G Model
ARTICLE IN PRESS
YTICE-908; No. of Pages 7
Tissue and Cell xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Tissue and Cell journal homepage: www.elsevier.com/locate/tice
Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells Layasadat Khorsandi a,b,∗ , Fereshteh Nejad-Dehbashi a , Akram Ahangarpour c , Mahmoud Hashemitabar a a
Cell & Molecular Research Center, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran Department of Anatomical Sciences, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran c Diabetes Research Center, Health research institute and Department of Physiology, School of Medicine, Jundishapur University of Medical Sciences, Ahvaz 61335-189, Iran b
a r t i c l e
i n f o
Article history: Received 24 July 2014 Received in revised form 22 November 2014 Accepted 23 November 2014 Available online xxx Keywords: Beta cells 3D culture Fibrine glue Mesenchymal stem cells
a b s t r a c t Fibrin glue (FG) is used in a variety of clinical applications and in the laboratory for localized and sustained release of factors potentially important for tissue engineering. The aim of this study was to evaluate FG scaffold effect on differentiation of insulin-producing cells (IPCs) from bone marrow-derived mesenchymal stem cells (BM-MSCs). In this experimental study BM-MSCs were cultured and the cells characterized by analysis of cell surface markers using flow cytometry. BM-MSCs were seeded in FG scaffold (3D culture) and then treated with induction media. After induction, the presence of IPCs was demonstrated using gene expression profiles for pancreatic cell differentiation markers (PDX-1, GLUT-2 and insulin) and insulin detection in cytoplasm. Release of insulin by these cells was confirmed by radioimmunoassay. Expression of the islet-associated genes PDX-1, GLUT-2 and Insulin genes in 3D cultured cells was markedly higher than the 2D cultured cells exposure differentiation media. Compared to 2D culture of BM-MSCs-derived IPCs, the insulin release from 3D BM-MSCs-derived IPCs showed a nearly 3 fold (p < 0.05) increase when exposed to a high glucose (25 mM) medium. Percentage of insulin positive cells in 3D experimental group showed an approximately 3.5-fold increase in compared to 2D experimental culture cells. The results of this study demonstrated that FG scaffold can enhance the differentiation of IPCs from rats BM-MSCs. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Diabetes mellitus is one of the most common chronic diseases which directly affect millions of people (Pandey, 2010). Type 1 diabetes is caused by autoimmune destruction of the pancreatic islet insulin-producing beta-cells. Insulin administration does not prevent long-term complications of the disease, as the optimal insulin dosage is difficult to adjust. Replacement of the damaged cells with regulated insulin-producing cells is considered the ultimate cure for type 1 diabetes. Transplantation of intact human pancreases or isolated islets has been severely limited by the scarcity of human tissue donors (Zalzman et al., 2005).
∗ Corresponding author at: Cell & Molecular Research Center, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, P. O. Box: 61335, Ahvaz, Iran. Tel.: +98 611 3720458; fax: +98 611 3336380. E-mail addresses: [email protected], khorsandi [email protected] (L. Khorsandi).
Many studies have been focused on how to develop renewable sources of islet-replacement tissue. Whereas some studies have shown the generation of insulin producing cells (IPCs) from progenitor cells of the pancreas (Bonner-Weir et al., 2000), liver (Yang et al., 2002, Liu et al., 2013), pluripotent embryonic stem cells (Lumelsky et al., 2001; Ebrahimie et al., 2014), and skin derived stem cells (Guo et al., 2009), the efficiency of in vitro generated IPCs is low. Ianus et al. (2003) showed that labeled cells from the bone marrow were able to contribute, even if just partially, to the pancreatic endocrine lineage. It has been reported that 3D culture is important for the acquisition of mature IPCs (Takeuchi et al., 2014). A 3D culture is advantageous to imitate the in vivo micro environment by enhancing cell-cell and cell-matrix interactions and subsequent cell signaling (Wang et al., 2007; Grayson et al., 2004; Schmeichel and Bissell, 2003; Mohr et al., 2006) To date, a variety of 3D cell culture systems have been developed and adopted for directing stem cell differentiation into various lineages (Levenberg et al., 2003; Liu et al., 2013; Mohr et al., 2006).
http://dx.doi.org/10.1016/j.tice.2014.11.005 0040-8166/© 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model YTICE-908; No. of Pages 7
ARTICLE IN PRESS L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
2
It has been revealed that biomaterial scaffold can enhance differentiation of various cell types into IPC compared to those differentiated in 2D cultures (Vaithilingam et al., 2008; Wang et al., 2007; Ku et al., 2004; Kubo et al., 2004; Hebrok, 2012). Fibrin glue (FG) is a natural fibrous protein involved in the clotting of blood. FG scaffolds can be engineered as a tissue substitute that is biocompatible and biodegradable (Ahmed et al., 2008). Proliferation and differentiation of the stem cells can be achieved in a fibrin matrix, and fibrin alone or in combination with other materials has been used as scaffolds to regenerate adipose tissue, bone, cartilage, etc. (Ahmed et al., 2008). In this study effect of FG on BM-MSCs differentiation into IPCs was investigated. 2. Materials and methods 2.1. Isolation of BM-MSCs This study was approved by the ethics committee of Ahvaz Jundishapur University of Medical Sciences. BM-MSCs cultures were prepared under sterile conditions. Briefly, the femur and tibiae of the Wistar rats were excised with special attention given to remove all connective tissue attached to bones. Bone marrow was extruded from these bones by flushing the BM cavity using a syringe with 20-gauge needle filled with culture medium (DMEM) supplemented with 10% fetal calf serum (FCS). The harvested BM-MSCs were gently pipetted to break up cell clumps in order to obtain cell suspension. After a homogenous cell suspension was achieved, the cells were centrifuged at 1200 rpm for 7 min and the cell pellet was resuspended in 3 ml of culture medium. The cell suspension was seeded in 25 cm plastic tissue culture flasks with 5 ml culture medium and maintained at 37◦ C in a humidified atmosphere with 5% CO2 . Cultures of BM-MSCs were inspected and refed every 3 days and passaged when the BM-MSCs have reached approximately 80% confluence. The mesenchymal population was isolated on the basis of its ability to adhere to the culture plate (Moradi et al., 2012; Wakitani et al., 1995; Barbash et al., 2003). Expression of cell surface markers on the BM-MSCs culture prior to use of differentiation media were analyzed using flow cytometry. The cells were characterized with regard to a set of markers characteristic for BM-MSCs including CD44, CD105, CD45 and CD34 (Karaoz et al., 2009). 2.2. Experimental design The BM-MSCs at passages three were used in this experiment. Four groups including two controls and two experimental groups were formed. The cells were cultured in DMEM as 2D control group. The seeded cells onto the FG scaffolds were cultured in DMEM and used as 3D control group. The cultured cells in IPC differentiation media used as 2D experimental group. The seeded cells onto the FG scaffolds were cultured in IPC differentiation media and used as 3D experimental group. A three-stage protocol was used to induce IPC. Stage 1: The cells (1 × 105/ml) were cultured (37 ◦ C, 5% CO2 ) in serum-free high glucose DMEM (25 mmol/L) containing 0.5 mmol/L betamercaptoethanol (Invitrogen) for 2 days. Stage 2: The cells then were cultured in the medium containing 1% non-essential amino acids (Invitrogen), 20 ng/ml fibroblast growth factor (FGF, SigmaAldrich), 20 ng/ml epidermal growth factor (EGF, Sigma-Aldrich), 2% B27 (Invitrogen), 2 mmol/L l-glutamine and 10 ng/ml exendine4 (Sigma) in 6-well plates for 8 days. Stage 3: The cells were cultured for an additional 8 days in new medium containing 10 ng/ml betacellulin, 10 ng/ml activin A, 2% B27, 10 mmol/L nicotinamide and 10 ng/ml exendine-4 (Sun et al., 2007).
Table 1 Sequences of genes. Gene
PDX-1 GLUT-2 Insulin Glucagon Somatostatin PAX-4 MafA -Actin GAPDH
Sequences Forward
Reverse
AAACGCCACACACAAGGAGAA CAGCTGTCTCTGTGCTGCTTGT TCTTCTACACACCCATGTCCC GTAATGCTGGTACAAGGCAG CTGCATCGTCCTGGCTTTGG TGGCTTTCTGTCCTTCTGTGA CTTCAGCAAGGAGGAGGTCAT ACCTGACAGACTACCTCATG CTCTGGTGGACCTCATGGCCTAC
AGACCTGGCGGTTCACATG GCCGTCATGCTCACATAACTCA GGTGCAGCACTGATCCAC CCAGTTGATGAAGTCTCTGG TGCAGCCAGCTTTGCGTTCC TCCAAGACTCCTGTGCGGTAG GCGTAGCCGCGGTTCTT ATCGTACTCCTGCTTGCTGA CAGCAACTGAGGGCCTCTCT
2.3. 3D culture FG scaffolds (total volume: 400 l) were made by combining fibrinogen (from bovine plasma) at a concentration of 10 mg/ml, 2.5 mM CaCl2 , and 2 NIH units/ml of thrombin (all from Sigma except where indicated). The scaffold was characterized by SEM (Willerth et al., 2006). Scaffolds were prewetted overnight (approximately 12 h) at 4 ◦ C in culture medium consisting of DMEM supplemented with 10% FCS, 100 U/ml penicillin, 10 g/ml streptomycin, and 0.1 mm nonessential amino acids. Following trypsinization, BM-MSCs at passage 3 (1–1.5 × 106 cells/scaffold) were resuspended into 200 l of culture medium and were seeded onto the FG scaffolds, and maintained for 3 days. The cell seeded scaffolds were then incubated in the IPC media. 2.4. Scanning electron microscopy (SEM) Unseeded and seeded scaffolds were fixed with 2.5% glutaraldehyde buffered in 0.15 mol/L sodium cacodylate (pH 7.2, 20 ◦ C, 1 h). After fixation, the cultures were repeatedly rinsed in cacodylate buffer. The cultures were dehydrated in a graded series of ethanol (50%, 70%, 95% and 100% alcohol) prior to critical point drying. The preparations were sputter-coated with gold-palladium before SEM. 2.5. Real-time polymerase chain reaction Using the RNeasy Mini kit (Qiagen), RNA was isolated from the harvest cells according to manufacturer’s instructions. cDNA was produced from the extracted RNAs using the cDNA synthesis kit based on the manufacturer’s instructions (Fermentas, Canada). Primer sequences are shown in Table 1. Approximately 2 l of cDNA was amplified in each 25 l PCR reaction mix containing 12.5 l of 2 × SYBR Green Master Mix (Fermentas, Canada), 0.2 l of each 10 pmol forward and reverse primers (designed in primer 3 software, Table 1) and 10.1 l DEPC water. PCR amplification was done in 40 cycles using the following program: 95 ◦ C for 10 min, 95 ◦ C for 15 s, 5 ◦ C for 30 s and 60 ◦ C for 34 s. Data were analyzed using the 2−CT method. Gene expression in IPCs was normalized either to undifferentiated BM-MSCs or adult rat islets. Expression values were corrected for the housekeeping gene -actin (Ebrahimie et al., 2014). 2.6. Radioimmunoassay (RIA) The differentiated cells were plated in 24-well plates at 105 cells per well. The cells were preincubated for 1 h in glucose-free Krebs-Ringer bicarbonate (KRB), and incubated with KRB containing 5.56 mmol/L, 16.7 mmol/L and 25 mmol/L of glucose (glucose challenge) for an additional 1 h, respectively. The KRB media were collected and frozen at −80 ◦ C until assay (Gabr et al., 2012). Insulin assay was performed by RIA using a commercially available rat RIA kit (Millipore) according to the manufacturer’s instructions.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model
ARTICLE IN PRESS
YTICE-908; No. of Pages 7
L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
3
Fig. 1. Characterization of the different surface markers including: CD34, CD45, CD44 and CD105. High expression of CD44 and CD105, low expression of CD34 and no expression of CD45 are shown. Gray and white histograms showed control and cell surface markers.
Determinations were carried out in triplicate and the means and standard deviations were obtained. 2.7. Immunofluorescent staining Both cell seeded and unseeded scaffolds were fixed in 10% buffered formalin, dehydrated, embedded in paraffin and cut into 4 m sections. Paraffin sections were dewaxed in xylene, hydrated, boiled for 15 min in a microwave oven in 10 mmol/L sodium citrate, pH 6, for antigen retrieval. The cells were blocked with normal goat serum in PBS for 1 h at room temperature. Anti-insulin primary antibody (H-86: sc-9168, Santa Cruz) was diluted 1:200 in PBS and incubated overnight at 4 ◦ C. The cells were rinsed three times with PBS and then incubated with fluorescence-labeled specific secondary antibody diluted in PBS with 0.5% BSA at 37 ◦ C for 50 min. After washing, cells were incubated with DAPI (4 , 6-diamidino2-phenylindole) at dilution 1:1000 in PBS for 10 min. 2D cultures were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.1% Triton X-100/PBS for 10 min at room temperature. The cells were blocked for 30 min in PBS plus 0.2% Triton X-100,
1% bovine serum albumin (BSA). Anti-insulin primary antibody (H86: sc-9168, Santa Cruz) was diluted 1:200 in PBS and incubated overnight at 4 ◦ C. The cells were rinsed three times with PBS and then incubated with fluorescence-labeled specific secondary antibody diluted in PBS with 0.5% BSA at 37 ◦ C for 50 min. After washing, cells were incubated with DAPI for 10 min (Liu et al., 2013). Images were captured using an Olympus BX51 phase contrast fluorescent microscope (Olympus). The percentage of insulin-positive cells were calculated by dividing the number of Insulin-positive cells in a randomly microscopy field by the total number of cells in that field, and the result was multiplied by 100. There were at least three slides for different groups. Ten randomly field were evaluated for each slide (Orazizadeh et al., 2014).
2.8. Statistical analysis A two-tailed Student’s t-test was used for comparing the obtained values. For statistical purposes at least three independent cultures were considered. All values stated as means ± standard
Fig. 2. Morphological changes in 2D culture. (A) BM-MSCs in DMEM. (B) BM-MSCs in IPC differentiation media.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model YTICE-908; No. of Pages 7
ARTICLE IN PRESS L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
4
deviations. A p value p < 0.05 was considered to be statistically significant. 3. Results 3.1. Flow cytometry Cell surface markers detected by flow cytometry revealed that BM-MSCs highly expressed CD105 and CD44, whereas no expression of CD34, CD45 was detected (Fig. 1). 3.2. 2D culture Under an inverted microscope, BM-MSCs were typical of adherent spindle and fibrocyte-like at passage 3. The BM-MSCs cultured in undifferentiating media (control 2D group) showed various shapes including spherical, neuron-like cells or glial-like cells (Fig. 2A). Under differentiation media, the BM-MSCs formed spherical type with confluence (Fig. 2B). 3.3. 3D culture SEM studies indicated that the spongy scaffold possessed numerous interconnected pores. BM-MSCs formed continuous sheets of the cells that filled the interconnected pores of the FG scaffolds in both control and experimental 3D culture groups. In control group the morphologies of BM-MSCs were flat and elongated while the cells in differentiation media showed round-shaped morphology (Fig. 3). 3.4. Gene expression To determine whether the BM-MSCs had undergone pancreatic differentiation, gene expression profiles for pancreatic cell differentiation markers were assessed using real time RT-PCR. Since gene expression analysis showed no significant differences between the two controls, all data were combined into one control group. As illustrated in Fig. 4, low expression of PDX-1, GLUT-2, somatostatin, glucagon and insulin was detected in undifferentiated BM-MSCs (Control). Expression of PDX-1, GLUT-2, Pax-4, MafA and insulin genes was significantly increased in 2D culture of BMMSCs-derived IPCs. High expression of these genes was observed in FG seeded differentiated cells. Compared to 2D culture of BM-MSCs-derived IPCs, the expression of PDX-1 GLUT-2, insulin, MafA and Pax-4 genes in 3D BM-MSCs-derived IPCs showed a nearly 2.4 fold, 2.3 fold, 3 fold, 2.4 fold and 2.2 fold (p < 0.05) increases respectively. Somatostatin and glucagon were not expressed in both 2D and 3D experimental groups. 3.5. Insulin release in response to glucose stimulation The cultured BM-MSCs in control groups showed very low levels of insulin in the presence or absence of glucose challenge. Since RIA analysis showed no significant differences between the two controls, all data were combined into one control group. The 2D culture of BM-MSCs-derived IPCs could release insulin in a low concentration of glucose (5.56 mmol/L) and release approximately 20 fold insulin under glucose challenge (25 mmol/L) (p < 0.01). Insulin secretion of 3D culture of BM-MSCs-derived IPCs was significantly increased in a low concentration of glucose (2 fold) and under glucose challenge (3 fold) compared to 2D culture of BM-MSCs-derived IPCs (p < 0.01). These results are shown in Fig. 5.
Fig. 3. Morphological changes in 3D culture. (A) Unseeded scaffold; (B) FG encapsulated-BM-MSCs in DMEM. Spindle-shape morphology are observed; (C) FG encapsulated-BM-MSCs in IPC differentiation media. Clusters of round-shaped morphology are observed.
3.6. Immunofluorescence staining Expression of insulin proteins was represented as green color in the immunofluorescence assay (Fig. 3). No expression of insulin was observed in both 2D and 3D control groups. In 2D experimental culture group, there was a marked increase in the percentage of the insulin positive cells (25%). In 3D experimental culture group, the percentage of insulin expressing cells was significantly increased (∼3.5 fold) in compare to 2D experimental group. These results are shown in Figs. 6 and 7.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model YTICE-908; No. of Pages 7
ARTICLE IN PRESS L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
Fig. 4. Gene expression in various groups. Expression normalized to average of housekeeping gene (-actin). Values are expressed as mean ± SD. * p < 0.001, † p < 0.001, * and † symbols respectively indicate comparison to control and 2D IPCs.
Fig. 5. Insulin secretion changes in various groups. Values are expressed as mean ± SD. * p < 0.001, † p < 0.01, †† p < 0.001, * and † symbols respectively indicate comparison to control and 2D IPCs.
4. Discussion The results of this study have demonstrated that 3D culture by using FG can effectively enhance differentiation of BM-MSCs into IPCs. The existence of IPCs was confirmed by expression pattern analysis of islet-specific genes and insulin synthesis and secretion. Gabr et al. (2008) showed that IPCs derived from adult rat BM-MSCs expressed insulin and endocrine-specific transcription genes. They transplanted the IPCs into the testes of diabetic rats, the differentiated cells could normalize blood glucose levels for 3 months in 80% of the treated rats. In another study, Gabr et al. (2013) showed that differentiated IPCs from human BM-MSCs expressed transcription factors and genes of pancreatic hormones similar to those
5
Fig. 7. Percentage of insulin-positive cells in various groups. Values are expressed as mean ± SD. * p < 0.001, † p < 0.001, * and † symbols respectively indicate comparison to control and 2D IPCs.
expressed by pancreatic islets. At the end of differentiation, ∼5–10% of cells were immunofluorescent stained for insulin. They reported that transplantation of IPCs into nude diabetic mice resulted in control of their diabetic status for 3 months. They concluded that optimization of the culture conditions are required to improve the yield of IPCs and their functional performance. In this study, the expression of PDX-1 in 3D culture of BMMSCs-derived IPCs was markedly increased in compare to 2D culture of BM-MSCs-derived IPCs. PDX is a pancreatic homeoprotein that is critical for the development of both the endocrine and exocrine pancreas, and it mediates glucose-responsive stimulation of insulin gene transcription (Edlund, 1998). PDX-1 plays a crucial role in the control of several genes expressed in the pancreas. Chun et al. (2012) demonstrated that PDX-1-transduced human amniotic fluid-derived stem cells encapsulated in alginate effectively differentiates to insulin-producing clusters. PDX1 is the first molecular marker identified in the gut region when the foregut endoderm becomes committed to the pancreatic linage. In mature beta-cells, PDX-1 transactivates the insulin gene and other genes involved in glucose sensing and metabolism, such as GLUT-2 and glucokinase (Peshavaria et al., 2000). High expression of insulin and GLUT-2 genes in 3D culture of BM-MSCs-derived IPCs was also shown in present study. It has been reported that expression of these genes indicates differentiation and fully functional IPCs. In pancreatic beta-cells, the glucose uptake is controlled by GLUT-2 (Olson and Pessin, 1996). The ability of beta-cells to release insulin in response to changes in glucose concentration is dependent, in part, on the presence of GLUT-2 transporters in the cell membrane. GLUT-2 transporters are therefore used as a marker for beta-cell maturity (Zhao and Keating, 2007).
Fig. 6. Immunofluorescence analysis of insulin. (A) Control group, BM-MSCs in DMEM. (B) BM-MSCs in IPC differentiation media. Weak or moderate immune-reactivity is observed in the cytoplasm of differentiated cells. (C) FG encapsulated-IPCs differentiation media. The cells show strong immune-staining in their cytoplasm. (Insulin stain: green; DAPI stain: blue). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model YTICE-908; No. of Pages 7 6
ARTICLE IN PRESS L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
Expression of MafA was significantly increased in 3D BM-MSCsderived IPCs. MafA is a transactivator of the insulin promoter. Recently, it was demonstrated that MafA knockout mice develop age-dependent diabetes. At birth, islets of the MafA knockout mice are morphologically normal, but with age, the mice display impaired glucose-stimulated insulin secretion and abnormal islet architecture. They also exhibit reduction of insulin and GLUT-2 expression (Zhao et al., 2005). Roles of MafA in beta-cell functions are also shown by studies of MafA overexpression in betaand non beta-cell lines. MafA seems to regulate not only insulin gene expression but also other genes involved in beta-cell functions, such as insulin biosynthesis, insulin secretion and glucose metabolism (Kaneto et al., 2005; Wang et al., 2007). Expression of Pax-4 was also significantly increased in 3D BMMSCs-derived IPCs. Analysis of Pax4 knock-out mice has revealed its important roles in the differentiation of specific endocrine cell lineages during pancreas development (Sosa-Pineda et al., 1997; St-Onge et al., 1997; Dohrmann et al., 2000). The Pax4 knockout mice do not generate insulin-producing beta-cells in the pancreas. The present study has also detected insulin, glucagon and somatostatine gene expression in non-induced cells (control), which indicated that BM-MSCs could spontaneously differentiate into various islet-like cells. As shown in results, RIA analysis demonstrated significant increase in secretion of insulin upon glucose challenge in 3D BMMSCs-derived IPCs in compared to 2D BM-MSCs-derived IPCs. This finding indicates that more mature insulin-producing cells can be generated from BM-MSCs in 3D cultures. Wang and Ye (2009a,b) reported that compared to 2D embryonic stem cell-derived IPCs, the insulin release from 3D embryonic stem cell-derived IPCs showed a nearly 5-fold increase when exposed to a high glucose medium. In this study, 3D BM-MSCsderived IPCs showed 3-fold increase in the insulin release compared to 2D culture of BM-MSCs-derived IPCs. Among candidate cells for tissue regeneration, embryonic stem cells possess ethical issues limiting their application in tissue regeneration. Additionally, some reports have indicated that transplantation of embryonic stem cells has led to teratoma formation in the animal model (Benya and Shaffer, 1982; von der Mark et al., 1977). About 83% of cells in 3D culture show insulin in their cytoplasm. Presence of immunostainable insulin demonstrates that the BM-MSCs-derived IPCs are capable of storing insulin. More interestingly, they not only produced insulin but also could secret insulin in response to different concentrations of glucose stimulation in a regulated manner. Mason et al. (2009) showed that polyethylene glycol/Col promotes differentiation of a glucose-responsive betacell population from dissociated precursor cells. About 1% of the cells showed insulin in their cytoplasm. Aloysious and Nair (2014) fabricated a 3D biodegradable scaffold comprised of natural polymers dextran and gelatin for differentiation of adipose stem cells to islet-like clusters. Insulin secretion in response to glucose challenge of IPCs on the scaffold was significantly higher than the 2D culture. Bose et al. (2012) have demonstrated presence of almost 65% of IPCs from human embryonic stem cell in 3D clusters. The exact mechanism of FG scaffold on IPCs differentiation from BM-MSCs is not obtained from this study. It has been revealed that the nascent endocrine cells migrate from the branched epithelium into the surrounding mesenchyme to form the islets of Langerhans during the pancreatic development. Thus, it is highly desirable to grow the cells within three-dimensional (3D) scaffolds to allow the formation of adequate extracellular matrix for cell proliferation, migration, and interaction with each other. It has been well documented that not only temporal synthesis but also spatial distribution of signal factors within extracellular matrix affects the lineage-specific differentiation of stem cells (Watt and Hogan, 2000; Czyz and Wobus, 2001). Extracellular interactions have been
shown to optimize beta-cell functions and proliferation (Hammar et al., 2005; Weber et al., 2008; Parnaud et al., 2009). In addition, 3D culture conditions are likely to strengthen interactions between beta-cells and could enhance insulin secretory dynamics that may be directly affected by electrical coupling between insulin-producing cells (Speier et al., 2007). Fibrin is a passive cell delivery matrix that it binds specifically many growth factors (Weisel, 2005; Lishko et al., 2002; Chernousov and Carey, 2003). This bioactivity makes fibrin an attractive matrix for stem cell differentiation and tissue engineering (Catelas et al., 2006; Willerth et al., 2006). FG has been utilized to engineer tissues with skeletal muscle cells, smooth muscle cells, and chondrocytes (Lee and Mooney, 2001). This study showed that FG scaffold can enhance the differentiation of IPCs from rats BM-MSCs, but future in vivo studies are needed to establish the clinical and prognostic potential of this IPCs-encapsulated within diabetes. It has been reported that implantation of IPCs-encapsulated close to blood vessels can be effectively reduce blood glucose in animal models of diabetes. (de Vos et al., 2000) FG encapsulated-IPCs can be successfully implanted in different sites such as such as the spleen (Soria et al., 2000) and the renal capsule (Tang et al., 2004). Implantation of IPCsencapsulated in close contact with the blood stream induces good survival and is essential for clinical application. 5. Conclusion In summary, the results of this study demonstrated that FG scaffold can enhance the differentiation of IPCs from rats BMMSCs. Future experiments will need to be performed to determine whether 2D versus 3D conditions have intrinsic benefits in generating fully matured beta-cells from human stem cell populations. Additionally, future in vivo studies are needed to establish the clinical potential of FG encapsulated-IPCs within diabetes. Acknowledgments The financial cost of this project has been provided by the research council of theAhvaz Jundishapur University of Medical Sciences (Grant number: CMRC-50). References Ahmed, T.A., Dare, E.V., Hincke, M., 2008. Fibrin: a versatile scaffold for tissue engineering applications. Tissue Eng. B 14, 199–215. Aloysious, N., Nair, P.D., 2014. Enhanced survival and function of islet-like clusters differentiated from adipose stem cells on a three-dimensional natural polymeric scaffold: an in vitro study. Tissue Eng. Part A 20, 1508–1522. Barbash, I.M., Chouraqui, P., Baron, J., Feinberg, M.S., Etzion, S., Tessone, A., Miller, L., Guetta, E., Zipori, D., Kedes, L.H., Kloner, R.A., Leor, J., 2003. Systemic delivery of bone marrow-derived mesenchymal stem cells to the infarcted myocardium: feasibility, cell migration, and body distribution. Circulation 108, 863–868. Benya, P.D., Shaffer, J.D., 1982. Dedifferentiated chondrocytes reexpress the differentiated collagen phenotype when cultured in agarose gels. Cell 30, 215–224. Bonner-Weir, S., Taneja, M., Weir, G.C., Tatarkiewicz, K., Song, K.H., Sharma, A., O’Neil, J.J., 2000. In vitro cultivation of human islets from expanded ductal tissue. Proc. Natl. Acad. Sci. USA 97, 7999–8004. Bose, B., Shenoy, S.P., Konda, S., Wangikar, P., 2012. Human embryonic stem cell differentiation into insulin secreting -cells for diabetes. Cell Biol. Int. 36, 1013–1020. Chernousov, M.A., Carey, D.J., 2003. AlphaVb8 integrin is a Schwann cell receptor for fibrin. Exp. Cell Res. 291, 514–524. Chun, S.Y., Mack, D.L., Moorefield, E., Oh, S.H., Kwon, T.G., Pettenati, M.J., Yoo, J.J., Coppi, P.D., Atala, A., Soker, S., 2012. Pdx1 and controlled culture conditions induced differentiation of human amniotic fluid-derived stem cells to insulin-producing clusters. J. Tissue Eng. Regen. Med., http://dx.doi.org/10.1002/term.1631 (Epub ahead of print). Catelas, I., Sese, N., Wu, B.M., Dunn, J.C., Helgerson, S., Tawil, B., 2006. Human mesenchymal stem cell proliferation and osteogenic differentiation in fibrin gels in vitro. Tissue Eng. 12, 2385–2396. Czyz, J., Wobus, A., 2001. Embryonic stem cell differentiation: the role of extracellular factors. Differentiation 68, 167–174.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model YTICE-908; No. of Pages 7
ARTICLE IN PRESS L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
de Vos, P., Hamel, A.F., Tatarkiewicz, K., 2000. Considerations for successful transplantation of encapsulated pancreatic islets. Diabetologia 45, 159–173. Dohrmann, C., Gruss, P., Lemaire, L., 2000. Pax genes and the differentiation of hormone-producing endocrine cells in the pancreas. Mech. Dev. 92, 47–54. Ebrahimie, M., Esmaeili, F., Cheraghi, C., Houshmand, F., Shabani, L., Ebrahimie, E., 2014. Efficient and simple production of insulin-producing cells from embryonal carcinoma stem cells using mouse neonate pancreas extract as a natural inducer. PloS ONE 9, e90885. Edlund, H., 1998. Transcribing pancreas. Diabetes 47, 1817–1823. Gabr, M.M., Sobh, M.M., Zakaria, M.M., Refaie, A.F., Ghoneim, M.A., 2008. Transplantation of insulin-producing clusters derived from adult bone marrow stem cells to treat diabetes in rats. Exp. Clin. Transpl. 206, 236–243. Gabr, M.M., Zakaria, M.M., Refaie, A.F., Ismail, A.M., Abou-El-Mahasen, M.A., Ashamallah, S.A., Khater, S.M., El-Halawani, S.M., Ibrahim, R.Y., Uin, G.S., Kloc, M., Calne, R.Y., Ghoneim, M.A., 2013. Insulin-producing cells from adult human bone marrow mesenchymal stem cells control streptozotocin-induced diabetes in nude mice. Cell Transpl. 22, 133–145. Gabr, M.M., El-Far, M.A., Ibrahim, R.Y., El-Halawani, S.M., Ismail, A.M., Zakaria, M.M., Sherry, M.K., Ghoneim, M.A., 2012. Biochemical induction of adult bone marrow hematopeitic stem cells into insulin producing cells. Curr. Top. Biochem. Res. 14, 45–56. Grayson, W.L., Ma, T., Bunnell, B., 2004. Human mesenchymal stem cells tissue development in 3D PET matrices. Biotechnol. Prog. 20, 905–912. Guo, W., Miao, C., Liu, S., Qiu, Z., Li, J., Duan, E., 2009. Efficient differentiation of insulin-producing cells from skin-derived stem cells. Cell Prolif. 42, 49–62. Hammar, E.B., Irminger, J.C., Rickenbach, K., Parnaud, G., Ribaux, P., Bosco, D., Rouiller, D.G., Halban, P.A., 2005. Activation of NF-kB by extracellular matrix is involved in spreading and glucose-stimulated insulin secretion of pancreatic b cells. J. Biol. Chem. 280, 30630–30637. Hebrok, M., 2012. Generating b cells from stem cells-the story so far. Cold Spring Harb. Perspect. Med. 2, a007674. Ianus, A., Holz, G.G., Theise, N.D., Hussain, M.A., 2003. In vivo derivation of glucosecompetent pancreatic endocrine cells from bone marrow without evidence of cell fusion. J. Clin. Invest. 111, 843–850. Kubo, A., Shinozaki, K., Shannon, J.M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H.J., Keller, G., 2004. Development of definitive endoderm from embryonic stem cells in culture. Development 131, 1651–1662. Ku, H.T., Zhang, N., Kubo, A., O’Connor, R., Mao, M., Keller, G., Bromberg, J.S., 2004. Committing embryonic stem cells to early endocrine pancreas in vitro. Stem Cells 22, 1205–1217. Kaneto, H., Matsuoka, T.A., Nakatani, Y., Miyatsuka, T., Matsuhisa, M., Hori, M., Yamasaki, Y., 2005. A crucial role of MafA as a novel th erapeutic target for diabetes. J. Biol. Chem. 280, 15047–15052. Karaoz, E., Aksoy, A., Ayhan, S., Sariboyaci, A.E., Kaymaz, F., Kasap, M., 2009. Characterization of mesenchymal stem cells from rat bone marrow: ultrastructural properties differentiation potential and immunophenotypic markers. Histochem. Cell Biol. 132, 533–546. Lee, K.Y., Mooney, D.J., 2001. Hydrogels for tissue engineering. Chem. Rev. 101, 1869–1879. Levenberg, S., Huang, N.F., Lavik, E., Rogers, A.B., Itskovitz-Eldor, J., Langer, R., 2003. Differentiation of human embryonic stem cells on three-dimensional polymer scaffolds. Proc. Natl. Acad. Sci. USA 100, 12741–12746. Lishko, V.K., Kudryk, B., Yakubenko, V.P., Yee, V.C., Ugarova, T.P., 2002. Regulated unmasking of the cryptic binding site for integrin aM b2 in the g C-domain of fibrinogen. Biochemistry 41, 12 942–12 951. Liu, J., Liu, Y., Wang, H., Hao, H., Han, Q., Shen, J., Shi, J., Li, C., Mu, Y., Han, W., 2013. Direct differentiation of hepatic stem-like WB cells into insulin-producing cells using small molecules. Sci. Rep. 3, 1–8. Lumelsky, N., Blondel, O., Laeng, P., Velasco, I., Ravin, R., McKay, R., 2001. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 292, 1389–1394. Mason, M.N., Arnold, C.A., Mahoney, M.J., 2009. Entrapped collagen type 1 promotes differentiation of embryonic pancreatic precursor cells into glucose-responsive beta-cells when cultured in three-dimensional PEG hydrogels. Tissue Eng. Part A 15, 3799–3808. Mohr, J.C., de Pablo, J.J., Palecek, S.P., 2006. 3-D microwell culture of human embryonic stem cells. Biomaterials 27, 6032–6042. Moradi, F., Haji, M., Kashani, G., Ghorbanian, M.T., Lashkarbolouki, T., 2012. Spontaneous expression of neurotrophic factors and TH, Nurr1, nestin genes in long-term culture of bone marrow mesenchymal stem cells. Cell J. 13, 243–250.
7
Olson, A.L., Pessin, J.E., 1996. Structure function and regulation of the mammalian facilitative glucose transporter gene family. Annu. Rev. Nutr. 16, 235–256. Orazizadeh, M., Fakhredini, F., Mansouri, E., Khorsandi, L., 2014. Effect of glycyrrhizic acid on titanium dioxide nanoparticles-induced hepatotoxicity in rats. Chem. Biol. Interact. 220, 214–221. Pandey, S., 2010. Stem cell transplantation: a future for diabetic paitient. Int. J. Pharm. Sci. Rev. Res. 1, 68–71. Parnaud, G., Hammar, E., Ribaux, P., Donath, M.Y., Berney, T., Halban, P.A., 2009. Signaling pathways implicated in the stimulation of b-cell proliferation by extracellular matrix. Mol. Endocrinol. 23, 1264–1271. Peshavaria, M., Cissell, M.A., Henderson, E., Petersen, H.V., Stein, R., 2000. The PDX1 activation domain provides specific functions necessary for transcriptional stimulation in pancreatic beta-cells. Mol. Endocrinol. 14, 1907–1917. Schmeichel., K.L., Bissell, M.J., 2003. Modeling tissue-specific signaling and organ function in three dimensions. J. Cell Sci. 116, 2377–2388. Soria, B., Roche, E., Berná, G., León-Quinto, T., Reig, J.A., Martín, F., 2000. Insulinsecreting cells derived from embryonic stem cells normalize glycemia in streptozotocin-induced diabetic mice. Diabetes 2000 (49), 157–162. Sosa-Pineda, B., Chowdhury, K., Torres, M., Oliver, G., Gruss, P., 1997. The Pax4 gene is essential for differentiation of insulin-producing beta cells in the mammalian pancreas. Nature 386, 399–402. Speier, S., Gjinovci, A., Charollais, A., Meda, P., Rupnik, M., 2007. Cx36mediated coupling reduces b-cell heterogeneity, confines the stimulating glucose concentration range, and affects insulin release kinetics. Diabetes 56, 1078–1086. St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A., Gruss, P., 1997. Pax6 is required for differentiation of glucagon-producing alpha cells in the mouse pancreas. Nature 387, 406–409. Sun, Y., Chen, L., Hou, X.G., Hou, W.K., Dong, J.J., Sun, L., Tang, K.X., Wang, B., Song, J., Li, H., Wang, K.X., 2007. Differentiation of bone marrow-derived mesenchymal stem cells from diabetic patients into insulin-producing cells in vitro. Chin. Med. J. (Engl) 120, 771–776. Takeuchi, H., Nakatsuji, N., Suemori, H., 2014. Endodermal differentiation of human pluripotent stem cells to insulin-producing cells in 3D culture. Sci. Rep. 4, 4488. Tang, D.Q., Cao, L.Z., Burkhardt, B.R., Xia, C.Q., Litherland, S.A., Atkinson, M.A., Yang, L.J., 2004. In vivo and in vitro characterization of insulin-producing cells obtained from murine bone marrow. Diabetes 53, 1721–1732. Vaithilingam, V., Sundaram, G., Tuch, B.E., 2008. Islet cell transplantation. Curr. Opin. Organ. Transpl. 13, 633–638. von der Mark, K., Gauss, V., von der Mark, H., Muller, P., 1977. Relationship between cell shape and type of collagen synthesised as chondrocytes lose their cartilage phenotype in culture. Nature 267, 531–532. Wakitani, S., Saito, T., Caplan, A.I., 1995. Myogenic cells derived from rat bone marrow mesenchymal stem cells exposed to 5-azacytidine. Muscle Nerve 18, 1417–1426. Wang, X., Ye, K., 2009a. Three-dimensional differentiation of embryonic stem cells into islet-like insulin-producing clusters. Tissue Eng. Part. A 15, 1941–1952. Watt, F.M., Hogan, B.L., 2000. Out of Eden: stem cells and their niches. Science 287, 1427–1430. Wang, H., Brun, T., Kataoka, K., Sharma, A.J., Wollheim, C.B., 2007. MAFA controls genes implicated in insulin biosynthesis and secretion. Diabetologia 50, 348–358. Wang, X., Ye, K., 2009b. Three-dimensional differentiation of embryonic stem cells into islet-like insulin-producing clusters. Tissue Eng. Part A 15, 1941–1952. Weber, L.M., Hayda, K.N., Anseth, K.S., 2008. Cell-matrix interactions improve b-cell survival and insulin secretion in three-dimensional culture. Tissue Eng. Part. A 14, 1959–1968. Weisel, J.W., 2005. Fibrinogen and fibrin. Adv. Protein. Chem. 70, 247–299. Willerth, S.M., Arendas, K.J., Gottlieb, D.I., Sakiyama-Elbert, S.E., 2006. Optimization of fibrin scaffolds for differentiation of murine embryonic stem cells into neural lineage cells. Biomaterials 27, 5990–6003. Yang, L., Li, S., Hatch, H., Ahrens, K., Cornelius, J.G., Petersen, B.E., Peck, A.B., 2002. In vitro transdifferentiation of adult hepatic stem cells into pancreatic endocrine hormoneproducing cells. Proc. Natl. Acad. Sci. USA 99, 8078–8083. Zalzman, M., Anker-Kitai, L., Efrat, S., 2005. Differentiation of human liver-derived, insulin producing cells toward the cell phenotype. Diabetes 54, 2568–2575. Zhao, F.Q., Keating, A.F., 2007. Functional properties and genomics of glucose transporters. Curr. Genomics 8, 113–128. Zhao, L., Guo, M., Matsuoka, T.A., Hagman, D.K., Parazzoli, S.D., Poitout, V., Stein, R., 2005. The islet beta cell-enriched MafA activator is a key regulator of insulin gene transcription. J. Biol. Chem. 280, 11887–11894.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
ARTICLE IN PRESS
YTICE-908; No. of Pages 7
Tissue and Cell xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Tissue and Cell journal homepage: www.elsevier.com/locate/tice
Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells Layasadat Khorsandi a,b,∗ , Fereshteh Nejad-Dehbashi a , Akram Ahangarpour c , Mahmoud Hashemitabar a a
Cell & Molecular Research Center, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran Department of Anatomical Sciences, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran c Diabetes Research Center, Health research institute and Department of Physiology, School of Medicine, Jundishapur University of Medical Sciences, Ahvaz 61335-189, Iran b
a r t i c l e
i n f o
Article history: Received 24 July 2014 Received in revised form 22 November 2014 Accepted 23 November 2014 Available online xxx Keywords: Beta cells 3D culture Fibrine glue Mesenchymal stem cells
a b s t r a c t Fibrin glue (FG) is used in a variety of clinical applications and in the laboratory for localized and sustained release of factors potentially important for tissue engineering. The aim of this study was to evaluate FG scaffold effect on differentiation of insulin-producing cells (IPCs) from bone marrow-derived mesenchymal stem cells (BM-MSCs). In this experimental study BM-MSCs were cultured and the cells characterized by analysis of cell surface markers using flow cytometry. BM-MSCs were seeded in FG scaffold (3D culture) and then treated with induction media. After induction, the presence of IPCs was demonstrated using gene expression profiles for pancreatic cell differentiation markers (PDX-1, GLUT-2 and insulin) and insulin detection in cytoplasm. Release of insulin by these cells was confirmed by radioimmunoassay. Expression of the islet-associated genes PDX-1, GLUT-2 and Insulin genes in 3D cultured cells was markedly higher than the 2D cultured cells exposure differentiation media. Compared to 2D culture of BM-MSCs-derived IPCs, the insulin release from 3D BM-MSCs-derived IPCs showed a nearly 3 fold (p < 0.05) increase when exposed to a high glucose (25 mM) medium. Percentage of insulin positive cells in 3D experimental group showed an approximately 3.5-fold increase in compared to 2D experimental culture cells. The results of this study demonstrated that FG scaffold can enhance the differentiation of IPCs from rats BM-MSCs. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Diabetes mellitus is one of the most common chronic diseases which directly affect millions of people (Pandey, 2010). Type 1 diabetes is caused by autoimmune destruction of the pancreatic islet insulin-producing beta-cells. Insulin administration does not prevent long-term complications of the disease, as the optimal insulin dosage is difficult to adjust. Replacement of the damaged cells with regulated insulin-producing cells is considered the ultimate cure for type 1 diabetes. Transplantation of intact human pancreases or isolated islets has been severely limited by the scarcity of human tissue donors (Zalzman et al., 2005).
∗ Corresponding author at: Cell & Molecular Research Center, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, P. O. Box: 61335, Ahvaz, Iran. Tel.: +98 611 3720458; fax: +98 611 3336380. E-mail addresses: [email protected], khorsandi [email protected] (L. Khorsandi).
Many studies have been focused on how to develop renewable sources of islet-replacement tissue. Whereas some studies have shown the generation of insulin producing cells (IPCs) from progenitor cells of the pancreas (Bonner-Weir et al., 2000), liver (Yang et al., 2002, Liu et al., 2013), pluripotent embryonic stem cells (Lumelsky et al., 2001; Ebrahimie et al., 2014), and skin derived stem cells (Guo et al., 2009), the efficiency of in vitro generated IPCs is low. Ianus et al. (2003) showed that labeled cells from the bone marrow were able to contribute, even if just partially, to the pancreatic endocrine lineage. It has been reported that 3D culture is important for the acquisition of mature IPCs (Takeuchi et al., 2014). A 3D culture is advantageous to imitate the in vivo micro environment by enhancing cell-cell and cell-matrix interactions and subsequent cell signaling (Wang et al., 2007; Grayson et al., 2004; Schmeichel and Bissell, 2003; Mohr et al., 2006) To date, a variety of 3D cell culture systems have been developed and adopted for directing stem cell differentiation into various lineages (Levenberg et al., 2003; Liu et al., 2013; Mohr et al., 2006).
http://dx.doi.org/10.1016/j.tice.2014.11.005 0040-8166/© 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model YTICE-908; No. of Pages 7
ARTICLE IN PRESS L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
2
It has been revealed that biomaterial scaffold can enhance differentiation of various cell types into IPC compared to those differentiated in 2D cultures (Vaithilingam et al., 2008; Wang et al., 2007; Ku et al., 2004; Kubo et al., 2004; Hebrok, 2012). Fibrin glue (FG) is a natural fibrous protein involved in the clotting of blood. FG scaffolds can be engineered as a tissue substitute that is biocompatible and biodegradable (Ahmed et al., 2008). Proliferation and differentiation of the stem cells can be achieved in a fibrin matrix, and fibrin alone or in combination with other materials has been used as scaffolds to regenerate adipose tissue, bone, cartilage, etc. (Ahmed et al., 2008). In this study effect of FG on BM-MSCs differentiation into IPCs was investigated. 2. Materials and methods 2.1. Isolation of BM-MSCs This study was approved by the ethics committee of Ahvaz Jundishapur University of Medical Sciences. BM-MSCs cultures were prepared under sterile conditions. Briefly, the femur and tibiae of the Wistar rats were excised with special attention given to remove all connective tissue attached to bones. Bone marrow was extruded from these bones by flushing the BM cavity using a syringe with 20-gauge needle filled with culture medium (DMEM) supplemented with 10% fetal calf serum (FCS). The harvested BM-MSCs were gently pipetted to break up cell clumps in order to obtain cell suspension. After a homogenous cell suspension was achieved, the cells were centrifuged at 1200 rpm for 7 min and the cell pellet was resuspended in 3 ml of culture medium. The cell suspension was seeded in 25 cm plastic tissue culture flasks with 5 ml culture medium and maintained at 37◦ C in a humidified atmosphere with 5% CO2 . Cultures of BM-MSCs were inspected and refed every 3 days and passaged when the BM-MSCs have reached approximately 80% confluence. The mesenchymal population was isolated on the basis of its ability to adhere to the culture plate (Moradi et al., 2012; Wakitani et al., 1995; Barbash et al., 2003). Expression of cell surface markers on the BM-MSCs culture prior to use of differentiation media were analyzed using flow cytometry. The cells were characterized with regard to a set of markers characteristic for BM-MSCs including CD44, CD105, CD45 and CD34 (Karaoz et al., 2009). 2.2. Experimental design The BM-MSCs at passages three were used in this experiment. Four groups including two controls and two experimental groups were formed. The cells were cultured in DMEM as 2D control group. The seeded cells onto the FG scaffolds were cultured in DMEM and used as 3D control group. The cultured cells in IPC differentiation media used as 2D experimental group. The seeded cells onto the FG scaffolds were cultured in IPC differentiation media and used as 3D experimental group. A three-stage protocol was used to induce IPC. Stage 1: The cells (1 × 105/ml) were cultured (37 ◦ C, 5% CO2 ) in serum-free high glucose DMEM (25 mmol/L) containing 0.5 mmol/L betamercaptoethanol (Invitrogen) for 2 days. Stage 2: The cells then were cultured in the medium containing 1% non-essential amino acids (Invitrogen), 20 ng/ml fibroblast growth factor (FGF, SigmaAldrich), 20 ng/ml epidermal growth factor (EGF, Sigma-Aldrich), 2% B27 (Invitrogen), 2 mmol/L l-glutamine and 10 ng/ml exendine4 (Sigma) in 6-well plates for 8 days. Stage 3: The cells were cultured for an additional 8 days in new medium containing 10 ng/ml betacellulin, 10 ng/ml activin A, 2% B27, 10 mmol/L nicotinamide and 10 ng/ml exendine-4 (Sun et al., 2007).
Table 1 Sequences of genes. Gene
PDX-1 GLUT-2 Insulin Glucagon Somatostatin PAX-4 MafA -Actin GAPDH
Sequences Forward
Reverse
AAACGCCACACACAAGGAGAA CAGCTGTCTCTGTGCTGCTTGT TCTTCTACACACCCATGTCCC GTAATGCTGGTACAAGGCAG CTGCATCGTCCTGGCTTTGG TGGCTTTCTGTCCTTCTGTGA CTTCAGCAAGGAGGAGGTCAT ACCTGACAGACTACCTCATG CTCTGGTGGACCTCATGGCCTAC
AGACCTGGCGGTTCACATG GCCGTCATGCTCACATAACTCA GGTGCAGCACTGATCCAC CCAGTTGATGAAGTCTCTGG TGCAGCCAGCTTTGCGTTCC TCCAAGACTCCTGTGCGGTAG GCGTAGCCGCGGTTCTT ATCGTACTCCTGCTTGCTGA CAGCAACTGAGGGCCTCTCT
2.3. 3D culture FG scaffolds (total volume: 400 l) were made by combining fibrinogen (from bovine plasma) at a concentration of 10 mg/ml, 2.5 mM CaCl2 , and 2 NIH units/ml of thrombin (all from Sigma except where indicated). The scaffold was characterized by SEM (Willerth et al., 2006). Scaffolds were prewetted overnight (approximately 12 h) at 4 ◦ C in culture medium consisting of DMEM supplemented with 10% FCS, 100 U/ml penicillin, 10 g/ml streptomycin, and 0.1 mm nonessential amino acids. Following trypsinization, BM-MSCs at passage 3 (1–1.5 × 106 cells/scaffold) were resuspended into 200 l of culture medium and were seeded onto the FG scaffolds, and maintained for 3 days. The cell seeded scaffolds were then incubated in the IPC media. 2.4. Scanning electron microscopy (SEM) Unseeded and seeded scaffolds were fixed with 2.5% glutaraldehyde buffered in 0.15 mol/L sodium cacodylate (pH 7.2, 20 ◦ C, 1 h). After fixation, the cultures were repeatedly rinsed in cacodylate buffer. The cultures were dehydrated in a graded series of ethanol (50%, 70%, 95% and 100% alcohol) prior to critical point drying. The preparations were sputter-coated with gold-palladium before SEM. 2.5. Real-time polymerase chain reaction Using the RNeasy Mini kit (Qiagen), RNA was isolated from the harvest cells according to manufacturer’s instructions. cDNA was produced from the extracted RNAs using the cDNA synthesis kit based on the manufacturer’s instructions (Fermentas, Canada). Primer sequences are shown in Table 1. Approximately 2 l of cDNA was amplified in each 25 l PCR reaction mix containing 12.5 l of 2 × SYBR Green Master Mix (Fermentas, Canada), 0.2 l of each 10 pmol forward and reverse primers (designed in primer 3 software, Table 1) and 10.1 l DEPC water. PCR amplification was done in 40 cycles using the following program: 95 ◦ C for 10 min, 95 ◦ C for 15 s, 5 ◦ C for 30 s and 60 ◦ C for 34 s. Data were analyzed using the 2−CT method. Gene expression in IPCs was normalized either to undifferentiated BM-MSCs or adult rat islets. Expression values were corrected for the housekeeping gene -actin (Ebrahimie et al., 2014). 2.6. Radioimmunoassay (RIA) The differentiated cells were plated in 24-well plates at 105 cells per well. The cells were preincubated for 1 h in glucose-free Krebs-Ringer bicarbonate (KRB), and incubated with KRB containing 5.56 mmol/L, 16.7 mmol/L and 25 mmol/L of glucose (glucose challenge) for an additional 1 h, respectively. The KRB media were collected and frozen at −80 ◦ C until assay (Gabr et al., 2012). Insulin assay was performed by RIA using a commercially available rat RIA kit (Millipore) according to the manufacturer’s instructions.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model
ARTICLE IN PRESS
YTICE-908; No. of Pages 7
L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
3
Fig. 1. Characterization of the different surface markers including: CD34, CD45, CD44 and CD105. High expression of CD44 and CD105, low expression of CD34 and no expression of CD45 are shown. Gray and white histograms showed control and cell surface markers.
Determinations were carried out in triplicate and the means and standard deviations were obtained. 2.7. Immunofluorescent staining Both cell seeded and unseeded scaffolds were fixed in 10% buffered formalin, dehydrated, embedded in paraffin and cut into 4 m sections. Paraffin sections were dewaxed in xylene, hydrated, boiled for 15 min in a microwave oven in 10 mmol/L sodium citrate, pH 6, for antigen retrieval. The cells were blocked with normal goat serum in PBS for 1 h at room temperature. Anti-insulin primary antibody (H-86: sc-9168, Santa Cruz) was diluted 1:200 in PBS and incubated overnight at 4 ◦ C. The cells were rinsed three times with PBS and then incubated with fluorescence-labeled specific secondary antibody diluted in PBS with 0.5% BSA at 37 ◦ C for 50 min. After washing, cells were incubated with DAPI (4 , 6-diamidino2-phenylindole) at dilution 1:1000 in PBS for 10 min. 2D cultures were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.1% Triton X-100/PBS for 10 min at room temperature. The cells were blocked for 30 min in PBS plus 0.2% Triton X-100,
1% bovine serum albumin (BSA). Anti-insulin primary antibody (H86: sc-9168, Santa Cruz) was diluted 1:200 in PBS and incubated overnight at 4 ◦ C. The cells were rinsed three times with PBS and then incubated with fluorescence-labeled specific secondary antibody diluted in PBS with 0.5% BSA at 37 ◦ C for 50 min. After washing, cells were incubated with DAPI for 10 min (Liu et al., 2013). Images were captured using an Olympus BX51 phase contrast fluorescent microscope (Olympus). The percentage of insulin-positive cells were calculated by dividing the number of Insulin-positive cells in a randomly microscopy field by the total number of cells in that field, and the result was multiplied by 100. There were at least three slides for different groups. Ten randomly field were evaluated for each slide (Orazizadeh et al., 2014).
2.8. Statistical analysis A two-tailed Student’s t-test was used for comparing the obtained values. For statistical purposes at least three independent cultures were considered. All values stated as means ± standard
Fig. 2. Morphological changes in 2D culture. (A) BM-MSCs in DMEM. (B) BM-MSCs in IPC differentiation media.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model YTICE-908; No. of Pages 7
ARTICLE IN PRESS L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
4
deviations. A p value p < 0.05 was considered to be statistically significant. 3. Results 3.1. Flow cytometry Cell surface markers detected by flow cytometry revealed that BM-MSCs highly expressed CD105 and CD44, whereas no expression of CD34, CD45 was detected (Fig. 1). 3.2. 2D culture Under an inverted microscope, BM-MSCs were typical of adherent spindle and fibrocyte-like at passage 3. The BM-MSCs cultured in undifferentiating media (control 2D group) showed various shapes including spherical, neuron-like cells or glial-like cells (Fig. 2A). Under differentiation media, the BM-MSCs formed spherical type with confluence (Fig. 2B). 3.3. 3D culture SEM studies indicated that the spongy scaffold possessed numerous interconnected pores. BM-MSCs formed continuous sheets of the cells that filled the interconnected pores of the FG scaffolds in both control and experimental 3D culture groups. In control group the morphologies of BM-MSCs were flat and elongated while the cells in differentiation media showed round-shaped morphology (Fig. 3). 3.4. Gene expression To determine whether the BM-MSCs had undergone pancreatic differentiation, gene expression profiles for pancreatic cell differentiation markers were assessed using real time RT-PCR. Since gene expression analysis showed no significant differences between the two controls, all data were combined into one control group. As illustrated in Fig. 4, low expression of PDX-1, GLUT-2, somatostatin, glucagon and insulin was detected in undifferentiated BM-MSCs (Control). Expression of PDX-1, GLUT-2, Pax-4, MafA and insulin genes was significantly increased in 2D culture of BMMSCs-derived IPCs. High expression of these genes was observed in FG seeded differentiated cells. Compared to 2D culture of BM-MSCs-derived IPCs, the expression of PDX-1 GLUT-2, insulin, MafA and Pax-4 genes in 3D BM-MSCs-derived IPCs showed a nearly 2.4 fold, 2.3 fold, 3 fold, 2.4 fold and 2.2 fold (p < 0.05) increases respectively. Somatostatin and glucagon were not expressed in both 2D and 3D experimental groups. 3.5. Insulin release in response to glucose stimulation The cultured BM-MSCs in control groups showed very low levels of insulin in the presence or absence of glucose challenge. Since RIA analysis showed no significant differences between the two controls, all data were combined into one control group. The 2D culture of BM-MSCs-derived IPCs could release insulin in a low concentration of glucose (5.56 mmol/L) and release approximately 20 fold insulin under glucose challenge (25 mmol/L) (p < 0.01). Insulin secretion of 3D culture of BM-MSCs-derived IPCs was significantly increased in a low concentration of glucose (2 fold) and under glucose challenge (3 fold) compared to 2D culture of BM-MSCs-derived IPCs (p < 0.01). These results are shown in Fig. 5.
Fig. 3. Morphological changes in 3D culture. (A) Unseeded scaffold; (B) FG encapsulated-BM-MSCs in DMEM. Spindle-shape morphology are observed; (C) FG encapsulated-BM-MSCs in IPC differentiation media. Clusters of round-shaped morphology are observed.
3.6. Immunofluorescence staining Expression of insulin proteins was represented as green color in the immunofluorescence assay (Fig. 3). No expression of insulin was observed in both 2D and 3D control groups. In 2D experimental culture group, there was a marked increase in the percentage of the insulin positive cells (25%). In 3D experimental culture group, the percentage of insulin expressing cells was significantly increased (∼3.5 fold) in compare to 2D experimental group. These results are shown in Figs. 6 and 7.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model YTICE-908; No. of Pages 7
ARTICLE IN PRESS L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
Fig. 4. Gene expression in various groups. Expression normalized to average of housekeeping gene (-actin). Values are expressed as mean ± SD. * p < 0.001, † p < 0.001, * and † symbols respectively indicate comparison to control and 2D IPCs.
Fig. 5. Insulin secretion changes in various groups. Values are expressed as mean ± SD. * p < 0.001, † p < 0.01, †† p < 0.001, * and † symbols respectively indicate comparison to control and 2D IPCs.
4. Discussion The results of this study have demonstrated that 3D culture by using FG can effectively enhance differentiation of BM-MSCs into IPCs. The existence of IPCs was confirmed by expression pattern analysis of islet-specific genes and insulin synthesis and secretion. Gabr et al. (2008) showed that IPCs derived from adult rat BM-MSCs expressed insulin and endocrine-specific transcription genes. They transplanted the IPCs into the testes of diabetic rats, the differentiated cells could normalize blood glucose levels for 3 months in 80% of the treated rats. In another study, Gabr et al. (2013) showed that differentiated IPCs from human BM-MSCs expressed transcription factors and genes of pancreatic hormones similar to those
5
Fig. 7. Percentage of insulin-positive cells in various groups. Values are expressed as mean ± SD. * p < 0.001, † p < 0.001, * and † symbols respectively indicate comparison to control and 2D IPCs.
expressed by pancreatic islets. At the end of differentiation, ∼5–10% of cells were immunofluorescent stained for insulin. They reported that transplantation of IPCs into nude diabetic mice resulted in control of their diabetic status for 3 months. They concluded that optimization of the culture conditions are required to improve the yield of IPCs and their functional performance. In this study, the expression of PDX-1 in 3D culture of BMMSCs-derived IPCs was markedly increased in compare to 2D culture of BM-MSCs-derived IPCs. PDX is a pancreatic homeoprotein that is critical for the development of both the endocrine and exocrine pancreas, and it mediates glucose-responsive stimulation of insulin gene transcription (Edlund, 1998). PDX-1 plays a crucial role in the control of several genes expressed in the pancreas. Chun et al. (2012) demonstrated that PDX-1-transduced human amniotic fluid-derived stem cells encapsulated in alginate effectively differentiates to insulin-producing clusters. PDX1 is the first molecular marker identified in the gut region when the foregut endoderm becomes committed to the pancreatic linage. In mature beta-cells, PDX-1 transactivates the insulin gene and other genes involved in glucose sensing and metabolism, such as GLUT-2 and glucokinase (Peshavaria et al., 2000). High expression of insulin and GLUT-2 genes in 3D culture of BM-MSCs-derived IPCs was also shown in present study. It has been reported that expression of these genes indicates differentiation and fully functional IPCs. In pancreatic beta-cells, the glucose uptake is controlled by GLUT-2 (Olson and Pessin, 1996). The ability of beta-cells to release insulin in response to changes in glucose concentration is dependent, in part, on the presence of GLUT-2 transporters in the cell membrane. GLUT-2 transporters are therefore used as a marker for beta-cell maturity (Zhao and Keating, 2007).
Fig. 6. Immunofluorescence analysis of insulin. (A) Control group, BM-MSCs in DMEM. (B) BM-MSCs in IPC differentiation media. Weak or moderate immune-reactivity is observed in the cytoplasm of differentiated cells. (C) FG encapsulated-IPCs differentiation media. The cells show strong immune-staining in their cytoplasm. (Insulin stain: green; DAPI stain: blue). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model YTICE-908; No. of Pages 7 6
ARTICLE IN PRESS L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
Expression of MafA was significantly increased in 3D BM-MSCsderived IPCs. MafA is a transactivator of the insulin promoter. Recently, it was demonstrated that MafA knockout mice develop age-dependent diabetes. At birth, islets of the MafA knockout mice are morphologically normal, but with age, the mice display impaired glucose-stimulated insulin secretion and abnormal islet architecture. They also exhibit reduction of insulin and GLUT-2 expression (Zhao et al., 2005). Roles of MafA in beta-cell functions are also shown by studies of MafA overexpression in betaand non beta-cell lines. MafA seems to regulate not only insulin gene expression but also other genes involved in beta-cell functions, such as insulin biosynthesis, insulin secretion and glucose metabolism (Kaneto et al., 2005; Wang et al., 2007). Expression of Pax-4 was also significantly increased in 3D BMMSCs-derived IPCs. Analysis of Pax4 knock-out mice has revealed its important roles in the differentiation of specific endocrine cell lineages during pancreas development (Sosa-Pineda et al., 1997; St-Onge et al., 1997; Dohrmann et al., 2000). The Pax4 knockout mice do not generate insulin-producing beta-cells in the pancreas. The present study has also detected insulin, glucagon and somatostatine gene expression in non-induced cells (control), which indicated that BM-MSCs could spontaneously differentiate into various islet-like cells. As shown in results, RIA analysis demonstrated significant increase in secretion of insulin upon glucose challenge in 3D BMMSCs-derived IPCs in compared to 2D BM-MSCs-derived IPCs. This finding indicates that more mature insulin-producing cells can be generated from BM-MSCs in 3D cultures. Wang and Ye (2009a,b) reported that compared to 2D embryonic stem cell-derived IPCs, the insulin release from 3D embryonic stem cell-derived IPCs showed a nearly 5-fold increase when exposed to a high glucose medium. In this study, 3D BM-MSCsderived IPCs showed 3-fold increase in the insulin release compared to 2D culture of BM-MSCs-derived IPCs. Among candidate cells for tissue regeneration, embryonic stem cells possess ethical issues limiting their application in tissue regeneration. Additionally, some reports have indicated that transplantation of embryonic stem cells has led to teratoma formation in the animal model (Benya and Shaffer, 1982; von der Mark et al., 1977). About 83% of cells in 3D culture show insulin in their cytoplasm. Presence of immunostainable insulin demonstrates that the BM-MSCs-derived IPCs are capable of storing insulin. More interestingly, they not only produced insulin but also could secret insulin in response to different concentrations of glucose stimulation in a regulated manner. Mason et al. (2009) showed that polyethylene glycol/Col promotes differentiation of a glucose-responsive betacell population from dissociated precursor cells. About 1% of the cells showed insulin in their cytoplasm. Aloysious and Nair (2014) fabricated a 3D biodegradable scaffold comprised of natural polymers dextran and gelatin for differentiation of adipose stem cells to islet-like clusters. Insulin secretion in response to glucose challenge of IPCs on the scaffold was significantly higher than the 2D culture. Bose et al. (2012) have demonstrated presence of almost 65% of IPCs from human embryonic stem cell in 3D clusters. The exact mechanism of FG scaffold on IPCs differentiation from BM-MSCs is not obtained from this study. It has been revealed that the nascent endocrine cells migrate from the branched epithelium into the surrounding mesenchyme to form the islets of Langerhans during the pancreatic development. Thus, it is highly desirable to grow the cells within three-dimensional (3D) scaffolds to allow the formation of adequate extracellular matrix for cell proliferation, migration, and interaction with each other. It has been well documented that not only temporal synthesis but also spatial distribution of signal factors within extracellular matrix affects the lineage-specific differentiation of stem cells (Watt and Hogan, 2000; Czyz and Wobus, 2001). Extracellular interactions have been
shown to optimize beta-cell functions and proliferation (Hammar et al., 2005; Weber et al., 2008; Parnaud et al., 2009). In addition, 3D culture conditions are likely to strengthen interactions between beta-cells and could enhance insulin secretory dynamics that may be directly affected by electrical coupling between insulin-producing cells (Speier et al., 2007). Fibrin is a passive cell delivery matrix that it binds specifically many growth factors (Weisel, 2005; Lishko et al., 2002; Chernousov and Carey, 2003). This bioactivity makes fibrin an attractive matrix for stem cell differentiation and tissue engineering (Catelas et al., 2006; Willerth et al., 2006). FG has been utilized to engineer tissues with skeletal muscle cells, smooth muscle cells, and chondrocytes (Lee and Mooney, 2001). This study showed that FG scaffold can enhance the differentiation of IPCs from rats BM-MSCs, but future in vivo studies are needed to establish the clinical and prognostic potential of this IPCs-encapsulated within diabetes. It has been reported that implantation of IPCs-encapsulated close to blood vessels can be effectively reduce blood glucose in animal models of diabetes. (de Vos et al., 2000) FG encapsulated-IPCs can be successfully implanted in different sites such as such as the spleen (Soria et al., 2000) and the renal capsule (Tang et al., 2004). Implantation of IPCsencapsulated in close contact with the blood stream induces good survival and is essential for clinical application. 5. Conclusion In summary, the results of this study demonstrated that FG scaffold can enhance the differentiation of IPCs from rats BMMSCs. Future experiments will need to be performed to determine whether 2D versus 3D conditions have intrinsic benefits in generating fully matured beta-cells from human stem cell populations. Additionally, future in vivo studies are needed to establish the clinical potential of FG encapsulated-IPCs within diabetes. Acknowledgments The financial cost of this project has been provided by the research council of theAhvaz Jundishapur University of Medical Sciences (Grant number: CMRC-50). References Ahmed, T.A., Dare, E.V., Hincke, M., 2008. Fibrin: a versatile scaffold for tissue engineering applications. Tissue Eng. B 14, 199–215. Aloysious, N., Nair, P.D., 2014. Enhanced survival and function of islet-like clusters differentiated from adipose stem cells on a three-dimensional natural polymeric scaffold: an in vitro study. Tissue Eng. Part A 20, 1508–1522. Barbash, I.M., Chouraqui, P., Baron, J., Feinberg, M.S., Etzion, S., Tessone, A., Miller, L., Guetta, E., Zipori, D., Kedes, L.H., Kloner, R.A., Leor, J., 2003. Systemic delivery of bone marrow-derived mesenchymal stem cells to the infarcted myocardium: feasibility, cell migration, and body distribution. Circulation 108, 863–868. Benya, P.D., Shaffer, J.D., 1982. Dedifferentiated chondrocytes reexpress the differentiated collagen phenotype when cultured in agarose gels. Cell 30, 215–224. Bonner-Weir, S., Taneja, M., Weir, G.C., Tatarkiewicz, K., Song, K.H., Sharma, A., O’Neil, J.J., 2000. In vitro cultivation of human islets from expanded ductal tissue. Proc. Natl. Acad. Sci. USA 97, 7999–8004. Bose, B., Shenoy, S.P., Konda, S., Wangikar, P., 2012. Human embryonic stem cell differentiation into insulin secreting -cells for diabetes. Cell Biol. Int. 36, 1013–1020. Chernousov, M.A., Carey, D.J., 2003. AlphaVb8 integrin is a Schwann cell receptor for fibrin. Exp. Cell Res. 291, 514–524. Chun, S.Y., Mack, D.L., Moorefield, E., Oh, S.H., Kwon, T.G., Pettenati, M.J., Yoo, J.J., Coppi, P.D., Atala, A., Soker, S., 2012. Pdx1 and controlled culture conditions induced differentiation of human amniotic fluid-derived stem cells to insulin-producing clusters. J. Tissue Eng. Regen. Med., http://dx.doi.org/10.1002/term.1631 (Epub ahead of print). Catelas, I., Sese, N., Wu, B.M., Dunn, J.C., Helgerson, S., Tawil, B., 2006. Human mesenchymal stem cell proliferation and osteogenic differentiation in fibrin gels in vitro. Tissue Eng. 12, 2385–2396. Czyz, J., Wobus, A., 2001. Embryonic stem cell differentiation: the role of extracellular factors. Differentiation 68, 167–174.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
G Model YTICE-908; No. of Pages 7
ARTICLE IN PRESS L. Khorsandi et al. / Tissue and Cell xxx (2014) xxx–xxx
de Vos, P., Hamel, A.F., Tatarkiewicz, K., 2000. Considerations for successful transplantation of encapsulated pancreatic islets. Diabetologia 45, 159–173. Dohrmann, C., Gruss, P., Lemaire, L., 2000. Pax genes and the differentiation of hormone-producing endocrine cells in the pancreas. Mech. Dev. 92, 47–54. Ebrahimie, M., Esmaeili, F., Cheraghi, C., Houshmand, F., Shabani, L., Ebrahimie, E., 2014. Efficient and simple production of insulin-producing cells from embryonal carcinoma stem cells using mouse neonate pancreas extract as a natural inducer. PloS ONE 9, e90885. Edlund, H., 1998. Transcribing pancreas. Diabetes 47, 1817–1823. Gabr, M.M., Sobh, M.M., Zakaria, M.M., Refaie, A.F., Ghoneim, M.A., 2008. Transplantation of insulin-producing clusters derived from adult bone marrow stem cells to treat diabetes in rats. Exp. Clin. Transpl. 206, 236–243. Gabr, M.M., Zakaria, M.M., Refaie, A.F., Ismail, A.M., Abou-El-Mahasen, M.A., Ashamallah, S.A., Khater, S.M., El-Halawani, S.M., Ibrahim, R.Y., Uin, G.S., Kloc, M., Calne, R.Y., Ghoneim, M.A., 2013. Insulin-producing cells from adult human bone marrow mesenchymal stem cells control streptozotocin-induced diabetes in nude mice. Cell Transpl. 22, 133–145. Gabr, M.M., El-Far, M.A., Ibrahim, R.Y., El-Halawani, S.M., Ismail, A.M., Zakaria, M.M., Sherry, M.K., Ghoneim, M.A., 2012. Biochemical induction of adult bone marrow hematopeitic stem cells into insulin producing cells. Curr. Top. Biochem. Res. 14, 45–56. Grayson, W.L., Ma, T., Bunnell, B., 2004. Human mesenchymal stem cells tissue development in 3D PET matrices. Biotechnol. Prog. 20, 905–912. Guo, W., Miao, C., Liu, S., Qiu, Z., Li, J., Duan, E., 2009. Efficient differentiation of insulin-producing cells from skin-derived stem cells. Cell Prolif. 42, 49–62. Hammar, E.B., Irminger, J.C., Rickenbach, K., Parnaud, G., Ribaux, P., Bosco, D., Rouiller, D.G., Halban, P.A., 2005. Activation of NF-kB by extracellular matrix is involved in spreading and glucose-stimulated insulin secretion of pancreatic b cells. J. Biol. Chem. 280, 30630–30637. Hebrok, M., 2012. Generating b cells from stem cells-the story so far. Cold Spring Harb. Perspect. Med. 2, a007674. Ianus, A., Holz, G.G., Theise, N.D., Hussain, M.A., 2003. In vivo derivation of glucosecompetent pancreatic endocrine cells from bone marrow without evidence of cell fusion. J. Clin. Invest. 111, 843–850. Kubo, A., Shinozaki, K., Shannon, J.M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H.J., Keller, G., 2004. Development of definitive endoderm from embryonic stem cells in culture. Development 131, 1651–1662. Ku, H.T., Zhang, N., Kubo, A., O’Connor, R., Mao, M., Keller, G., Bromberg, J.S., 2004. Committing embryonic stem cells to early endocrine pancreas in vitro. Stem Cells 22, 1205–1217. Kaneto, H., Matsuoka, T.A., Nakatani, Y., Miyatsuka, T., Matsuhisa, M., Hori, M., Yamasaki, Y., 2005. A crucial role of MafA as a novel th erapeutic target for diabetes. J. Biol. Chem. 280, 15047–15052. Karaoz, E., Aksoy, A., Ayhan, S., Sariboyaci, A.E., Kaymaz, F., Kasap, M., 2009. Characterization of mesenchymal stem cells from rat bone marrow: ultrastructural properties differentiation potential and immunophenotypic markers. Histochem. Cell Biol. 132, 533–546. Lee, K.Y., Mooney, D.J., 2001. Hydrogels for tissue engineering. Chem. Rev. 101, 1869–1879. Levenberg, S., Huang, N.F., Lavik, E., Rogers, A.B., Itskovitz-Eldor, J., Langer, R., 2003. Differentiation of human embryonic stem cells on three-dimensional polymer scaffolds. Proc. Natl. Acad. Sci. USA 100, 12741–12746. Lishko, V.K., Kudryk, B., Yakubenko, V.P., Yee, V.C., Ugarova, T.P., 2002. Regulated unmasking of the cryptic binding site for integrin aM b2 in the g C-domain of fibrinogen. Biochemistry 41, 12 942–12 951. Liu, J., Liu, Y., Wang, H., Hao, H., Han, Q., Shen, J., Shi, J., Li, C., Mu, Y., Han, W., 2013. Direct differentiation of hepatic stem-like WB cells into insulin-producing cells using small molecules. Sci. Rep. 3, 1–8. Lumelsky, N., Blondel, O., Laeng, P., Velasco, I., Ravin, R., McKay, R., 2001. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 292, 1389–1394. Mason, M.N., Arnold, C.A., Mahoney, M.J., 2009. Entrapped collagen type 1 promotes differentiation of embryonic pancreatic precursor cells into glucose-responsive beta-cells when cultured in three-dimensional PEG hydrogels. Tissue Eng. Part A 15, 3799–3808. Mohr, J.C., de Pablo, J.J., Palecek, S.P., 2006. 3-D microwell culture of human embryonic stem cells. Biomaterials 27, 6032–6042. Moradi, F., Haji, M., Kashani, G., Ghorbanian, M.T., Lashkarbolouki, T., 2012. Spontaneous expression of neurotrophic factors and TH, Nurr1, nestin genes in long-term culture of bone marrow mesenchymal stem cells. Cell J. 13, 243–250.
7
Olson, A.L., Pessin, J.E., 1996. Structure function and regulation of the mammalian facilitative glucose transporter gene family. Annu. Rev. Nutr. 16, 235–256. Orazizadeh, M., Fakhredini, F., Mansouri, E., Khorsandi, L., 2014. Effect of glycyrrhizic acid on titanium dioxide nanoparticles-induced hepatotoxicity in rats. Chem. Biol. Interact. 220, 214–221. Pandey, S., 2010. Stem cell transplantation: a future for diabetic paitient. Int. J. Pharm. Sci. Rev. Res. 1, 68–71. Parnaud, G., Hammar, E., Ribaux, P., Donath, M.Y., Berney, T., Halban, P.A., 2009. Signaling pathways implicated in the stimulation of b-cell proliferation by extracellular matrix. Mol. Endocrinol. 23, 1264–1271. Peshavaria, M., Cissell, M.A., Henderson, E., Petersen, H.V., Stein, R., 2000. The PDX1 activation domain provides specific functions necessary for transcriptional stimulation in pancreatic beta-cells. Mol. Endocrinol. 14, 1907–1917. Schmeichel., K.L., Bissell, M.J., 2003. Modeling tissue-specific signaling and organ function in three dimensions. J. Cell Sci. 116, 2377–2388. Soria, B., Roche, E., Berná, G., León-Quinto, T., Reig, J.A., Martín, F., 2000. Insulinsecreting cells derived from embryonic stem cells normalize glycemia in streptozotocin-induced diabetic mice. Diabetes 2000 (49), 157–162. Sosa-Pineda, B., Chowdhury, K., Torres, M., Oliver, G., Gruss, P., 1997. The Pax4 gene is essential for differentiation of insulin-producing beta cells in the mammalian pancreas. Nature 386, 399–402. Speier, S., Gjinovci, A., Charollais, A., Meda, P., Rupnik, M., 2007. Cx36mediated coupling reduces b-cell heterogeneity, confines the stimulating glucose concentration range, and affects insulin release kinetics. Diabetes 56, 1078–1086. St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A., Gruss, P., 1997. Pax6 is required for differentiation of glucagon-producing alpha cells in the mouse pancreas. Nature 387, 406–409. Sun, Y., Chen, L., Hou, X.G., Hou, W.K., Dong, J.J., Sun, L., Tang, K.X., Wang, B., Song, J., Li, H., Wang, K.X., 2007. Differentiation of bone marrow-derived mesenchymal stem cells from diabetic patients into insulin-producing cells in vitro. Chin. Med. J. (Engl) 120, 771–776. Takeuchi, H., Nakatsuji, N., Suemori, H., 2014. Endodermal differentiation of human pluripotent stem cells to insulin-producing cells in 3D culture. Sci. Rep. 4, 4488. Tang, D.Q., Cao, L.Z., Burkhardt, B.R., Xia, C.Q., Litherland, S.A., Atkinson, M.A., Yang, L.J., 2004. In vivo and in vitro characterization of insulin-producing cells obtained from murine bone marrow. Diabetes 53, 1721–1732. Vaithilingam, V., Sundaram, G., Tuch, B.E., 2008. Islet cell transplantation. Curr. Opin. Organ. Transpl. 13, 633–638. von der Mark, K., Gauss, V., von der Mark, H., Muller, P., 1977. Relationship between cell shape and type of collagen synthesised as chondrocytes lose their cartilage phenotype in culture. Nature 267, 531–532. Wakitani, S., Saito, T., Caplan, A.I., 1995. Myogenic cells derived from rat bone marrow mesenchymal stem cells exposed to 5-azacytidine. Muscle Nerve 18, 1417–1426. Wang, X., Ye, K., 2009a. Three-dimensional differentiation of embryonic stem cells into islet-like insulin-producing clusters. Tissue Eng. Part. A 15, 1941–1952. Watt, F.M., Hogan, B.L., 2000. Out of Eden: stem cells and their niches. Science 287, 1427–1430. Wang, H., Brun, T., Kataoka, K., Sharma, A.J., Wollheim, C.B., 2007. MAFA controls genes implicated in insulin biosynthesis and secretion. Diabetologia 50, 348–358. Wang, X., Ye, K., 2009b. Three-dimensional differentiation of embryonic stem cells into islet-like insulin-producing clusters. Tissue Eng. Part A 15, 1941–1952. Weber, L.M., Hayda, K.N., Anseth, K.S., 2008. Cell-matrix interactions improve b-cell survival and insulin secretion in three-dimensional culture. Tissue Eng. Part. A 14, 1959–1968. Weisel, J.W., 2005. Fibrinogen and fibrin. Adv. Protein. Chem. 70, 247–299. Willerth, S.M., Arendas, K.J., Gottlieb, D.I., Sakiyama-Elbert, S.E., 2006. Optimization of fibrin scaffolds for differentiation of murine embryonic stem cells into neural lineage cells. Biomaterials 27, 5990–6003. Yang, L., Li, S., Hatch, H., Ahrens, K., Cornelius, J.G., Petersen, B.E., Peck, A.B., 2002. In vitro transdifferentiation of adult hepatic stem cells into pancreatic endocrine hormoneproducing cells. Proc. Natl. Acad. Sci. USA 99, 8078–8083. Zalzman, M., Anker-Kitai, L., Efrat, S., 2005. Differentiation of human liver-derived, insulin producing cells toward the cell phenotype. Diabetes 54, 2568–2575. Zhao, F.Q., Keating, A.F., 2007. Functional properties and genomics of glucose transporters. Curr. Genomics 8, 113–128. Zhao, L., Guo, M., Matsuoka, T.A., Hagman, D.K., Parazzoli, S.D., Poitout, V., Stein, R., 2005. The islet beta cell-enriched MafA activator is a key regulator of insulin gene transcription. J. Biol. Chem. 280, 11887–11894.
Please cite this article in press as: Khorsandi, L., et al., Three-dimensional differentiation of bone marrow-derived mesenchymal stem cells into insulin-producing cells. Tissue Cell (2014), http://dx.doi.org/10.1016/j.tice.2014.11.005
