarization (APD50/APD90), and AP amplitude (APA) were measured by Campfit 9.0.
Western Blot Analysis Induced BMSCs were collected on week 3 after induction and washed 3 times with ice-cold PBS. Cells were lysed with extraction buffer (Lysis Buffer:Protease Inhibitor Mix = 500:1; Vazyme Biotech Co, Nanjing, China) on ice, and 50 mg of each protein sample was analyzed by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis under reducing conditions. The separated proteins were transferred to a nitrocellulose membrane (Millipore, Billerica) and blocked with 5% bovine serum albumin. The antibodies used included anti-TBX3 (diluted 1:500; Boisynthesis Biotechnology, Beijing, China), anti-p-Akt (diluted 1:100; Cell Signaling Technology), anti-Akt (diluted 1:250; Cell Signaling Technology), and anti-b-actin (diluted 1:1000; ZGGB-BIO, Beijing, China), which were incubated overnight at 48C and then incubated with corresponding horseradish peroxidase–conjugated secondary antibodies (goat anti-rabbit; ZGGB-BIO). The blots were visualized using the enhanced chemiluminescence method (Thermo) with a chemiluminescence imaging system (GE).
Statistical Analyses
Experimental data were expressed as mean 6 SD. Comparisons between groups were made by 1-way analysis of variance with Fisher protected least significant difference post hoc comparison. Results were considered statistically significant if P , 0.05.
RESULTS Morphology and Identification of BMSCs After 4–6 hours in primary culture, BMSCs began to adhere on the plastic surface, initially appearing as a small dot and later becoming spindle shaped. After 5–7 days of culture, cells covered approximately 80%–85% of the surface. Flow cytometric analysis of BMSC surface antigens demonstrated that more than 95% of the cells were positive for stem cell surface markers CD29, CD90, and CD105, whereas the hematopoietic lineage marker CD45 was absent (Fig. 1).
Action Potential Recording
Myogenic Differentiation
Action potentials (APs) were recorded at 378C from single cells 3 weeks after induction. The APs were recorded
After exposure to 5-aza and FGF-basic, some adherent cells died, their shape underwent significant changes, and
FIGURE 1. Detection of cell surface antigens of BMSCs using flow cytometry found that BMSCs highly expressed mesenchymal cell surface markers CD29, CD90, and CD105 and negatively expressed the hematopoietic cell surface of CD45.
436
| www.jcvp.org
2013 Lippincott Williams & Wilkins
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
NRG-1/ErbB Signaling on the Differentiation of BMSCs
expression of p-Akt was increased in the NRG-1 group while decreased in the AG1478 group (Fig. 5).
Detection of AP
FIGURE 2. RT-PCR analysis of the expression of NKx2.5 in BMSCs induced cells. Diagrams of the quantifications of NKx2.5 expression in 5-aza–treated cells.
growth became slower. After indirect contact coculture with neonatal rat CMs in a Transwell system, the cells became larger and assumed ball-like or stick-like morphologies. In some cases, the formation of new branches was observed. RT-PCR was employed to detect the expression of CM marker NKx2.5. No expression of NKx2.5 was detected in the BMSCs, whereas NKx2.5 was detected in the induced BMSCs at day 10, with expression increasing over time, and the expression of NKx2.5 was peaked at day 21 (Fig. 2). Immunofluorescence analysis revealed that 30%–40% of the induced BMSCs stained positive for CTnI after differentiating for 3 weeks, whereas none of the BMSCs displayed positive expression (Fig. 3).
Effect of NRG-1/ErbB Pathway on Differentiation of CMs From BMSCs Three weeks after induction, qRT-PCR analysis revealed that the differentiated BMSCs expressed cardiac early transcription factor Nkx2.5 after being treated with 5-aza and cocultured with neonatal rat CMs. As expected, expression was negative in the blank control group. The inhibition of NRG-1/ErbB signaling (used AG1478) greatly enhanced the gene expression of HCN4, Tbx3, and Tbx2 as compared with the control and NRG-1 groups (P , 0.05). The expression of Nkx2.5 in the NRG-1 group was higher than that of the other 2 groups (P , 0.05) (Fig. 4). Western blot analysis of the protein expression of Tbx3 and p-Akt revealed that Tbx3 levels were higher in the AG1478 group than the control group (P , 0.05) and the
Three weeks after induction, in whole-cell currentclamp mode, we could detect typical cardiac-type APs with sinus-like APs (Fig. 6A) or ventricular muscle–like APs (Fig. 6B) in the AG1478, NRG-1, and control groups, whereas none was observed in the BMSC group. Sinus-like APA was 68 6 4 mV, APD50/APD90 was 117 6 9.5/188 6 13.3 ms, ventricular muscle–like APA was 108 6 5 mV, and APD50/APD90 was 163.7 6 19/281 6 27 ms.
DISCUSSION Marrow stromal cells (MSCs) are a population of selfrenewing and multipotent cells, according to the minimum standards provided by the International Society for Cellular Therapy. MSCs isolated from various origins should meet the following 3 criteria15: (1) isolated MSCs should adhere to plastic when maintained in standard culture conditions, (2) display specific markers of mesenchymal stem cells, which includes more than 95% of the cells expressing the surface markers CD73, CD90, and CD105 and less than 2% of cells expressing the surface antigens CD14, CD34, and CD45, and (3) have the potential to differentiate into various types of tissue cells in vitro. In this study, MSCs were obtained from rat bone marrow and meet these requirements. Compared with other stem cells, it has obvious advantages in autologous transplantation as rich contents and easy and wide availability. At present, no uniform effective genetic markers of early sinus node cells are known.12 A large body of evidence indicates that early working-type CMs are characterized by higher expression of transcription factor NKx2.5, ANF, and high-conductance gap junction proteins (cx-40 and cx-43) than sinoatrial node cells.16,17 The early sinus node cell expression markers include elevated levels of the transcription factors Tbx2 and Tbx3, the pacing gene HCN4, and lowconductance gap junction proteins (cx-45)18,19; further, they also have lower proliferative activity and greater automaticity than working-type CMs.18,19 In our study, BMSCs expressed cardiac early transcription factor Nkx2.5 and troponin-I after treatment with 5-aza and coculture with neonatal rat CMs in
FIGURE 3. Immunofluorescence analysis of the expression of CTnI in BMSCs induced cells. A, BMSCs expressed the cardiac marker CTnI (red) and DAPI for nucleolus (blue) visualization after treating with 5-aza for 24 hours and coculture with CMs for 3 weeks. B, BMSCs did not express CTnI. 2013 Lippincott Williams & Wilkins
www.jcvp.org |
437
Li et al
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
FIGURE 4. qRT-PCR analysis of the expression of pacemaker-related genes after intervening NRG-1/ ErbB signaling pathway in certain period when rat BMSCs differentiate into CMs. BMSCs expressed Nkx2.5 after induction for 3 weeks, whereas it was negative in blank control group (*P , 0.05 vs. BMSC group). The relative messenger RNA expression of Tbx3, Tbx2, and HCN4 in AG1478 group was significantly higher than control group and NRG-1 group (#P , 0.05 vs. control group; DP , 0.05 vs. AG1478 group), whereas the relative expression of Nkx2.5 in NRG-1 group was higher than the other 2 groups (#P , 0.05 vs. control group; DP , 0.05 vs. AG1478 group).
a Transwell culture system for 3 weeks. The inhibition of NRG-1/ErbB signaling at certain periods of BMSC differentiation into CMs greatly enhanced some markers associated with differentiating CM sinus node precursors (HCN4, Tbx3, Tbx2). Furthermore, distinct nodal-type APs could be detected. Together, these data suggest that targeting the NRG1/ErbB signaling may induce cardiomyogenic differentiation of BMSCs to a nodal phenotype. On the other hand, the expression of Nkx2.5 in NRG-1 group cells was higher than the other 2 groups. Tbx3 is a transcriptional repressor required for the development of the mammalian heart. This factor plays an important role during heart embryogenesis, especially in the development and maturation of the early cardiac sinus node cells.20,21 Some researchers reported that in the early developing heart, Tbx2 and Tbx3 repress the expression of cardiac work-related genes and impose the pacemaker phenotype, promoting the differentiation and maturation of the sinoatrial node cells.20,22 Usually, Tbx3 and HCN4 are regarded as markers of pacemaker tissue in the heart,18,23 whereas the expression of NKx2.5 is detrimental for the development of nodal cells for a certain period during early heart development,24 as this can suppress the expression of nodal phenotypes, such as Tbx3 and HCN4 expression, and lead to cardiac abnormalities, including hypoplastic sinus node.25
NRG-1 operates as a signaling transduction protein between cells,9 and its biological function is mediated by binding the tyrosine kinase receptor to activate multiple signal transduction pathways, including phosphatidylinositol-3kinase (PI3K)/Akt and mitogen-activated protein kinase/ extracellular signal-regulated kinase (MAPK-ERK) signaling pathways. PI3K/Akt signaling is regarded as the central regulator of the NRG/ErbB signaling network and is involved in mediating survival signals in a variety of cells.26 Previous studies demonstrated that NRG-1/ErbB signaling plays indispensable roles in cardiac and neuronal development by regulating the proliferation and differentiation of multiple cell types, including epithelial cells, neurons, and CMs.27 Recently, multiple biological functions of the NRG-1/ErbB signaling pathway in the developing and mature hearts have been discovered. Multiple laboratories have reported that NRG-1 acts as a protective growth factor,28 injecting exogenous NRG-1 in adult rat models of systolic heart failure,29 ischemic, dilated, and viral cardiomyopathies,30 diabetic cardiomyopathy,31 and myocardial infarction.32 Furthermore, investigations of the function of NRG-1 indicate that it inhibits cardiac apoptosis and fibrosis, improving ventricular function. The maturation of the heart is a very complicated and highly regulated process involving a variety of signaling pathways. Recent studies have determined that the NRG-1/ ErbB signaling pathway is indispensable in early myocardial
FIGURE 5. Western blot analysis of the expression of Akt, p-Akt, and Tbx3 in each group after differentiation for 3 weeks. A, The original gels of Akt, p-Akt, and Tbx3. B, The mean density of Akt, p-Akt, and Tbx3 in control group was defined as 100%, *P , 0.05 versus BMSC group, #P , 0.05 versus control group, DP , 0.05 versus AG1478 group.
438
| www.jcvp.org
2013 Lippincott Williams & Wilkins
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
FIGURE 6. Interference with NRG-1/ErbB signaling regulated the ratio of nodal- versus working-type cells in differentiating BMSC-derived CM cultures. A, BMSCs derived cells exhibit distinct nodal-type (a) and working-type (b) APs. B, Histogram plots indicating the percentage of BMSCs derived cells exhibiting either the working (black) or the nodal (white) AP phenotype in control group (n = 13 cells), NRG-1 group (n = 16 cells), and AG1478 group (n = 14 cells). Note that inhibiting endogenous NRG-1/ErbB signaling enhanced the proportion of pacemaker phenotype.
cell differentiation and maturation. However, how NRG-1 signaling affects heart morphogenesis and gene expression is not entirely clear at present. The first evidence of the NRG-1/ ErbB signaling pathway participating in the development of the heart was revealed investigating NRG-12/2 null mice. Meyer27 reported that NRG-12/2 mice die during embryogenesis (10.5 days) because of the absence of normal trabeculation of the ventricles. Furthermore, Lai33 used NRG-1 and ErbB4 mutant mice to demonstrate that NRG-1 is essential for ventricular morphogenesis but is not a required factor in the initial stages of chamber specification, with the expression of Tbx2 found to be normal in NRG-1 mutant mice. These data indicate that NRG-1 is a critical regulator in the maturation of the ventricular node, but not the sinus node. Current research indicates that NRG-1 induces CM cell cycle activity, promotes myocardial regeneration,34 and induces CM differentiation of embryonic stem cells at an early stage of development.35 In our study, we also observed that exogenous NRG-1 could promote the expression of Nkx2.5, which may contribute to promoting the working-type phenotype, whereas inhibiting endogenous NRG-1/ErbB signaling enhanced the pacemaker phenotype. However, the downstream molecular mechanism is poorly understood. In this study, Western blot analysis revealed that the levels of p-Akt were significantly increased in the NRG-1–treated group and decreased in the AG1478-treated group. Akt, 2013 Lippincott Williams & Wilkins
NRG-1/ErbB Signaling on the Differentiation of BMSCs
a downstream effector of the PI3K signaling cascade, is phosphorylated and activated by PI3K and plays a pivotal role in cell proliferation and differentiation.36 Relevant to this study, others have recently speculated that the molecular mechanisms underlying induction of CM proliferation by NRG-1 may involve the activation of PI3K/Akt signaling.34,35 Interestingly, a recent study employed animal models to demonstrate that automatic rhythmicity in PI3K2/2 mice was greater than PI3K+/+ mice.37,38 Thus, we speculate that PI3K/Akt signaling may be a target of NRG-1, regulating cardiac subtype specification in differentiating rat BMSCs. In summary, this study showed that the expression of pacemaker-related genes and proteins could be greatly enhanced by intervening endogenous NRG-1/ErbB pathway in certain period when rat BMSCs differentiated into CMs. The mechanisms underlying this function may be closely related with the intervention of the PI3K/Akt signaling system. This provides a good model for the development of biological pacemaker. However, because of our limited conditions, no spontaneous beating cells were observed in this study. This may be because of the low differentiation efficiency of induction or limit of induction time. The mechanism and the optimal conditions for inducing differentiation require further investigation. REFERENCES 1. He JQ, Ma Y, Lee Y, et al Human embryonic stem cells develop into multiple types of cardiac myocytes: action potential characterization. Circ Res. 2003;93:32–39. 2. Moore JC, Fu J, Chan YC, et al. Distinct cardiogenic preferences of two human embryonic stem cell (hESC) lines are imprinted in their proteomes in the pluripotent state. Biochem Biophys Res Commun. 2008; 372:553–558. 3. Makino S, Fukuda K, Miyoshi S, et al. Cardiomyocytes can be generated from marrow stromal cells in vitro. J Clin Invest. 1999;103:697–705. 4. Pittenger MF, Mackay AM, Beck SC, et al. Multilineage potential of adult human mesenchymal stem cells. Science. 1999;284:143–147. 5. Meligy FY, Shigemura K, Behnsawy HM, et al. The efficiency of in vitro isolation and myogenic differentiation of MSCs derived from adipose connective tissue, bone marrow, and skeletal muscle tissue. In Vitro Cell Dev Biol Anim. 2012;48:203–215. 6. Yoon J, Shim WJ, Ro YM, et al. Transdifferentiation of mesenchymal stem cells into cardiomyocytes by direct cell-to-cell contact with neonatal cardiomyocyte but not adult cardiomyocytes. Ann Hematol. 2005;84: 715–721. 7. Wang T, Xu Z, Jiang W, et al. Cell-to-cell contact induces mesenchymal stem cell to differentiate into cardiomyocyte and smooth muscle cell. Int J Cardiol. 2006;109:74–81. 8. Garbade J, Schubert A, Rastan AJ, et al. Fusion of bone marrow-derived stem cells with cardiomyocytes in a heterologous in vitro model. Eur J Cardiothorac Surg. 2005;28:685–691. 9. Pentassuglia L, Sawyer DB. The role of Neuregulin-1beta/ErbB signaling in the heart. Exp Cell Res. 2009;315:627–637. 10. Odiete O, Hill MF, Sawyer DB. Neuregulin in cardiovascular development and disease. Circ Res. 2012;111:1376–1385. 11. Lemmens K, Doggen K, De Keulenaer GW. Role of neuregulin-1/ErbB signaling in cardiovascular physiology and disease: implications for therapy of heart failure. Circulation. 2007;116:954–960. 12. Zhu WZ, Xie Y, Moyes KW, et al. Neuregulin/ErbB signaling regulates cardiac subtype specification in differentiating human embryonic stem cells. Circ Res. 2010;107:776–786. 13. Zhang J, Chatterjee K, Alano CC, et al. Vincristine attenuates N-methylN’-nitro-N- nitrosoguanidine-induced poly-(ADP) ribose polymerase activity in cardiomyocytes. J Cardiovasc Pharmacol. 2010;55:219–226. 14. Sayed D, Rane S, Lypowy J, et al. MicroRNA-21 targets Sprouty2 and promotes cellular outgrowths. Mol Biol Cell. 2008;19:3272–3282.
www.jcvp.org |
439
Li et al
J Cardiovasc Pharmacol Volume 63, Number 5, May 2014
15. Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8:315–317. 16. Christoffels VM, Burch JB, Moorman AF. Architectural plan for the heart: early patterning and delineation of the chambers and the nodes. Trends Cardiovasc Med. 2004;14:301–307. 17. Evans SM, Yelon D, Conlon FL, et al. Myocardial lineage development. Circ Res. 2010;107:1428–1444. 18. Wiese C, Grieskamp T, Airik R, et al. Formation of the sinus node head and differentiation of sinus node myocardium are independently regulated by Tbx18 and Tbx3. Circ Res. 2009;104:388–397. 19. Jensen B, Boukens BJ, Postma AV, et al. Identifying the evolutionary building blocks of the cardiac conduction system. PLoS One. 2012;7: e44231. 20. Hoogaars WM, Engel A, Brons JF, et al. Tbx3 controls the sinoatrial node gene program and imposes pacemaker function on the atria. Genes Dev. 2007;21:1098–1112. 21. McNally EM, Svensson EC. Setting the pace: Tbx3 and Tbx18 in cardiac conduction system development. Circ Res. 2009;104:285–287. 22. Singh R, Hoogaars WM, Barnett P, et al. Tbx2 and Tbx3 induce atrioventricular myocardial development and endocardial cushion formation. Cell Mol Life Sci. 2012;69:1377–1389. 23. DiFrancesco D. The role of the funny current in pacemaker activity. Circ Res. 2010;106:434–446. 24. Mommersteeg MT, Hoogaars WM, Prall OW, et al. Molecular pathway for the localized formation of the sinoatrial node. Circ Res. 2007;100: 354–362. 25. Espinoza-Lewis RA, Liu H, Sun C, et al. Ectopic expression of Nkx2.5 suppresses the formation of the sinoatrial node in mice. Dev Biol. 2011; 356:359–369. 26. Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network. Nat Rev Mol Cell Biol. 2001;2:127–137. 27. Meyer D, Birchmeier C. Multiple essential functions of neuregulin in development. Nature. 1995;378:386–390.
28. Hedhli N, Huang Q, Kalinowski A, et al. Endothelium-derived neuregulin protects the heart against ischemic injury. Circulation. 2011;123: 2254–2262. 29. Wang XH, Zhuo XZ, Ni YJ, et al. Improvement of cardiac function and reversal of gap junction remodeling by Neuregulin-1beta in volume-overloaded rats with heart failure. J Geriatr Cardiol. 2012; 9:172–179. 30. Liu X, Gu X, Li Z, et al. Neuregulin-1/ErbB-activation improves cardiac function and survival in models of ischemic, dilated, and viral cardiomyopathy. J Am Coll Cardiol. 2006;48:1438–1447. 31. Li B, Zheng Z, Wei Y, et al. Therapeutic effects of neuregulin-1 in diabetic cardiomyopathy rats. Cardiovasc Diabetol. 2011;10:69. 32. Xiao J, Li B, Zheng Z, et al. Therapeutic effects of neuregulin-1 gene transduction in rats with myocardial infarction. Coron Artery Dis. 2012; 23:460–468. 33. Lai D, Liu X, Forrai A, et al. Neuregulin 1 sustains the gene regulatory network in both trabecular and nontrabecular myocardium. Circ Res. 2010;107:715–727. 34. Bersell K, Arab S, Haring B, et al. Neuregulin1/ErbB4 signaling induces cardiomyocyte proliferation and repair of heart injury. Cell. 2009;138: 257–270. 35. Wang Z, Xu G, Wu Y, et al. Neuregulin-1 enhances differentiation of cardiomyocytes from embryonic stem cells. Med Biol Eng Comput. 2009;47:41–48. 36. Qiu FY, Song XX, Zheng H, et al. Thymosin beta4 induces endothelial progenitor cell migration via PI3K/Akt/eNOS signal transduction pathway. J of Cardiovasc Pharmacol. 2009;53:209–214. 37. Rose RA, Kabir MG, Backx PH. Altered heart rate and sinoatrial node function in mice lacking the cAMP regulator phosphoinositide 3-kinasegamma. Circ Res. 2007;101:1274–1282. 38. Alloatti G, Marcantoni A, Levi R, et al. Phosphoinositide 3-kinase gamma controls autonomic regulation of the mouse heart through Gi-independent downregulation of cAMP level. FEBS Lett. 2005;579: 133–140.
440
| www.jcvp.org
2013 Lippincott Williams & Wilkins
