0161-58~/92 $5.00 + 0.00 Q 1992Pergamon Press Ltd
~o~e~lar Z~~~oiog~, Vol. 29, NO. 6, pp. 807-810, 1992 Printed in Great Britain.
EVIDENCE SUGGESTING AN EVOLUTIONARY RELATIONSHIP BETWEEN TRANSPOSABLE ELEMENTS AND IMMUNE SYSTEM RECOMBINATION SEQUENCES DAVXD H. DRIXFUS Department
of Molecular Genetics, Division of Biological Sciences, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, U.S.A. (First received 21 June 1991; accepted in revised form 15 October 1991)
Abstract-Sequence similarity between the termini of invertebrate Tel-like transposable sequences and the signal sequences of the vertebrate immunoglobulin somatic recombination pathway is described. These similarities suggest that the Tel transposition pathway may share common sequence-specific binding factors with the immunoglobulin somatic recombination pathway.
Somatic r~om~ination of vertebrate immunoglobulin genes occurs in the most primitive vertebrate studied to date, et
the horned
al.,
1985;
shark Heterodontus franc&i (Litman Hinds and Litman, 1986), and the
immunoglobulin gene somatic recombination pathway appears phylogenetically related to the somatic recombination of T cell receptor genes (Hood et al., 1985). Sakano et ai. (1979) have previously proposed that the vertebrate somatic recombination pathway evolved via the insertion of a transposable element into an ancestral gene encoding an antigen binding molecule, thus accounting for the simultaneous appearance of separated gene segments and a r~ombinat~on mechanism for their reassembly. Sequence similarity between immunoglobulin recombination signals and the termini of the Ceanorhabditis elegans (C. elegans) repetitive element Tc6 has recently been noted (Dreyfus and Emmons, 1991). The termini of Tc6 are also noted to share regions of terminal sequence similarity to the C. elegans transposon Tel, an invertebrate mobile DNA sequence which excises from genomic sites at high frequency in somatic tissues (Emmons eb al., 1983; reviewed in Moerman and Waterston, 1988). As shown in Fig. 1, comparison of the terns nucleotides of Tel to sequences known to be essential for immune system recombination in vivo and in vifro (Siu et al., 1984; Akira et al., 1987) reveals that Tel termini are identical for six of seven bases to the sequence of the conserved terminal heptamer of the recombination signal sequence. Both transposon terminal nucleotides and heptamer sequences are located adjacent to the site of recombination and are the presumed targets of the transposase or recombinase. Although the first nucleotide of the immunoglobulin signal sequence, a cytosine required for functional activity of the signal, is not conserved in the Tel-like elements, in all Tel-like elements a th~diue residue occupies this position suggesting that this difference may reflect a functionally 807
important difference between the two types of sequence. Conservation of non-functional sequences between Tcllike elements and immunoglobulin signal sequences, for example the 11 nucleotides including both functionally important and non-important positions shared between Tc6 and the immunoglobuliu Vk21 C sequence, suggests a common evolutionary origin for the sequences as through descent from a common precursor sequence capable of directing site specific recombination. As shown in Fig. 2, a similar dyad symmetry is conserved between the termim of a hypothetical trans~sition inte~ediate proposed for Tel-like elements and the primary product of i~unoglobulin signal sequence excision. The nucleotides shared by Tc 1 and the immune system are found at the termini of a widely distributed family of invertebrate transposable sequences including transposons from nematodes: Tclb, Tc3, and Tc6 as well as transposable sequences from fruit flies: HBl, Uhu, and mariner (Fig. 1). The mariner element, like Tel, exhibits a high rate of somatic excision (Jacobson et al., 1986). Properties of immunoglobulin and T-cell receptor gene rearrangements are consistent with a multi-step mechanism (Lewis and Gellert, 1989). Recently, a molecule expressed in lymphoid tissues denoted “JkRS binding factor” (Matsunami et al., 1989) has been isolated via specific binding to the heptamer sequence “CACTGTG” containing six of seven nucleotides shared with Tcf and with Tel-like invertebrate element termini, providing direct evidence that the nucleotides shared between T&-like invertebrate transposons and the immuno~obulin r~ombination heptamer are sufhcient to direct sequence specific protein binding. The mechanistic role of JkRS in immunoglobulin recombination is currently not known. However, the sequence of a phylogenetically conserved DNA binding protein denoted TcA encoded within Tel-like transposons ~Schukkink and Plasterk, 1990) is not similar to JkRS binding factor (analysis not shown). The sequence of
808
Viewpoint Tel:
(TAI ~AGTGCTGGCCA~AAGATAT~~ACTTTTGGTTTTTTGTGTGTA - --____-..A*--Tclb: (TA) ~AGTA~TGGCCAT~AeAATG~GA~AA~TTGTTTTTTGAAGATA - _--- _Tc3: ITA) ~AGTGTGGGA~GTTCTATAGGA~C~~CC - c_I--Tc6: (TA) ~AGTGCTC~ACATAATGATACGGCCA~~CC~A~TTTTGGTATA - ___-__I_-_I_ ffbl: (TA) CAGCTGTGTTCAGAAAAATAGCAGTGC - __-_ marinex:(TAICCAGGTGTACAAGTAGGGAATGTCGGTT - __-- UhU (TA) ~AGTGTCTTA~AG~TC~CTGGA~CAGTGCCTAGG~A~TTTT~ *_,x*n/. - --__Vk21C
CA CAGTGCTCCAGGG~TG~GA~AAC~ I 7mer I f 9mer
Jk2
CA -CA _CA ~-
V/Dbl.l DfJbl.1
I
CAGTGGTAGTA~TCGACTGTCTGG~TGTACAA~A~C __-_- ~AATGTTA~AGCTTTATACAAAA~GG -_ -_ _ --CGGTGATT~AATTCTATGGG~GCCTTTAG~~~~A _ _-- __ -__
Bimiiarity between Tel--like transposons from immunoglobulin and T-cell receptor Element
and joining signals genes: Reference
Grqanism
Species
nematode
C, elesans
TCl
Rosenzweig (I.9831
,f
C. brisssae
Tclb
,r
Harlris (1988)
C. elecrans
Tc3
,f
C,
TC6
Colfins t1989) Dxeyfus
electans
et et
et al.
al. al.
and EZmmons
tl.9911 fruit fly
D._ melanosaster
Hbl.
I#
D, mauritania
mariner
‘t
$I._heteroneura
Uhu
Mouse
~mmunoglob~lin
joint
Vk21C
Brierly and Potter (1985) Jacobson et al. (19861 Brezinsky et aI.. (19901 Akira et aI. (1987)
Jkl Mouse
T cell receptor
joint
11
VfDb1.l D/Jbl.l.
Siu et (19841 li
al.
Fig. 1. Invertebrate transposons of the T&like family share terminal sequences similar to the CACAGTC signal heptamer of Vk2lC and other immunoglobulin and T-cell receptor signal sequence joining sites. The immunoglobulin signal heptamer and nonomer are indicated within the Vk2lC sequence. Underlined bases denote terminal nucleotides shared between indicated sequence and the mouse Vk21C signal sequence terminus, which has been chosen as the basis of comparison to other sequences. The TA dinuc~~tide conserved at T&like element insertion sites is denoted with parentheses and corresponding nucteotides are aligned within the signal sequences in order to facilitate sequence compa~son. Bases underlined with a A indicate nucleotides within T&like sequences which are similar to the immunoglobulin nonomer “ACAAAAACC,” atthough these sequences are not highly conserved in the Tel-like elements and do not conform to a fixed spacing from the heptamer.
another vertebrate factor denoted “RAG-I I’ required for the expression of immunoglobuiin recombination (Schatz et al., 1989) is also distinct from that of TcA (analysis not shown). While the structure of sequenced Tel excision sites reviewed in Moerman and Waterston, 1988) is consistent
with either perfect excision of the Tel element or retention of transposon termini at the excision site, the sequence of immunoglobul~n “coding joints” resulting from excision of signal sequences suggests that additional
processing
of the
“coding
joint”
following signal sequence excision (McCo~ack
occurs
et
al.,
809
Viewpoint >< TG~AG~ACTGTGCAGAGTGGTAGTA
Immune
GCCAGCACTGT -___ --__
TC!l
-_----->
consensue
m-----
() formed via joining of the element termini is shown above, as proposed in Ruan and Emmons (1984). The Tci ~ansposition inte~ediate has not been expe~mentally confirmed, and is based upon analogy to tr~sposition pathways characterized for palindromic mobile sequences in prokaryotic species, although indirect evidence suggests that many Tel somatic excision products have such a novel end to end joint (Ruan and Emmons, 1984). Underlined bases in the Tel sequence indicate nucleotides matching the immune consensus. The immunoglobulin novel joint (denoted ) () contains a GC dinucleotide not present in the putative Tel novel joint, however the palindromic symmetry and the sequences flanking the novel joint are conserved.
1989; Lafaille et al., 1989). In addition, while the closed circular products of Tel excision (Rose and Snutch, 1984; Ruan and Emmons, 1984) have been proposed to be transposition intermediates, the products of immunoglobulin somatic excision appear to be end products since unlike Tel elements, signal sequences do not appear to reinsert at other genomic loci. These evident differences between Tel-like somatic excision and immunoglobulin signal sequence directed recombination suggest that two pathways are not identical, although both pathways may share a similar sequence specific binding factor or factors. These observed sequence simila~ties suggest several routes of experimental confirmation. One might predict that sequence of intermediates and mechanism of Tcllike somatic excision and/or transposition (which are currently hypothetical and based solely on analogy to bacterial mobile sequences) would share additional similarities to the corresponding intermediates of i~unoglob~in signal sequence excision. In addition, one would predict that proteins such as TcA which appear to have a role in the ~ansposition of Tel-like sequences in invertebrate species might share a relatedness to protein or proteins in the immunoglobulin excision pathway, and conversely that proteins such as the JkR6 binding factor might have invertebrate relatives in the Tel-like sequence transposition pathway. Acknowledgements-I thank Drs S. W. Emmons, A. Radice, B. Birshstein, S. Hawley, and M. Scharff for their comments on this manuscript. This work was supports by NIH Training Grant T32GM~7288 and by NIH grant GM38174 to S. W. Emmons. REFERENCES Akira S., Okazaki K. and Sakano H. (1987) Two pairs of Recombination Signals are sufficient to cause immunoglobulin V-D-J joining. Science 238, 1134-l 138. Brezinsky L., Gordon V. L., Wang, Humphreys T. and Hunt J. (1990) The transposable element Uhu from Hawaiian ~r~~u~~~~ff-rnern~r of the widely dispersed class of Tel-like transposons. Nucl. Acids Res. 18, 2053-2059. Brierly H. L. and Potter H. S. (1985) Distinct characteristics of loop sequences of two Drosophila foldback transposable elements. Nuci. Acids Res. 13, 485-500.
Collins J., Forbes E. and Anderson F. (1989) The TC3 family of transposable genetic elements in Cae~orhabditis elegms. Genetics 121, 47-55. Dreyfus D. H. and Emmons S. W. (1991) A transposon related palindromic repetitive sequence from Cuenorhabditis Elegans. Nucl. Acids Res. 19, 1871-1877. Emmons S. W., Yesner L., Ruan K. and Katzenberg D. (1983) Evidence for a transposon in Caernohabditis elegans. Cell 32, 55-65. Harris L. J., Baillie D. L. and Rose A. M. (1988) Sequence identity between an inverted repeat family of transposable elements in Drosophila and Cae~orhabditis. Nucl. Acids Res. 16, 5991-5998. Hinds K. R. and Litman G. W. (1986) Major reorganization of immunoglobulin VH segmental elements during vertebrate evolution. Nature 320, 546-549. Hood L., Kronenberg M. and Hunkapillar T. (1985) T cell antigen receptors and the immunoglobulin supergene family. CeN 40, 225-229. Jacobson J. W., Medhora M. M. and Hart1 D. L. (1986) Molecular structure of a somatically unstable transposable element in Drosophila. Proc. natn. Acad. Aci. U.S.A. 83, 8684-8688. Lafaille J. J., DeCloux A., Bonneville M., Takagaki Y. and Tonegowa S. (1989) Junctional sequences of T cell receptor gamma-delta genes: Implications for gamma-delta T cell lineages and for a novel intermediate of V-(D)-J joining. Cell 59, 859-870. Lewis S. and Gellert M. (1989) The mechanism of antigen receptor gene assembly. Cell 59, 585-588. Litman G. W., Berger L., Murphy K., Litman R., Hinds K., and Erickson B. W. (1985) Immunoglobulin VH gene structure and diversity in ~eterodontus, a phylogenetically primitive shark. Proc. Nati. Acad. Aci. U.S.A. 82, 2082-2086. Matsunami N., Hamaguchi Y., Yamamoto Y., Kuze K., Kangawa K., Matsuo H., Kawaichi M. and Honjo T. (1989) A protein binding to the Jkappa recombination sequence of immunoglobulin genes contains a sequence related to the integrase motif. Nature 342, 934-937. McCormack W. T., Tjoelker L. W., Carlson L. M., Petryniak B., Barth C. F., Humphries E. H. and Thompson C. B. (1989) Chicken IGL gene rearrangement involves deletion and addition of single non-random nucfeotides to both coding segments. Ceil 56, 785-791. Moerman D. and Waterston R. (1988) Transposons in C. elegant. In MobiIe DNA (Edited by Berg P. and Howe M.) Am. Sot. Microbial.
810
Viewpoint
Rose A. M. and Snutch T. P. (1984) Isolation of the closed circular form of the transposable element Tel of Cuenorhabditis elegans. Nature 311, 4855486.
Rosenzweig B., Liao L. W. the C. elegans transposable 42014209. Ruan K. S. and Emmons copies of transposon Tel
and Hirsh D. (1983) Sequence of element Tel. Nucl. Acids Res. 11, S. W. (1984) Extrachromosomal in the nematode Cuernorhabditis
elegans. Proc. Natl. Acad. Sci. U.S.A. 81, 40184022.
Sakano H., Huppi K., Heinrich G. and Tonegowa S. (1979) Sequences at the somatic recombination sites of immunoglobulin light-chain genes. Nature 280, 288-294.
Schatz D. G., Oettinger M. A. and Baltimore D. (1989) The V(D)J recombination activating gene, RAG-l. Cell 59, 1035-1048. Schukkink R. F. and Plasterk R. H. A. (1990) TcA, the putative transposase of the C. elegans Tel transposon, has an N-terminal DNA binding domain. Nucl. Acids Res. 18, 895-900.
Siu G., Kronenberg M., Strauss E., Haars R., Mak T. W. and Hood L. (1984) The structure, rearrangement and expression of D-beta gene segments of the murine T-cell antigen receptor. Nature 311, 344350.
~o~e~lar Z~~~oiog~, Vol. 29, NO. 6, pp. 807-810, 1992 Printed in Great Britain.
EVIDENCE SUGGESTING AN EVOLUTIONARY RELATIONSHIP BETWEEN TRANSPOSABLE ELEMENTS AND IMMUNE SYSTEM RECOMBINATION SEQUENCES DAVXD H. DRIXFUS Department
of Molecular Genetics, Division of Biological Sciences, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, U.S.A. (First received 21 June 1991; accepted in revised form 15 October 1991)
Abstract-Sequence similarity between the termini of invertebrate Tel-like transposable sequences and the signal sequences of the vertebrate immunoglobulin somatic recombination pathway is described. These similarities suggest that the Tel transposition pathway may share common sequence-specific binding factors with the immunoglobulin somatic recombination pathway.
Somatic r~om~ination of vertebrate immunoglobulin genes occurs in the most primitive vertebrate studied to date, et
the horned
al.,
1985;
shark Heterodontus franc&i (Litman Hinds and Litman, 1986), and the
immunoglobulin gene somatic recombination pathway appears phylogenetically related to the somatic recombination of T cell receptor genes (Hood et al., 1985). Sakano et ai. (1979) have previously proposed that the vertebrate somatic recombination pathway evolved via the insertion of a transposable element into an ancestral gene encoding an antigen binding molecule, thus accounting for the simultaneous appearance of separated gene segments and a r~ombinat~on mechanism for their reassembly. Sequence similarity between immunoglobulin recombination signals and the termini of the Ceanorhabditis elegans (C. elegans) repetitive element Tc6 has recently been noted (Dreyfus and Emmons, 1991). The termini of Tc6 are also noted to share regions of terminal sequence similarity to the C. elegans transposon Tel, an invertebrate mobile DNA sequence which excises from genomic sites at high frequency in somatic tissues (Emmons eb al., 1983; reviewed in Moerman and Waterston, 1988). As shown in Fig. 1, comparison of the terns nucleotides of Tel to sequences known to be essential for immune system recombination in vivo and in vifro (Siu et al., 1984; Akira et al., 1987) reveals that Tel termini are identical for six of seven bases to the sequence of the conserved terminal heptamer of the recombination signal sequence. Both transposon terminal nucleotides and heptamer sequences are located adjacent to the site of recombination and are the presumed targets of the transposase or recombinase. Although the first nucleotide of the immunoglobulin signal sequence, a cytosine required for functional activity of the signal, is not conserved in the Tel-like elements, in all Tel-like elements a th~diue residue occupies this position suggesting that this difference may reflect a functionally 807
important difference between the two types of sequence. Conservation of non-functional sequences between Tcllike elements and immunoglobulin signal sequences, for example the 11 nucleotides including both functionally important and non-important positions shared between Tc6 and the immunoglobuliu Vk21 C sequence, suggests a common evolutionary origin for the sequences as through descent from a common precursor sequence capable of directing site specific recombination. As shown in Fig. 2, a similar dyad symmetry is conserved between the termim of a hypothetical trans~sition inte~ediate proposed for Tel-like elements and the primary product of i~unoglobulin signal sequence excision. The nucleotides shared by Tc 1 and the immune system are found at the termini of a widely distributed family of invertebrate transposable sequences including transposons from nematodes: Tclb, Tc3, and Tc6 as well as transposable sequences from fruit flies: HBl, Uhu, and mariner (Fig. 1). The mariner element, like Tel, exhibits a high rate of somatic excision (Jacobson et al., 1986). Properties of immunoglobulin and T-cell receptor gene rearrangements are consistent with a multi-step mechanism (Lewis and Gellert, 1989). Recently, a molecule expressed in lymphoid tissues denoted “JkRS binding factor” (Matsunami et al., 1989) has been isolated via specific binding to the heptamer sequence “CACTGTG” containing six of seven nucleotides shared with Tcf and with Tel-like invertebrate element termini, providing direct evidence that the nucleotides shared between T&-like invertebrate transposons and the immuno~obulin r~ombination heptamer are sufhcient to direct sequence specific protein binding. The mechanistic role of JkRS in immunoglobulin recombination is currently not known. However, the sequence of a phylogenetically conserved DNA binding protein denoted TcA encoded within Tel-like transposons ~Schukkink and Plasterk, 1990) is not similar to JkRS binding factor (analysis not shown). The sequence of
808
Viewpoint Tel:
(TAI ~AGTGCTGGCCA~AAGATAT~~ACTTTTGGTTTTTTGTGTGTA - --____-..A*--Tclb: (TA) ~AGTA~TGGCCAT~AeAATG~GA~AA~TTGTTTTTTGAAGATA - _--- _Tc3: ITA) ~AGTGTGGGA~GTTCTATAGGA~C~~CC - c_I--Tc6: (TA) ~AGTGCTC~ACATAATGATACGGCCA~~CC~A~TTTTGGTATA - ___-__I_-_I_ ffbl: (TA) CAGCTGTGTTCAGAAAAATAGCAGTGC - __-_ marinex:(TAICCAGGTGTACAAGTAGGGAATGTCGGTT - __-- UhU (TA) ~AGTGTCTTA~AG~TC~CTGGA~CAGTGCCTAGG~A~TTTT~ *_,x*n/. - --__Vk21C
CA CAGTGCTCCAGGG~TG~GA~AAC~ I 7mer I f 9mer
Jk2
CA -CA _CA ~-
V/Dbl.l DfJbl.1
I
CAGTGGTAGTA~TCGACTGTCTGG~TGTACAA~A~C __-_- ~AATGTTA~AGCTTTATACAAAA~GG -_ -_ _ --CGGTGATT~AATTCTATGGG~GCCTTTAG~~~~A _ _-- __ -__
Bimiiarity between Tel--like transposons from immunoglobulin and T-cell receptor Element
and joining signals genes: Reference
Grqanism
Species
nematode
C, elesans
TCl
Rosenzweig (I.9831
,f
C. brisssae
Tclb
,r
Harlris (1988)
C. elecrans
Tc3
,f
C,
TC6
Colfins t1989) Dxeyfus
electans
et et
et al.
al. al.
and EZmmons
tl.9911 fruit fly
D._ melanosaster
Hbl.
I#
D, mauritania
mariner
‘t
$I._heteroneura
Uhu
Mouse
~mmunoglob~lin
joint
Vk21C
Brierly and Potter (1985) Jacobson et al. (19861 Brezinsky et aI.. (19901 Akira et aI. (1987)
Jkl Mouse
T cell receptor
joint
11
VfDb1.l D/Jbl.l.
Siu et (19841 li
al.
Fig. 1. Invertebrate transposons of the T&like family share terminal sequences similar to the CACAGTC signal heptamer of Vk2lC and other immunoglobulin and T-cell receptor signal sequence joining sites. The immunoglobulin signal heptamer and nonomer are indicated within the Vk2lC sequence. Underlined bases denote terminal nucleotides shared between indicated sequence and the mouse Vk21C signal sequence terminus, which has been chosen as the basis of comparison to other sequences. The TA dinuc~~tide conserved at T&like element insertion sites is denoted with parentheses and corresponding nucteotides are aligned within the signal sequences in order to facilitate sequence compa~son. Bases underlined with a A indicate nucleotides within T&like sequences which are similar to the immunoglobulin nonomer “ACAAAAACC,” atthough these sequences are not highly conserved in the Tel-like elements and do not conform to a fixed spacing from the heptamer.
another vertebrate factor denoted “RAG-I I’ required for the expression of immunoglobuiin recombination (Schatz et al., 1989) is also distinct from that of TcA (analysis not shown). While the structure of sequenced Tel excision sites reviewed in Moerman and Waterston, 1988) is consistent
with either perfect excision of the Tel element or retention of transposon termini at the excision site, the sequence of immunoglobul~n “coding joints” resulting from excision of signal sequences suggests that additional
processing
of the
“coding
joint”
following signal sequence excision (McCo~ack
occurs
et
al.,
809
Viewpoint >< TG~AG~ACTGTGCAGAGTGGTAGTA
Immune
GCCAGCACTGT -___ --__
TC!l
-_----->
consensue
m-----
() formed via joining of the element termini is shown above, as proposed in Ruan and Emmons (1984). The Tci ~ansposition inte~ediate has not been expe~mentally confirmed, and is based upon analogy to tr~sposition pathways characterized for palindromic mobile sequences in prokaryotic species, although indirect evidence suggests that many Tel somatic excision products have such a novel end to end joint (Ruan and Emmons, 1984). Underlined bases in the Tel sequence indicate nucleotides matching the immune consensus. The immunoglobulin novel joint (denoted ) () contains a GC dinucleotide not present in the putative Tel novel joint, however the palindromic symmetry and the sequences flanking the novel joint are conserved.
1989; Lafaille et al., 1989). In addition, while the closed circular products of Tel excision (Rose and Snutch, 1984; Ruan and Emmons, 1984) have been proposed to be transposition intermediates, the products of immunoglobulin somatic excision appear to be end products since unlike Tel elements, signal sequences do not appear to reinsert at other genomic loci. These evident differences between Tel-like somatic excision and immunoglobulin signal sequence directed recombination suggest that two pathways are not identical, although both pathways may share a similar sequence specific binding factor or factors. These observed sequence simila~ties suggest several routes of experimental confirmation. One might predict that sequence of intermediates and mechanism of Tcllike somatic excision and/or transposition (which are currently hypothetical and based solely on analogy to bacterial mobile sequences) would share additional similarities to the corresponding intermediates of i~unoglob~in signal sequence excision. In addition, one would predict that proteins such as TcA which appear to have a role in the ~ansposition of Tel-like sequences in invertebrate species might share a relatedness to protein or proteins in the immunoglobulin excision pathway, and conversely that proteins such as the JkR6 binding factor might have invertebrate relatives in the Tel-like sequence transposition pathway. Acknowledgements-I thank Drs S. W. Emmons, A. Radice, B. Birshstein, S. Hawley, and M. Scharff for their comments on this manuscript. This work was supports by NIH Training Grant T32GM~7288 and by NIH grant GM38174 to S. W. Emmons. REFERENCES Akira S., Okazaki K. and Sakano H. (1987) Two pairs of Recombination Signals are sufficient to cause immunoglobulin V-D-J joining. Science 238, 1134-l 138. Brezinsky L., Gordon V. L., Wang, Humphreys T. and Hunt J. (1990) The transposable element Uhu from Hawaiian ~r~~u~~~~ff-rnern~r of the widely dispersed class of Tel-like transposons. Nucl. Acids Res. 18, 2053-2059. Brierly H. L. and Potter H. S. (1985) Distinct characteristics of loop sequences of two Drosophila foldback transposable elements. Nuci. Acids Res. 13, 485-500.
Collins J., Forbes E. and Anderson F. (1989) The TC3 family of transposable genetic elements in Cae~orhabditis elegms. Genetics 121, 47-55. Dreyfus D. H. and Emmons S. W. (1991) A transposon related palindromic repetitive sequence from Cuenorhabditis Elegans. Nucl. Acids Res. 19, 1871-1877. Emmons S. W., Yesner L., Ruan K. and Katzenberg D. (1983) Evidence for a transposon in Caernohabditis elegans. Cell 32, 55-65. Harris L. J., Baillie D. L. and Rose A. M. (1988) Sequence identity between an inverted repeat family of transposable elements in Drosophila and Cae~orhabditis. Nucl. Acids Res. 16, 5991-5998. Hinds K. R. and Litman G. W. (1986) Major reorganization of immunoglobulin VH segmental elements during vertebrate evolution. Nature 320, 546-549. Hood L., Kronenberg M. and Hunkapillar T. (1985) T cell antigen receptors and the immunoglobulin supergene family. CeN 40, 225-229. Jacobson J. W., Medhora M. M. and Hart1 D. L. (1986) Molecular structure of a somatically unstable transposable element in Drosophila. Proc. natn. Acad. Aci. U.S.A. 83, 8684-8688. Lafaille J. J., DeCloux A., Bonneville M., Takagaki Y. and Tonegowa S. (1989) Junctional sequences of T cell receptor gamma-delta genes: Implications for gamma-delta T cell lineages and for a novel intermediate of V-(D)-J joining. Cell 59, 859-870. Lewis S. and Gellert M. (1989) The mechanism of antigen receptor gene assembly. Cell 59, 585-588. Litman G. W., Berger L., Murphy K., Litman R., Hinds K., and Erickson B. W. (1985) Immunoglobulin VH gene structure and diversity in ~eterodontus, a phylogenetically primitive shark. Proc. Nati. Acad. Aci. U.S.A. 82, 2082-2086. Matsunami N., Hamaguchi Y., Yamamoto Y., Kuze K., Kangawa K., Matsuo H., Kawaichi M. and Honjo T. (1989) A protein binding to the Jkappa recombination sequence of immunoglobulin genes contains a sequence related to the integrase motif. Nature 342, 934-937. McCormack W. T., Tjoelker L. W., Carlson L. M., Petryniak B., Barth C. F., Humphries E. H. and Thompson C. B. (1989) Chicken IGL gene rearrangement involves deletion and addition of single non-random nucfeotides to both coding segments. Ceil 56, 785-791. Moerman D. and Waterston R. (1988) Transposons in C. elegant. In MobiIe DNA (Edited by Berg P. and Howe M.) Am. Sot. Microbial.
810
Viewpoint
Rose A. M. and Snutch T. P. (1984) Isolation of the closed circular form of the transposable element Tel of Cuenorhabditis elegans. Nature 311, 4855486.
Rosenzweig B., Liao L. W. the C. elegans transposable 42014209. Ruan K. S. and Emmons copies of transposon Tel
and Hirsh D. (1983) Sequence of element Tel. Nucl. Acids Res. 11, S. W. (1984) Extrachromosomal in the nematode Cuernorhabditis
elegans. Proc. Natl. Acad. Sci. U.S.A. 81, 40184022.
Sakano H., Huppi K., Heinrich G. and Tonegowa S. (1979) Sequences at the somatic recombination sites of immunoglobulin light-chain genes. Nature 280, 288-294.
Schatz D. G., Oettinger M. A. and Baltimore D. (1989) The V(D)J recombination activating gene, RAG-l. Cell 59, 1035-1048. Schukkink R. F. and Plasterk R. H. A. (1990) TcA, the putative transposase of the C. elegans Tel transposon, has an N-terminal DNA binding domain. Nucl. Acids Res. 18, 895-900.
Siu G., Kronenberg M., Strauss E., Haars R., Mak T. W. and Hood L. (1984) The structure, rearrangement and expression of D-beta gene segments of the murine T-cell antigen receptor. Nature 311, 344350.
