Folia Microbiol (2014) 59:433–438 DOI 10.1007/s12223-014-0317-3

Evaluation of molecular markers for the diagnosis of Mycobacterium bovis Mariana Lázaro Sales & Antônio Augusto Fonseca Jr. & Érica Bravo Sales & Ana Cláudia Pinto Cottorello & Marina Azevedo Issa & Mikael Arrais Hodon & Paulo Martins Soares Filho & Alberto Knust Ramalho & Marcio Roberto Silva & Andrey Pereira Lage & Marcos Bryan Heinemann

Received: 11 July 2013 / Accepted: 8 April 2014 / Published online: 18 April 2014 # Institute of Microbiology, Academy of Sciences of the Czech Republic, v.v.i. 2014

Abstract Mycobacterium tuberculosis complex (MTC) comprises a group of bacteria that have a high degree of genetic similarity. Two species in this group, Mycobacterium tuberculosis and Mycobacterium bovis, are the main cause of human and bovine tuberculosis, respectively. M. bovis has a broader host range that includes humans; thus, the differentiation of mycobacterium is of great importance for epidemiological and public health considerations and to optimize treatment. The current study aimed to evaluate primers and molecular markers described in the literature to differentiate M. bovis and M. tuberculosis by PCR. Primers JB21/22, frequently cited in scientific literature, presented in our study the highest number of errors to identify M. bovis or M. tuberculosis (73 %) and primers Mb.400, designed to flank region of difference 4 (RD4), were considered the most efficient (detected all M. bovis tested and did not detect any M. tuberculosis tested). Although also designed to flank RD4, primers Mb.115 misidentified eight samples due to primer design problems. The results showed that RD4 is the ideal region to differentiate M. bovis from other bacteria classified in MTC, but primer design should be considered carefully.

M. L. Sales : A. A. Fonseca Jr. : É. B. Sales : A. C. P. Cottorello : M. A. Issa : M. A. Hodon : P. M. Soares Filho : A. K. Ramalho Lanagro/MG, Pedro Leopoldo, Minas Gerais, Brazil M. R. Silva Embrapa Gado de Leite, Juiz de Fora, Minas Gerais, Brazil A. P. Lage : M. B. Heinemann (*) Escola de Veterinária da Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil e-mail: [email protected]

Introduction Mycobacterium tuberculosis complex (MTC) is composed of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium bovis Bacille Calmette-Guérin (BCG), Mycobacterium africanum, Mycobacterium microti, Mycobacterium origi, Mycobacterium mungi, Mycobacterium caprae, and Mycobacterium pinnipedii. M. africanum and M. tuberculosis are the causative agents of human tuberculosis, the first being found only in West Africa or in individuals with any relationship with this region (Huard et al. 2006; de Jong et al. 2010; Alexander et al. 2010). M. bovis has a wide host range and is the cause of bovine tuberculosis, a disease of high impact in cattle (Di Pietrantonio and Schurr 2013). MTC is a group of microorganisms with high genetic homology. The genome of M. bovis has 99.95 % similarity with M. tuberculosis; deletions in DNA are a major contributor to these differences (Fleischmann et al. 2002; Garnier et al. 2003). It is important to correctly identify the species of the isolates of the MTC for epidemiological studies and public health considerations and to optimize treatment (Silva et al. 2013). M. bovis can infect humans by close contact with sick animals, consumption of contaminated milk, and even due to vaccination with BCG strain in immunodeficient individuals or neonates (Pinsky and Banaei 2008). As this species of Mycobacterium is resistant to pyrazinamide, a first-line antituberculosis agent, correct identification is important for effective treatment (Bakshi et al. 2005). Although M. tuberculosis is the most common cause of tuberculosis in humans, M. bovis corresponds to 0.5 to 7.2 % of tuberculosis cases in humans in industrialized countries and is estimated to be responsible for 10 to 15 % of new cases in the developing world (de la Rua-Domenech 2006). The main mode of transmission of the agent from animals to man is by consuming

434

animal products, such as milk, contaminated with the bacillus. The situation is highly concerning in Brazil, where 41 % of milk is produced illegally and consumed in the form of cheeses, yogurts, and milk, without proper thermal processing. This risk is further heightened by 5 % of the herds and 0.85 % of the cattle in Brazil positive for skin tests according to Silva et al. (2013). The identification of a pathogen is not only important for human health but also to animal health. The gold standard for diagnosis of bovine tuberculosis is isolation and subsequent identification by biochemical methods (Brasil 2006; Taylor et al. 2007; Cardoso et al. 2009). This method is timeconsuming due to the slow growth of M. bovis. The use of molecular techniques is very promising, allowing both fast and accurate results in the identification after isolation as the detection in clinical samples (Sakamoto et al. 1999). However, due to the high degree of similarity in the genome of members of MTC, caution must be exercised when developing molecular techniques. With the advancement of bioinformatics, it was possible to sequence the complete genome of M. tuberculosis and M. bovis and refine molecular studies (Fleischmann et al. 2002; Garnier et al. 2003). Analysis and comparison of DNA fragments in silico in public databases have become essential tools in the selection of target sequences (Garnier et al. 2003). The correct choice of molecular markers to be detected and primer design is a critical to the success of a PCR reaction in the diagnosis of tuberculosis (Sakamoto et al. 1999). Discrimination of Mycobacterium genus can be compromised if the regions studied are not tested on isolates from different sources and in greater numbers (Ruggiero et al. 2007). Thus, this paper aims to design, select, and evaluate various primers and molecular markers described in literature to differentiate M. tuberculosis and M. bovis by the PCR.

Materials and methods Standard samples The standard samples M. bovis AN5 CRNC and M. tuberculosis H37Rv CRNC 23 were used as positive and negative controls throughout the process to develop and validate the PCRs (Araujo et al. 2014). Besides them, all round reactions included controls to verify contamination in DNA extraction and PCR reagents. Three mycobacteria of the M. tuberculosis (MTC), Mycobacterium fortuitum CRNC 10, Mycobacterium kansasii CRNC 48, Mycobacterium gordonae CRNC 16, Mycobacterium avium D4 CRNC 05, Mycobacterium avium paratuberculosis CRNC 26, M. avium 1500 CRNC 15, M. intracellulare CRNC 17, M. avium 2045 CRNC 14, Mycobacterium marinum CRNC 19, Mycobacterium scrofulaceum CRNC 49, Mycobacterium

Folia Microbiol (2014) 59:433–438

szulgai CRNC 21, Mycobacterium triviale CRNC 22, Mycobacterium fortuitum peregrinum CRNC 11, Rhodococcus equi CRC 09/01, Corynebacterium pseudotuberculosis CRC 09/02, and Nocardia asteroides CRC 10/01 were used to verify the analytical specificity of the PCRs. All standard samples were derived from a collection maintained by the Laboratory of Diagnosis of Bacterial Diseases in an official laboratory of the Brazilian Ministry of Agriculture (Lanagro/MG). Isolates A total of 30M. bovis and 30M. tuberculosis isolates from Brazil provided by the Laboratory of Diagnosis of Bacterial Diseases of the National Agricultural Laboratory of Ministry of Agriculture, Livestock and Supply (DDB—Lanagro/MG) were used to test PCR efficiency and specificity. All mycobacterium tested had been subjected to additional phenotypic speciation methods, including biochemical tests such as catalase at room temperature and at 68 °C, niacin, nitrate, pyrazinamidase, urease, and drug susceptibility testing (DST), to distinguish mycobacterial strains. M. tuberculosis samples were isolated in a previous project and kindly provided by Embrapa Gado de Leite. M. bovis were isolated in Lanagro/MG from samples collected in slaughterhouses from tissues with lesions characteristic of bovine tuberculosis. DNA extraction Culture media containing bacterial colonies were washed with 1.5 mL of TE buffer (10 mmol/L Tris-HCl, 1 mmol/L EDTA, pH 8.0). Samples were inactivated for 1 h at 87.5 °C. After the inactivation process, 200 μL of bacterial suspension was used in the DNA extraction process. Sixty microliters of lysozyme (10 mg/mL) was added to the samples. The mixture was incubated for 2 h at 37 °C. To break up proteins, 30 μL of Proteinase K (10 mg/mL) and 60 μL of 10 % SDS were added to the samples. Samples were incubated at 56 °C during 4 h. Four hundred microliters pH 8.0 phenol saturated and 15 μL of isoamyl alcohol were used to remove protein from the solution. Each sample was centrifuged at 700g for 5 min at room temperature. The supernatant (aqueous phase) was removed and transferred to a new tube. The precipitation of DNA was carried out using 275 μL of absolute ethanol and 15 μL of 2-propanol. Samples were centrifuged at 19,000 g for 10 min at 4 °C. After discarding the supernatant, the precipitate was washed with 500 μL 70 % ethanol and the tube was homogenized by inversion. The sample was centrifuged at 19,000g for 10 min at 4 °C. The supernatant was again discarded. DNA was dried and resuspended in 50 μL of TE buffer. The DNA samples were stored at 4 °C until use.

Folia Microbiol (2014) 59:433–438

435

Primer design Primers used were designed and selected by the authors or found in the literature (Table 1). The oligonucleotides designed in this study were based on the complete genome of M. bovis (Garnier et al. 2003) targeting regions flanking large sequence polymorphisms or regions of difference. First, the sequences were subjected to BLAST® for verification of differences between M. bovis and M. tuberculosis (Altschul et al. 1997). Then, the selected target sequences available on GenBank (NCBI, http://www.ncbi.nlm.nih.gov/) were aligned in BioEdit (Hall 1999). After checking the ideal regions, namely, those present only on M. bovis, primers were designed in the program Primer3Plus (Untergasser et al. 2007). In silico analytical specificity of the primers was tested with the PrimerBlast program (Altschul et al. 1990). PCR PCRs with primers designed in this study and described in the literature were optimized for detection of M. bovis using trial and error change in annealing temperature, DNA polymerase concentration, and MgCl2 concentration (Table 2). The primers used are described in Table 1. All PCRs were used in this study in order to differentiate M. bovis from M. tuberculosis, with the exception described by Telenti et al. (1993), which was only used to verify that the bacteria used were in the MTC group and that the DNA was correctly extracted. This methodology allows the confirmation of the isolates as MTC using enzymatic digestion of the amplified products by HaeIII and BstEII. Reactions were performed with a final volume of 20 μL per reaction with the following reagent concentrations: 0.075 U/ μL GoTaq® Hot Start Polymerase (Promega, USA), 20 % Green Buffer 5x GoTaq Hot Start® (Promega, USA), 1.5 mmol/L MgCl2 (Promega, USA), 10 mmol/L dNTP, 1

pmol/μL of each primer, and 2.0 μL of DNA. The temperature conditions are described in Table 2. The amplified products from PCR were all subjected to gel electrophoresis in 2 % agarose stained with ethidium bromide (0.5 μg/mL). Statistical analysis We used the kappa and McNemar tests to determine the correlation between the PCRs used, sensitivity, and specificity (Kraemer 1992).

Results Standard samples Results indicated that all primers tested had a high specificity to MTC as they did not amplify DNA extracted from any mycobacterium outside MTC or other species of the order Actinomycetales. DNA extraction was successful as nucleic acid extracted from all isolates amplified in the technique described by Telenti et al. (1993). PCRs All positive, negative, DNA extraction, and blank controls validated the results of each PCR as there were no amplifications in tubes supposed to be negative for the PCRs. Table 3 shows the results of each PCR for all samples tested for the 30 M. bovis and 30M. tuberculosis isolated and biochemically characterized. Each PCR had different number of positive and negative results in the two groups of isolates. The performance was different even when primers were designed to detect the same genomic region like Mb.400 and Mb.115. The worst performance was that of JB21/22 that presented a high number of positive results for M. tuberculosis. Due to this

Table 1 Oligonucleotide primers used to perform the PCRs Primer

Region

Sequence 5′–3′

Amplicon (bp)

Reference

TB11 TB12

groEL2

ACCAACGATGGTGTGTCCAT CTTGTCGAACCGCATACCCT

439

Telenti et al. 1993

Mb.280.F Mb.280.R JB22 JB21 TB.MB.F TB.MB.R Mb.115.F Mb.115.R Mb.400.F Mb.400.R

mmpS6

ACGCGGCTGGATGGTGCTGGTTG CGCGGGCAGGGTCGTCGTGA TCGTCCGCTGATGCAAGTGC CGTCCGCTGACCTCAAGAAG CTGAGGTGTTGTTTCCGTCC TCGTTGACCACGAATTTTCA AGAAGCGCAACACTCTTGGA CCCCGTAGCGTTACTGAGAA AACGCGACGACCTCATATTC AAGGCGAACAGATTCAGCAT

280

Present work

499

Rodriguez et al. 1999

217

Present work

115

Present work

400

Present work

a

RvD1-Rv2024c RD5a RD4a

Primers were designed to flank these regions amplifying the respective fragments in M. bovis

436

Folia Microbiol (2014) 59:433–438

Table 2 Cycling conditions for each PCR Primer

TB11/TB12 Mb.280 JB21/JB22 TBMB Mb.115 Mb.400

Denaturation

96 94 95 94 95 95

°C/4 °C/4 °C/5 °C/5 °C/5 °C/5

min min min min min min

Cycles

Polymerization

Denaturation

Annealing

Extension

95 95 95 95 95 95

56 66 54 54 60 56

72 72 72 72 72 72

°C/45 °C/35 °C/30 °C/20 °C/15 °C/30

s s s s s s

°C/45 °C/35 °C/30 °C/20 °C/20 °C/30

discrepant result, DNA samples were extracted again and retested. We found the same results in this repetition, indicating the poor performance of these primers or this genomic region to differentiate M. bovis from M. tuberculosis.

Discussion Choice of markers to be detected and amplified, primer sequences, and the quality of DNA extraction are critical steps in PCR development (Sakamoto et al. 2008). Many primers that initially proved effective to discriminate the species in Mycobacterium genus failed to correctly identify when used in routine diagnosis to molecularly characterize isolates from different regions of the world (Ruggiero et al. 2007). PCRs used in this study did not amplify DNA of Mycobacterium o u t s i d e th e M T C o r o t h e r s p e c i e s o f th e o r d e r Actinomycetales. However, there were more diverse results when the PCRs were used to detect genetically similar bacteria such as M. tuberculosis and M. bovis. The PCR using primers JB21/JB22 had the highest number of errors to correctly discriminate M. bovis and M. tuberculosis. We performed an in silico primer alignment with the sequences of the M. tuberculosis available in GenBank and found that they aligned with a segment of 499 bp following the region coding for the enzyme helicase (position 2257788–2258286 according to CCDC5180 M. tuberculosis, access number CP001642.1). The same primer also aligned with genomic sequence of M. africanum (FR878060.1) and M. bovis (BX248341.1), yielding a product with the same size. Rodriguez et al. (1999) obtained 100 % agreement between the PCR and microbiological method using primers JB21/JB22 in 121 samples isolated in Argentina, Mexico, and Colombia. However, other works had results more similar to ours. Sechi et al. (2000) showed that 4 out of 30 samples of M. bovis isolated from cattle in Sardinia (Italy) did not amplify in the same PCR. Twelve of the 20 samples of M. tuberculosis isolates from India were also positive (Shah et al. 2002).

s s s s s s

°C/45 °C/35 °C/30 °C/20 °C/30 °C/30

Number of cycles s s s s s s

35× 35× 35× 35× 35× 35×

72 72 72 72 72 72

°C/5 °C/5 °C/5 °C/5 °C/5 °C/5

min min min min min min

Previous publications using Brazilian isolates from cattle found that only 88.24 % tested positive for JB21/JB22 (Figueiredo et al. 2009). These results correspond with the data of the present study in which 16.66 % of M. bovis isolates were negative and 73.33 % of M. tuberculosis isolates were positive in PCR that used this primer pairs (Table 3). The target for primer Mb.280 is known as TbD1, a deletion detected in M. tuberculosis after complete sequencing of the genome of strain H37Rv (Brosch et al. 1999). In silico analysis in this study determined that the region is deleted in all the genomes of M. tuberculosis currently available in GenBank. The PCR using these primers amplified all M. bovis and none of the species outside MTC; however, it detected 36.66 % of M. tuberculosis isolates. This result corroborates the findings of Brosch et al. (2002) who found that some strains of the causative agent of human tuberculosis had an intact TbD1 with genes mmpS6 and mmpL6. If primers TBMB were designed to flank the region of difference 5 (RD5), then these primers should amplify M. bovis because this region is deleted in these isolates. However, RD5 is located in a highly variable region, and it is now apparent that absence of this gene may occur due to a number of different genomic deletions, and thus, isolates other than M. bovis may lack Table 3 M. bovis and M. tuberculosis positives in each PCR Primer

Mb.280 JB21/JB22 TBMB Mb.115 Mb.400

Positive samples

M. bovis

M. tuberculosis

100 % (30/30) 83.33 % (25/30) 96.66 % (29/30) 96.66 % (29/30) 100 % (30/30)

36.66 % (11/30) 73.33 % (22/30) 53.33 % (16/30) 26.66 % (8/30) 0 % (0/30)

Folia Microbiol (2014) 59:433–438

this gene. In our study, 53.33 % of M. tuberculosis were positive for PCR with primers flanking RD5, indicating that this is a common polymorphism in the population of M. tuberculosis in Brazil. Primers Mb.400 and Mb.115 were designed to flank the region of difference 4 (RD4) present in all species or ecotypes of MTC, but absent in M. bovis and M. bovis BCG (Smith et al. 2006). The PCR using primers Mb.115 amplified eight samples of M. tuberculosis. The in silico tests indicated that the direct primer (forward) aligns with the genome of all M. tuberculosis deposited in GenBank. The second primer aligns with only two sequences (AF181860.1 and AF189746.1) of this microorganism, none of them belonging to a complete genome. When the pair was analyzed together in PrimerBlast, the results indicated only for the formation of amplicon in sequences of M. bovis. When BLAST was performed using the PCR product (115 bp) in the genome of M. tuberculosis, a match of 93 bp (positions 1709949 to 1710041, access number CP003234.1) was observed. Possibly high rate of guanine in the 5 ′anti-sense primer (reverse) and the similarity of a large part of the amplified product have generated unspecific PCR products in samples of M. tuberculosis similar in size to M. bovis. The first in silico analysis indicated that the primers would result in no amplification using M. tuberculosis DNA, but in vitro tests contradicted the computational analysis. Bakshi et al. (2005) analyzed the same region and concluded that all samples of M. bovis were deleted for RD4 but postulated that the analysis of a larger number of samples or other populations could counteract this result. Although this is a possibility, because the region is associated with one repetition and an is6110, it is also likely that the annealing with other portions of the genome of some strains of M. tuberculosis occurred. The best results were obtained using PCR with primers MB.400. Deletion of the region RD4 removes the genes Rv1506–Rv1516 in all of the complete genome sequences of M. bovis and M. bovis BCG in GenBank. All other MTC available in the database had no deletions in this region. The deletion of this region was indicated by other studies (Brosch et al. 2002) and is confirmed by this experiment indicating that it is the most suitable for the identification of M. bovis. Primers JB21/22 were cited in scientific literature to amplify M. bovis. However, the target of these primers is also present in many M. tuberculosis strains. This agrees with our results where these primers amplified a high number of M. tuberculosis (73 %). Primers Mb.400 designed to flank region of difference 4 (RD4) were considered the most efficient to amplify M. bovis (30/30–100 %), and they did not amplify M. bovis (0/30–0 %). Although also designed to flank RD4, primers Mb.115 amplified eight M. tuberculosis. The results showed that RD4 is the ideal region to differentiate M. bovis from other bacterium classified in MTC (with the

437

exception of M. caprae as it was not tested in this work), but primer design should be considered carefully. Acknowledgments We would like to thank Ministério da Agricultura, Pecuária e Abastecimento, INCT-Pecuária and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). APL and MBH thank the CNPq for the fellowships.

References Alexander KA, Laver PN, Michel AL, Williams M, van Helden PD, Warren RM, Gey van Pittius NC (2010) Novel Mycobacterium tuberculosis complex pathogen, M. mungi. Emerg Infect Dis 16(8):1296–1299 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215:403–410 Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389–3402 Araujo CP, Osorio ALAR, Jorge KSG, Ramos CAN, Filho AFS, Vidal CES, Roxo E, Nishibe C, Almeida NF, Fonseca Jr AA, Silva MR, Neto JDB, Cerqueira VD, Zumarraga MJ, Araujo FR (2014) Detection of Mycobacterium bovis in bovine and bubaline tissues using nested-PCR for TbD1. Plos One 9:e91023 Bakshi CS, Shah DH, Verma R, Singh RK, Malik M (2005) Rapid differentiation of Mycobacterium bovis and Mycobacterium tuberculosis based on a 12.7-kb fragment by a single tube multiplex-PCR. Vet Microbiol 109:211–216 Brasil (2006) Ministério da Agricultura Pecuária e Abastecimento. Programa Nacional de Controle e Erradicação da Brucelose e Tuberculose – PNCEBT. Brasil: MAPA/DAS/DAS, 184p. (Manual Técnico). Brosch R, Philipp WJ, Stavropoulos E, Colston MJ, Cole ST, Gordon SV (1999) Genomic analysis reveals variation between Mycobacterium tuberculosis H37Rv and the attenuated M. tuberculosis H37Ra strain. Infect Immun 67:5768–5774 Brosch R, Gordon SV, Marmiesse M, Brodin P, Buchrieser C, Eiglmeier K, Garnier T, Gutierrez C, Hewinson G, Kremer K, Parsons LM, Pym AS, Samper S, Van Soolingen D, Cole ST (2002) A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proc Natl Acad Sci 99(6):3684–3689 Cardoso MA, Cardoso RF, Hirata RDC, Hirata MH, Leite CQF, Santos ACB, Siqueira VLD, Okano W, Rocha NS, Lonardoni MVC (2009) Direct detection of Mycobacterium bovis in bovine lymph nodes by PCR. Zoonoses Public Health 56:465–470 de Jong BC, Antonio M, Gagneux S (2010) Mycobacterium africanum— review of an important cause of human tuberculosis in West Africa. PLoS Negl Trop Dis 4:e744 de La Rua-Domenech R (2006) Human Mycobacterium bovis infection in the United Kingdom: incidence, risks, control measures and review of the zoonotic aspects of bovine tuberculosis. Tuberculosis 86:77–109 Di Pietrantonio T, Schurr E (2013) Host-pathogen specificity in tuberculosis. Adv Exp Med Biol 783:33–44 Figueiredo EES, Silvestre FG, Campos WN, Furlanetto LV, Medeiros L, Lilenbaum W, Fonseca LS, Silva JT, Paschoalin V (2009) Identification of Mycobacterium bovis isolates by a multiplex PCR. Braz J Microbiol 40:231–233 Fleischmann RD, Alland D, Eisen JA, Carpenter L, White O, Peterson J, Deboy R, Dodson R, Gwinn M, Haft D, Hickey E, Kolonay JF, Nelson WC, Umayam LA, Ermolaeva M, Salzberg SL, Delcher A, Utterback T, Weidman J, Khouri H, Gill J, Mikula A, Bishai W,

438 Jacobs WR Jr, Venter JC, Fraser CM (2002) Whole-genome comparison of Mycobacterium tuberculosis clinical and laboratory strains. J Bacteriol 184:5479–5490 Garnier T, Eiglmeier K, Camus JC, Medina N, Mansoor H, Pryor M, Duthoy S, Grondin S, Lacroix C, Monsempe C, Simon S, Harris B, Atkin R, Doggett J, Mayes R, Keating L, Wheeler PR, Parkhill J, Barrell BG, Cole ST, Gordon SV, Hewinson RG (2003) The complete genome sequence of Mycobacterium bovis. Proc Natl Acad Sci 100:7877–7882 Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98 Huard RC, Fabre M, de Haas P, Lazzarini LC, van Soolingen D, Cousins D, Ho JL (2006) Novel genetic polymorphisms that further delineate the phylogeny of the Mycobacterium tuberculosis complex. J Bacteriol 188(12):4271–4287 Kraemer HC (1992) Evaluating medical tests. Sage, Newbury Park Pinsky BA, Banaei N (2008) Multiplex real-time PCR assay for rapid identification of Mycobacterium tuberculosis complex members to the species level. J Clin Microbiol 46:2241–2246 Rodriguez JG, Fissanoti JC, Del Portillo P, Patarroyo ME, Romano MI, Cataldi A (1999) Amplification of a 500-base-pair fragment from cultured isolates of Mycobacterium bovis. Eur J Clin Microbiol Infect Dis 37:2330–2332 Ruggiero AP, Ikuno AA, Ferreira VCA, Roxo E (2007) Tuberculose bovina: alternativas para o diagnóstico. Arq Inst Biol 74:55–65 Sakamoto SM, Telles MAS, Heinemann MB, Richtzenhain LJ, Roxo E, Vasconcellos AS, Ferreira Neto JS (1999) Detecção e identificação de Mycobacterium bovis pela reação em cadeia da polimerase. Arq Inst Biol 66:45–58

Folia Microbiol (2014) 59:433–438 Sakamoto SM, Assis RA, Alencar AP, Mota PMPC, Lage AP (2008) Métodos auxiliares de diagnóstico da tuberculose bovina. Cad Téc Vet Zootec 59:43–68 Sechi LA, Duprè I, Leori G, Fadda G, Zanetti S (2000) Distribution of a specific 500-base-pair fragment in Mycobacterium bovis isolates from Sardinian cattle. J Clin Microbiol 38:3837–3839 Shah DH, Verma R, Bakshi CS, Singh RK (2002) A multiplex-PCR for the differentiation of Mycobacterium bovis and Mycobacterium tuberculosis. FEMS Microbiol Lett 214:39–43 Silva MR, Rocha AS, Costa RR, Alencar AP, Oliveira VM, Fonseca AA Jr, Sales ML, Issa MA, Soares Filho PM, Pereira OTV, Santos EC, Mendes RS, Ferreira AMJ, Mota PMPC, Suffys PN, Guimarães MDC (2013) Tuberculosis patients co-infected with Mycobacterium bovis and Mycobacterium tuberculosis in an urban area in Brazil. Mem Inst Oswaldo Cruz 108:321–327 Smith NH, Kremer K, Inwald J, Dale J, Driscoll JR, Gordon SV, Van Soolingen D, Hewinson RG, Smith JM (2006) Ecotypes of the Mycobacterium tuberculosis complex. J Theor Biol 239:220–225 Taylor GM, Worth DR, Palmer S, Jahans K, Hewinson RG (2007) Rapid detection of Mycobacterium bovis DNA in cattle lymph nodes with visible lesions using PCR. BMC Vet Res 3:12 Telenti A, Marchesi F, Balz M, Bally F, Böttger EC, Bodmer T (1993) Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J Clin Microbiol 31:175–178 Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JAM (2007) Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 35:W71–W74