Original Article
Expression of DROSHA in the Uterus of Mice in Early Pregnancy and Its Potential Significance During Embryo Implantation
Reproductive Sciences 1-9 ª The Author(s) 2015 Reprints and permission: sagepub.com/journalsPermissions.nav DOI: 10.1177/1933719115584444 rs.sagepub.com
Cuizhen Zhang, MD1, Xia Long, MD1, Yubin Ding, PhD1, Xuemei Chen, PhD1, Junlin He, MD1, Shangjing Liu, MD2, Yanqing Geng, PhD1, Yingxiong Wang, MD1, and Xueqing Liu, MD3
Abstract Previous studies have shown that microRNAs are involved in the process of implantation. They play an important role in cell growth and proliferation. DROSHA is the microRNA-processing enzyme and is required for the maturation of microRNAs. However, its expression and function during early pregnancy in mice still remain unclear. In the present study, we analyzed the expression pattern of DROSHA in the mouse uterus during early pregnancy, pseudopregnancy, artificially induced decidualization, and in the ovariectomized mouse uterus using real-time quantitative polymerase chain reaction, Western blotting analyses, and immunohistochemistry. We found that DROSHA was spatiotemporally expressed in decidualizing stromal cells during early pregnancy and in pseudopregnant mice in which decidualization was artificially induced. In the ovariectomized mouse uterus, the expression of DROSHA was upregulated after progesterone treatment. In a stromal cell culture model, the expression of DROSHA gradually increased with the progression of stromal decidualization. Taken together, our findings suggest that DROSHA is involved in stromal decidualization and may play an important role in embryo implantation in mice. Keywords DROSHA, microRNA, embryo implantation
Introduction It is generally accepted that successful implantation is the result of reciprocal interactions between the implantationcompetent blastocyst and receptive uterus. The endometrium is known to become receptive only for short periods in rodents; the timely arrival of the embryo at a receptive endometrium is crucial.1-5 More importantly, the maintenance and progression of decidualization in uterus are essential for implication.6 The implantation process is controlled by a number of complex molecules, such as hormones, cytokines, and growth factors.7-11 However, in addition to hormones and cytokines, recent reports have shown that microRNAs (miRNAs) are also involved in the process of implantation.12-14 MicroRNAs are a class of endogenous 21 to 24 noncoding small RNAs that are highly conserved and regulate and affect a variety of biological processes, including development, tissue morphogenesis, maintenance of tissue identity, cell growth, differentiation, apoptosis, and metabolism.15-17 DICER and DROSHA are miRNA-processing enzymes that are required for the maturation of miRNAs.18,19 Cumulative studies have investigated the role of DROSHA and DICER in a variety of cancers, including breast, lung, ovarian, colorectal, and esophageal cancer.20-26 On the female reproduction, death of early embryos and
abnormal structure and function of the female reproductive system are observed after Dicer is knocked out in the mice.27 However, the expression of Drosha in mouse uteri and its role in the process of embryo implantation are still unclear. Our microarray analysis of messenger RNA (mRNA) expression revealed that Drosha mRNA in the mouse uterus at implantation sites (ISs) was significantly higher than that at interimplantation sites (IISs). We hypothesized that Drosha plays an important role in embryo implantation in mice. Here, we investigated the expression pattern of DROSHA in mouse uteri during early pregnancy, pseudopregnancy, and in artificially induced decidualization stromal cells. In addition, we investigated
1 Laboratory of Reproductive Biology, School of Public Health, Chongqing Medical University, Yuzhong District, Chongqing, People’s Republic of China 2 Graduate School of Chongqing Medical University, Yuzhong District, Chongqing, People’s Republic of China 3 Chongqing Medical University, Yuzhong District, Chongqing, People’s Republic of China
Corresponding Author: Xueqing Liu, Chongqing Medical University, No.1 Yixueyuan Rd, Chongqing, 400016, People’s Republic of China. Email: [email protected]
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
2
Reproductive Sciences
whether P4 and E2 regulated the expression of DROSHA. Taken together, these results suggested that DROSHA plays an important role during the implantation process.
Table 1. Primer Sequences for qPCR. Gene
Sequence of primers 50 to 30
Drosha
Forward ATGCAAGGCAATACGTGTCAT Reverse TTTTGGGGTCTGAAAGCTGGT Forward CGAGCCTCCTACTTCCAGTG Reverse GGACAGGTAGCGATCCAGGT Forward ATCAGCCCATCCTGTGGAAC Reverse TGCAGCTAATCTCTCTAGCACTT Forward CCTGAGGCTCTTTTCCAGCC Reverse TAGAGGTCTTTACGGATGTCAACGT
Materials and Methods
CyclinD3
Animals and Tissue Collection
Igfbp1
Eight-week-old female and male Kunming mice (25-30 g) were purchased from the Animal Facility of Chongqing Medical University (Certification No.: SCXK [YU] 20070001). The animal procedures were performed according to the Ethics Committee of Chongqing Medical University. The mice used in this study were maintained in the no specific pathogenfree room in the experimental animal center of Chongqing Medical University. All animals involved in experiments were fed with laboratory chow and water under a constant photoperiod (12:12-hour light–dark cycle). Female mice were caged with fertile males or vasectomized males (2 weeks after vasectomy) to induce pregnancy or pseudopregnancy models,28 and the appearance of the vaginal plug was designated as day 1 (d1) of gestation. The pregnant mice were randomly assigned to 7 groups (d1-d7), and the pseudopregnant mice were also assigned to 7 groups (Pd1-Pd7), which consisted of 10 mice per group, with an additional 10 nonpregnant mice (d0 or Pd0) used as controls. The mice in each group were killed at 08:00–09:00 AM, and part of the mouse endometrial tissue was collected and stored in liquid nitrogen for real-time quantitative polymerase chain reaction (qPCR) and Western blotting (WB) analyses. The remaining part of the uterine tissue was fixed in 4% paraformaldehyde for immunohistochemistry (IHC). The tissues of 10 mice in each group were divided into 3 tissue pools with the uteri of 3 or 4 mice to meet the needs for qPCR and WB. Collection of the tissues from the IS and IIS was performed according to a previous report.16 The ISs on d5 of pregnancy were identified by intravenous injection via the tail vein with 0.1 mL 1% Chicago blue (Sigma-Aldrich, St. Louis, Missouri). Artificial decidualization was induced by intraluminal injections of corn oil (10 mL/mouse) in 1 uterine horn on d4 of pseudopregnancy, whereas the contralateral horn without any infusion served as the control. The mice were killed to collect the uteri at d8 of pseudopregnancy, and the decidual reaction was confirmed by increased uterine weight and histological examination.
b-Actin
Steroid Hormone Processing Model To examine the effects of estrogen (E2) and progestogen (P4) on the expression of DROSHA in the uterus, ovariectomized mice were treated with subcutaneous injections of corn oil (0.1 mL/mouse), E2 (100 ng/mouse), and Fulvestrant (ICI 182 780) (0.5 mg/mouse; Tocris Cookson, Inc, Ballwin, Missouri) 1 hour before E2 injection and P4 (2 mg/mouse) and RU486 (progesterone [PR] antagonist; 2 mg/mouse; M8046, Sigma). The mice were killed, and the uteri were collected at 6 hours after each treatment.
Abbreviations: qPCR, quantitative polymerase chain reaction.
Real-Time qPCR Total RNA was extracted from the mouse endometrial tissues using RNAiso Plus Reagent (Takara, China) according to the manufacturer’s protocol. Quantification and purity were assessed by optical density measurement at 260 nm and 280 nm. The integrity of the total RNA was examined using agarose gel electrophoresis. Reverse transcription was performed in a 20-mL reaction system using the PrimeScript RT Reagent Kit (Takara). The specific primers for Drosha, CyclinD3, Igfbp1, and b-actin for qPCR were designed and synthesized by Sangon Biotech Co. Ltd. (Shanghai, China). The sequences of the primers for qPCR are shown in Table 1. The PCR reaction was performed using the BioRad iQ5 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc, Hercules, California). Experiments were performed in triplicate for each sample, and the 2DDCt method was used to calculate the relative expression of Drosha, CyclinD3, and Igfbp1 in endometria on different pregnancy days with b-actin as an internal control.29
Western Blotting Analyses Proteins were extracted from the endometria of mice from each group using radioimmunoprecipitation assay lysis buffer containing 1% phenylmethylsulfonyl fluoride (Beyotime Biotechnology, China) to prevent protein degradation. Protein concentrations were determined using the bicinchoninic acid (BCA) method according to the manufacturer’s instructions (Beyotime Biotechnology). Protein samples were electrophoresed through 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis gels and then transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, Massachusetts). Immunoblotting was performed using a goat monoclonal DROSHA antibody at a 1:1000 dilution (D28B1; Cell Signaling Technology, Danvers, Massachusetts). A mouse monoclonal b-actin antibody (clone: AC-15) at a 1:2000 dilution (A5441, Sigma) was used to ensure equal loading of the samples. Rabbit anti-goat immunoglobulin (IgG), and goat anti-mouse IgG secondary antibodies were incubated to detect DROSHA and b-actin, respectively. The positive bands were detected by a chemiluminescent reaction (Millipore). Image collection and the densitometry analysis were performed using Quantity One version 4.6.2 analysis software.
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
Zhang et al
3
Immunohistochemistry The tissue sections were deparaffinized in xylene and rehydrated in descending concentrations of ethanol, followed by antigen retrieval and cooling to room temperature (RT). The following experiments were performed using HistostainTMPlus Kits (ZSGB-BIO, China), and a chromogenic reaction was performed with 3,30-diaminobenzidine (ZSGB-BIO) according to the manufacturer’s protocol. The primary antibody used in this study was a rabbit monoclonal DROSHA antibody at a 1:50 dilution (D28B1, CST). As a negative control, the primary antibodies were replaced with phosphate buffered saline. The sections were counterstained with hematoxylin and mounted with resinene. The images were then obtained using an Olympus microscope (BX40, Japan).
Isolation of Uterine Stromal Cells and In Vitro Decidualization Uterine horns from D4 pseudopregnant mice were split longitudinally to expose the uterine lumen. After washing thoroughly with Hanks’ balanced salt solution (HBSS; BOSTER, China), uterine tissues were placed in 5 mL HBSS containing 1% (wt/vol) trypsin (BOSTER) and 6 mg/mL dispase (Roche, Indianapolis, Indiana) for 1 hour at 4 C followed by 1 hour at RT and then 10 minutes at 37 C. The digested uteri were gently shaken to dislodge sheets of luminal epithelial cells. After the supernatant containing sheets of epithelial cells was discarded, the remaining tissues were rinsed 3 times with HBSS and incubated in 2 mL HBSS containing 0.15 mg/mL collagenase I (Invitrogen, Carlsbad, California) at 37 C for 30 minutes. The digested uteri were then vigorously shaken until the supernatant became turbid with dispersed stromal cells. The stromal cells were purified through a 70-mm nylon filter and then centrifuged, and the pellet was washed twice with HBSS and resuspended in complete medium consisting of Dulbecco Modified Eagle medium (DMEM)-nutrient mixture F-12 Ham (DMEM-F12; Sigma) with 10% heat-inactivated fetal bovine serum (FBS, Biological Industries, Inc, Israel). Cells were plated at 2 105 cells per 6-well cell culture plate in phenolred-free culture medium (DMEM/Hams F-12, 1:1) with 10% charcoal-stripped FBS and 10 U/mL penicillin–streptomycin solution (Co222, Beyotime). After incubation for 1 hour, the unattached cells were removed by several washes with fresh phenol red-free culture medium (DMEM/Ham F-12, 1:1), and cell culture was continued after the addition of fresh phenolred-free culture medium (DMEM/Ham’s F-12, 1:1) containing 10% charcoal-stripped FBS, 10 U/mL penicillin–streptomycin solution, 10 nmol/L E2, and 1 mmol/L P4.
Statistical Analysis The collected data were analyzed with SPSS13.0 (Chicago). The relative expression of mRNA and protein between IS and IIS was determined using Student t test. The relative expression of mRNA and protein during early pregnancy and
pseudopregnancy was determined using one-way analysis of variance (ANOVA). The number of ISs after injection was determined using one-way ANOVA. Differences were considered statistically significant if P < .05. Data were expressed as the mean + standard error of the mean.
Results Expression of Drosha in the Uteri During Early Pregnancy To investigate the function of DROSHA, we examined the expression level of Drosha mRNA and protein in endometria using real-time qPCR, IHC, and WB analyses. Our results showed that during early pregnancy, Drosha mRNA levels trended to be upregulated around the implantation window and reached a peak on d6 of pregnancy and were reduced thereafter (Figure 1A). Drosha mRNA levels at ISs were significantly higher than that at IISs on d5 of pregnancy (P < .05; Figure 1B). The DROSHA protein expression pattern was the same as the mRNA (Figure 1C and D).The quantitative figures of Figure 1C and D are shown in Figure 1E and F, respectively. Next, we analyzed the localization of DROSHA in the mouse uterus on d0 to d7 of pregnancy using IHC. Its expression remained at low levels in the uterine epithelium and stromal on d1 to d4 and in the interimplantation tissue on d5 to d7 of pregnancy5 and was mainly in the uterine epithelium on d1 to d4 and in decidualizing stromal cells surrounding the implanted embryo on d5 to d7.
Expression of Drosha in the Uteri During Early Pseudopregnancy To further determine whether the expression of Drosha was induced by competent blastocysts, we examined the expression of Drosha during early pseudopregnancy using real-time qPCR, IHC, and WB analyses. The levels of Drosha mRNA on Pd5 were slightly higher (no significant difference) than that on other pseudopregnant days (P > .05; Figure 2A). The DROSHA protein levels were detected using WB analyses (Figure 2B). The quantitative figure of Figure 2B is shown in Figure 2C. The localization of DROSHA protein during early pseudopregnancy using IHC is shown in Figure 2D. We found that its expression remained at low levels in the uterine epithelium and stroma on days 1 to 7. The protein expression level was consistent with the results obtained from real-time qPCR.
Expression of Drosha is Regulated by P4 in the Mouse Uterus The principal hormones that direct uterine receptivity are ovarian P4 and E2. P4 is essential for implantation and pregnancy maintenance in all mammals studied. We explored the correlation of the presence of DROSHA in the implanting uterus with the steroid hormones E2 and P4. Western blotting analyses revealed that P4 treatment significantly increased the expression of DROSHA compared with corn oil treatment, whereas
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
4
Reproductive Sciences
Figure 1. Expression of Drosha in the uteri during early pregnancy. A, Relative expression of Drosha mRNA from d0 to d7 as determined using qPCR,*P < .05. B, Relative expression of Drosha mRNA at IS and IIS on d5 as determined using qPCR,*P < .05. C, The level of DROSHA protein expression during d0 to d7 examined using WB analyses. b-Actin was used as a control. D, DROSHA relative protein expression at IS and IIS on d5. E, Quantitative presentation of data shown in C,*P < .05. F, Quantitative presentation of data shown in D, *P < .05. G, The localization of DROSHA protein as determined using IHC. The yellowish-brown stain indicates a positive signal. Con indicates the negative control; IS, implantation sites; IIS, interimplantation sites; Le, luminal epithelium; Ge, glandular epithelium; S, stroma; mRNA, messenger RNA; WB, Western blotting; IHC, immunohistochemistry; qPCR, quantitative polymerase chain reaction. (The color version of this figure is available in the online version at http://rs.sagepub.com/.)
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
Zhang et al
5
Figure 2. Expression of Drosha in uteri early pseudopregnancy. A, Relative expression of Drosha mRNA from Pd0 to Pd7 as determined using qPCR. B, The levels of DROSHA protein during Pd0 to Pd7 examined using WB analyses. b-Actin was used as a control. C, Quantitative presentation of data shown in B, *P < .05. D, The localization of DROSHA protein as determined using IHC. The yellowish-brown stain indicates a positive signal. Con indicates the negative control. Le indicates luminal epithelium; Ge, glandular epithelium; S, stroma; mRNA, messenger RNA; WB, Western blotting; IHC, immunohistochemistry; qPCR, quantitative polymerase chain reaction. (The color version of this figure is available in the online version at http://rs.sagepub.com/.)
this induction was significantly blocked by cotreatment with the PR antagonist RU486. Moreover, compared with corn oil treatment, there was no significant difference after E2 treatment (Figure 3A and B). These results indicated that the upregulation of DROSHA after P4 treatment was nuclear PR dependent. Similarly, the localization of DROSHA after steroid hormone processing is shown in Figure 3C. After corn oil and steroid hormone treatment, we found that Drosha was not expressed in the corn oil group. The E2 group showed a small amount of expression in stromal cells and glandular epithelium cells. The expression of Drosha in the P4 and E2 þ P4 groups was significantly stronger than that in the control. After steroid hormone and inhibitor treatment, the expression of Drosha was lower or not expressed. The quantitative figure of Figure 3A is shown in Figure 3B.
Expression of Drosha in the Mouse Uterus During Artificially Induced Decidualization To confirm whether the induction of Drosha expression in decidualizing stromal cells was affected by implanting blastocysts, we examined the expression of DROSHA in artificially induced decidualization. The expression of DROSHA in artificially induced decidualization was higher than that in control (Figure 4A and B). Next, we detected the spatiotemporal expression of DROSHA in the mouse uterus during
artificially induced decidualization using IHC. We found that its expression of DROSHA was higher than that of control. Taken together, these results indicated that DROSHA was involved in stromal cell decidualization. The quantitative figure of Figure 4A is shown in Figure 4B.
Expression of Drosha Increases During Decidualization of Stromal Cells in Culture To further explore the role of Drosha in the decidualization of mouse uterine stromal cells, we established a mouse primary stromal cell culture system. The purity of isolated uterine stromal cells was monitored by vimentin immunofluorescence staining (Figure 5A-C). At 24 to 72 hours after P4 and E2 treatment, stromal cells exhibited the morphological characteristics of mature decidual cells in culture (Figure 5D-F). Western blotting and real-time qPCR analyses revealed the expression of Drosha (Figure 5G and H) and decidualization marker genes including Cyclin D3 (mRNA, Figure 5I) and Igfbp1 (mRNA, Figure 5J), which exhibited a similar upregulation in cultured decidualizing stromal cells. We observed that the expression of Drosha was gradually induced at both the mRNA and protein levels (Figure 5G and H). The progression of decidualization of stromal cells in culture reinforces the idea that DROSHA plays a role during stromal decidualization.
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
6
Reproductive Sciences
Figure 3. Expression of Drosha is regulated by P4 in the mouse uterus. A, The levels of DROSHA protein in the mouse uterus after steroid hormone treatments. b-Actin was used as a control. B, Quantitative presentation of data shown in A, *P < .05. C, The localization of DROSHA protein as determined using IHC. The yellowish-brown stain indicates a positive signal. Con indicates the negative control. Le indicates luminal epithelium; Ge, glandular epithelium; S, stroma; IHC, immunohistochemistry. (The color version of this figure is available in the online version at http://rs.sagepub.com/.)
Figure 4. Expression of Drosha in the mouse uterus during artificially induced decidualization. A, The levels of DROSHA protein in the mouse uterus during artificially induced decidualization as examined using WB analyses. b-Actin was used as a control. B, Quantitative presentation of data shown in A. *P < .05. C, The localization of DROSHA protein as determined using IHC. The yellowish-brown stain indicates a positive signal. Con indicates the negative control. Le indicates luminal epithelium; Ge, glandular epithelium; S, stroma.ID, artificially induced decidualization. DC, decidualization cell; IHC, immunohistochemistry; WB, Western blotting. (The color version of this figure is available in the online version at http://rs.sagepub.com/.) Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
Zhang et al
7
Figure 5. Expression of Drosha increases during decidualization of stromal cells in culture. A-C, Immunocytochemical analysis of VIMENTIN protein in primary stromal cells (DAPI). D-F, Morphology of stromal cells cultured for 24, 48, and 72 hours. G, The levels of DROSHA protein after steroid hormone treatments during decidualization of stromal cells in culture as examined using WB analyses. b-Actin was used as a control. H-J, Relative expression of Drosha, CyclinD3, and Igfbp1 mRNA from 0 to 72 hours after steroid hormone treatment as determined using qPCR,*P < .05. qPCR indicates quantitative polymerase chain reaction; DAPI, 40 ,6-diamidino-2-phenylindole; WB, Western blotting.
Discussion Embryo implantation is a complicated process that requires interaction between the uterus and blastocysts, and differential expression of different genes is crucial for this process. Our data showed that the expression of Drosha mRNA and protein in the endometrium was upregulated and reached a peak on d6 of pregnancy and was reduced thereafter. Drosha mRNA and protein expression levels at ISs were significantly higher than that at IIS on d5 of pregnancy. These data indicated that DROSHA might participate in embryo implantation. Because DROSHA is an miRNA-processing enzyme, which is required for the maturation of miRNAs, and recent reports have shown that miRNAs are involved in implantation by regulating their target genes,30,31 we speculated that DROSHA plays a role in embryo implantation. We examined the expression pattern of DROSHA during implantation and
found that DROSHA was gradually upregulated around the implantation window and reached a peak on d6 of pregnancy and was reduced thereafter. Moreover, the mRNA level at ISs was significantly higher than that at IISs on d5 of pregnancy. To further explore whether the expression of Drosha is induced by competent blastocysts, the expression pattern of Drosha in early pseudopregnancy was investigated and we found that the expression pattern was not obviously different between d4 and d6. We found that the expression of Drosha may not be directly affected by implanted blastocysts. The normal decidualization of uterine stromal cells is necessary for successful embryo implantation because decidual cells provide nutrition to the developing embryo, protect it from maternal immune responses, and regulate trophoblast invasion into the endometrium.32 However, the complexity of this dynamic process makes it difficult to understand the molecular mechanisms governing uterine stromal cell
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
8
Reproductive Sciences
decidualization. In our study, Drosha is expressed in decidualizing stromal cells under artificially induced decidualization. Using an induced decidualization culture system of mouse primary stromal cells, we observed that the expression of DROSHA was strongly increased during the decidualization process. These data showed that DROSHA was involved in decidualization. The principal hormones that direct uterine receptivity are ovarian P4 and E2, and P4 is essential for implantation and pregnancy maintenance in all mammals studied.9,10 Furthermore, timely regulation of the expression of embryonic and maternal endometrial growth factors and cytokines plays a major role in determining the fate of the embryo.1-5,7 Some research has shown that E2 and PR P4 mediate uterine epithelial-stromal crosstalk to promote embryo implantation33 and that P4 regulates a number of genes in both the uterine epithelium and stroma, which mediate this crosstalk to regulate embryo implantation.34 Our results showed that the expression of Drosha was mainly localized in the uterine epithelium during d1 to d4 and in the stroma around the IS during d5 to d7. Thus, we examined the effect of E2 and P4 on DROSHA expression in the mouse uterus after steroid hormone treatments. We found that the expression of DROSHA in uteri was upregulated by P4 treatment in ovariectomized mice. These findings provided direct evidence that DROSHA is regulated by P4 and showed that the decidualization process is dependent mainly on PR signaling pathways and is regulated by various molecular and genetic pathways.35 After isolation of uterine stromal cells and in vitro decidualization, we found that Drosha plays a role in the decidualization process with the passage of time. Embryo implantation requires a reciprocal interaction between the blastocyst and endometrium and is associated with complicated regulatory mechanisms. Since their discovery, miRNAs have become prominent regulatory candidates, providing missing links for many biological pathways.36 MicroRNAs have been shown to regulate the expression of a large number of genes and play key roles in many biological processes, such as proliferation, differentiation, and apoptosis.37 Thus, we speculated that when the process of implantation occurs, the organism requires a large number of miRNAs to ensure a perfect pregnancy. DROSHA might play an important role in early pregnancy as a critical enzyme essential for posttranscriptional miRNA processing. The possible function pathway of Drosha in embryo implantation is as follows:
Overall, we found that Drosha exhibited spatial-temporal expression in the mouse uterus and that its expression at ISs was higher than that at IISs on d5. Our experiments also showed that the expression of DROSHA was regulated by P4 in the mouse uterus and participated in decidualization. Taken together, these findings suggest that DROSHA plays a role in the process of embryo implantation in mice. Acknowledgments The authors would like to thank all of the members in our research group for their technical support.
Declaration of Conflicting Interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Science and Technology Commission of Yuzhong District, Chongqing, China (number: 20130125).
References 1. Singh M, Chaudhry P, Asselin E. Bridging endometrial receptivity and implantation: network of hormones, cytokines, and growth factors. J Endocrinol. 2011;210(1):5-14. 2. Horne AW, White JO, Lalani EN. The endometrium and embryo implantation. A receptive endometrium depends on more than hormonal influences. BMJ. 2000;321(7272):1301-1302. 3. Ma WG, Song H, Das SK, Paria BC, Dey SK. Estrogen is a critical determinant that specifies the duration of the window of uterine receptivity for implantation. Proc Natl Acad Sci U S A. 2003;100(5):2963-2968. 4. Achache H, Revel A. Endometrial receptivity markers, the journey to successful embryo implantation. Hum Reprod Update. 2006;12(6):731-746. 5. Bazer FW, Spencer TE, Johnson GA, Burghardt RC, Wu G. Comparative aspects of implantation. Reproduction. 2009; 138(2):195-209. 6. Large MJ, Wetendorf M, Lanz RB, et al. The epidermal growth factor receptor critically regulates endometrial function during early pregnancy. PLoS Genet. 2014;10(6):e1004451. 7. Rashid NA, Lalitkumar S, Lalitkumar PG, Gemzell-Danielsson K. Endometrial receptivity and human embryo implantation. Am J Reprod Immunol. 2011;(66 suppl 1):23-30. 8. Schafer-Somi S. Cytokines during early pregnancy of mammals: a review. Anim Reprod Sci. 2003;75(1-2):73-94. 9. Makrigiannakis A, Minas V, Kalantaridou SN, Nikas G, Chrousos GP. Hormonal and cytokine regulation of early implantation. Trends Endocrinol Metab. 2006;17(5):178-185. 10. Salehnia M, Zavareh S. The effects of progesterone on oocyte maturation and embryo development. Int J Fertil Steril. 2013; 7(2):74-81. 11. Guzeloglu-Kayisli O, Kayisli UA, Taylor HS. The role of growth factors and cytokines during implantation: endocrine and paracrine interactions. Semin Reprod Med. 2009;27(1):62-79.
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
Zhang et al
9
12. Galliano D, Pellicer A. MicroRNA and implantation. Fertil Steril. 2014;101(6):1531-1544. 13. Geng Y, He J, Ding Y, et al. The differential expression of MicroRNAs between implantation sites and interimplantation sites in early pregnancy in mice and their potential functions. Reprod Sci. 2014;21(10):1296-1306. 14. Hu SJ, Ren G, Liu JL, et al. MicroRNA expression and regulation in mouse uterus during embryo implantation. J Biol Chem. 2008; 283(34):23473-23484. 15. Chakrabarty A, Tranguch S, Daikoku T, Jensen K, Furneaux H, Dey SK. MicroRNA regulation of cyclooxygenase-2 during embryo implantation. Proc Natl Acad Sci U S A. 2007;104(38): 15144-15149. 16. Ma XH, Hu SJ, Ni H, et al. Serial analysis of gene expression in mouse uterus at the implantation site. J Biol Chem. 2006;281(14): 9351-9360. 17. Felekkis K, Touvana E, Stefanou C, Deltas C. microRNAs: a newly described class of encoded molecules that play a role in health and disease. Hippokratia. 2010;14(4):236-240. 18. Kuehbacher A, Urbich C, Zeiher AM, Dimmeler S. Role of Dicer and Drosha for endothelial microRNA expression and angiogenesis. Circ Res. 2007;101(1):59-68. 19. Blahna MT, Hata A. Regulation of miRNA biogenesis as an integrated component of growth factor signaling. Curr Opin Cell Biol. 2013;25(2):233-240. 20. Gregory RI, Shiekhattar R. MicroRNA biogenesis and cancer. Cancer Res. 2005;65(9):3509-3512. 21. Chiosea S, Jelezcova E, Chandran U, et al. Up-regulation of dicer, a component of the MicroRNA machinery, in prostate adenocarcinoma. Am J Pathol. 2006;169(5):1812-1820. 22. Kumar MS, Lu J, Mercer KL, Golub TR, Jacks T. Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nat Genet. 2007;39(5):673-677. 23. Karube Y, Tanaka H, Osada H, et al. Reduced expression of Dicer associated with poor prognosis in lung cancer patients. Cancer Sci. 2005;96(2):111-115. 24. Thomson JM, Newman M, Parker JS, Morin-Kensicki EM, Wright T, Hammond SM. Extensive post-transcriptional regulation of
25.
26.
27.
28. 29.
30.
31.
32.
33. 34.
35.
36.
37.
microRNAs and its implications for cancer. Genes Dev. 2006; 20(16):2202-2207. Merritt WM, Lin YG, Han LY, et al. Dicer, Drosha, and outcomes in patients with ovarian cancer. N Engl J Med. 2008;359(25): 2641-2650. Muralidhar B, Goldstein LD, Ng G, et al. Global microRNA profiles in cervical squamous cell carcinoma depend on Drosha expression levels. J Pathol. 2007;212(4):368-377. Gonzalez G, Behringer RR. Dicer is required for female reproductive tract development and fertility in the mouse. Mol Reprod Dev. 2009;76(7):678-688. Chen X, He J, Ding Y, et al. The role of MTOR in mouse uterus during embryo implantation. Reproduction. 2009;138(2):351-356. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-408. Liu JL, Su RW, Yang ZM. Differential expression profiles of mRNAs, miRNAs and proteins during embryo implantation. Front Biosci (Schol Ed). 2011;3:1511-1519. Su RW, Lei W, Liu JL, et al. The integrative analysis of microRNA and mRNA expression in mouse uterus under delayed implantation and activation. PLoS One. 2010;5(11):e15513. Zhang L, Guo W, Chen Q, Fan X, Zhang Y, Duan E. Adam12 plays a role during uterine decidualization in mice. Cell Tissue Res. 2009;338(3):413-421. Wang H, Dey SK. Roadmap to embryo implantation: clues from mouse models. Nat Rev Genet. 2006;7(3):185-199. Large MJ, DeMayo FJ. The regulation of embryo implantation and endometrial decidualization by progesterone receptor signaling. Mol Cell Endocrinol. 2012;358(2):155-165. Ramathal CY, Bagchi IC, Taylor RN, Bagchi MK. Endometrial decidualization: of mice and men. Semin Reprod Med. 2010; 28(1):17-26. Dior UP, Kogan L, Chill HH, Eizenberg N, Simon A, Revel A. Emerging roles of microRNA in the embryo-endometrium cross talk. Semin Reprod Med. 2014;32(5):402-409. Ha TY. MicroRNAs in human diseases: from cancer to cardiovascular disease. Immune Netw. 2011;11(3):135-154.
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
Expression of DROSHA in the Uterus of Mice in Early Pregnancy and Its Potential Significance During Embryo Implantation
Reproductive Sciences 1-9 ª The Author(s) 2015 Reprints and permission: sagepub.com/journalsPermissions.nav DOI: 10.1177/1933719115584444 rs.sagepub.com
Cuizhen Zhang, MD1, Xia Long, MD1, Yubin Ding, PhD1, Xuemei Chen, PhD1, Junlin He, MD1, Shangjing Liu, MD2, Yanqing Geng, PhD1, Yingxiong Wang, MD1, and Xueqing Liu, MD3
Abstract Previous studies have shown that microRNAs are involved in the process of implantation. They play an important role in cell growth and proliferation. DROSHA is the microRNA-processing enzyme and is required for the maturation of microRNAs. However, its expression and function during early pregnancy in mice still remain unclear. In the present study, we analyzed the expression pattern of DROSHA in the mouse uterus during early pregnancy, pseudopregnancy, artificially induced decidualization, and in the ovariectomized mouse uterus using real-time quantitative polymerase chain reaction, Western blotting analyses, and immunohistochemistry. We found that DROSHA was spatiotemporally expressed in decidualizing stromal cells during early pregnancy and in pseudopregnant mice in which decidualization was artificially induced. In the ovariectomized mouse uterus, the expression of DROSHA was upregulated after progesterone treatment. In a stromal cell culture model, the expression of DROSHA gradually increased with the progression of stromal decidualization. Taken together, our findings suggest that DROSHA is involved in stromal decidualization and may play an important role in embryo implantation in mice. Keywords DROSHA, microRNA, embryo implantation
Introduction It is generally accepted that successful implantation is the result of reciprocal interactions between the implantationcompetent blastocyst and receptive uterus. The endometrium is known to become receptive only for short periods in rodents; the timely arrival of the embryo at a receptive endometrium is crucial.1-5 More importantly, the maintenance and progression of decidualization in uterus are essential for implication.6 The implantation process is controlled by a number of complex molecules, such as hormones, cytokines, and growth factors.7-11 However, in addition to hormones and cytokines, recent reports have shown that microRNAs (miRNAs) are also involved in the process of implantation.12-14 MicroRNAs are a class of endogenous 21 to 24 noncoding small RNAs that are highly conserved and regulate and affect a variety of biological processes, including development, tissue morphogenesis, maintenance of tissue identity, cell growth, differentiation, apoptosis, and metabolism.15-17 DICER and DROSHA are miRNA-processing enzymes that are required for the maturation of miRNAs.18,19 Cumulative studies have investigated the role of DROSHA and DICER in a variety of cancers, including breast, lung, ovarian, colorectal, and esophageal cancer.20-26 On the female reproduction, death of early embryos and
abnormal structure and function of the female reproductive system are observed after Dicer is knocked out in the mice.27 However, the expression of Drosha in mouse uteri and its role in the process of embryo implantation are still unclear. Our microarray analysis of messenger RNA (mRNA) expression revealed that Drosha mRNA in the mouse uterus at implantation sites (ISs) was significantly higher than that at interimplantation sites (IISs). We hypothesized that Drosha plays an important role in embryo implantation in mice. Here, we investigated the expression pattern of DROSHA in mouse uteri during early pregnancy, pseudopregnancy, and in artificially induced decidualization stromal cells. In addition, we investigated
1 Laboratory of Reproductive Biology, School of Public Health, Chongqing Medical University, Yuzhong District, Chongqing, People’s Republic of China 2 Graduate School of Chongqing Medical University, Yuzhong District, Chongqing, People’s Republic of China 3 Chongqing Medical University, Yuzhong District, Chongqing, People’s Republic of China
Corresponding Author: Xueqing Liu, Chongqing Medical University, No.1 Yixueyuan Rd, Chongqing, 400016, People’s Republic of China. Email: [email protected]
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
2
Reproductive Sciences
whether P4 and E2 regulated the expression of DROSHA. Taken together, these results suggested that DROSHA plays an important role during the implantation process.
Table 1. Primer Sequences for qPCR. Gene
Sequence of primers 50 to 30
Drosha
Forward ATGCAAGGCAATACGTGTCAT Reverse TTTTGGGGTCTGAAAGCTGGT Forward CGAGCCTCCTACTTCCAGTG Reverse GGACAGGTAGCGATCCAGGT Forward ATCAGCCCATCCTGTGGAAC Reverse TGCAGCTAATCTCTCTAGCACTT Forward CCTGAGGCTCTTTTCCAGCC Reverse TAGAGGTCTTTACGGATGTCAACGT
Materials and Methods
CyclinD3
Animals and Tissue Collection
Igfbp1
Eight-week-old female and male Kunming mice (25-30 g) were purchased from the Animal Facility of Chongqing Medical University (Certification No.: SCXK [YU] 20070001). The animal procedures were performed according to the Ethics Committee of Chongqing Medical University. The mice used in this study were maintained in the no specific pathogenfree room in the experimental animal center of Chongqing Medical University. All animals involved in experiments were fed with laboratory chow and water under a constant photoperiod (12:12-hour light–dark cycle). Female mice were caged with fertile males or vasectomized males (2 weeks after vasectomy) to induce pregnancy or pseudopregnancy models,28 and the appearance of the vaginal plug was designated as day 1 (d1) of gestation. The pregnant mice were randomly assigned to 7 groups (d1-d7), and the pseudopregnant mice were also assigned to 7 groups (Pd1-Pd7), which consisted of 10 mice per group, with an additional 10 nonpregnant mice (d0 or Pd0) used as controls. The mice in each group were killed at 08:00–09:00 AM, and part of the mouse endometrial tissue was collected and stored in liquid nitrogen for real-time quantitative polymerase chain reaction (qPCR) and Western blotting (WB) analyses. The remaining part of the uterine tissue was fixed in 4% paraformaldehyde for immunohistochemistry (IHC). The tissues of 10 mice in each group were divided into 3 tissue pools with the uteri of 3 or 4 mice to meet the needs for qPCR and WB. Collection of the tissues from the IS and IIS was performed according to a previous report.16 The ISs on d5 of pregnancy were identified by intravenous injection via the tail vein with 0.1 mL 1% Chicago blue (Sigma-Aldrich, St. Louis, Missouri). Artificial decidualization was induced by intraluminal injections of corn oil (10 mL/mouse) in 1 uterine horn on d4 of pseudopregnancy, whereas the contralateral horn without any infusion served as the control. The mice were killed to collect the uteri at d8 of pseudopregnancy, and the decidual reaction was confirmed by increased uterine weight and histological examination.
b-Actin
Steroid Hormone Processing Model To examine the effects of estrogen (E2) and progestogen (P4) on the expression of DROSHA in the uterus, ovariectomized mice were treated with subcutaneous injections of corn oil (0.1 mL/mouse), E2 (100 ng/mouse), and Fulvestrant (ICI 182 780) (0.5 mg/mouse; Tocris Cookson, Inc, Ballwin, Missouri) 1 hour before E2 injection and P4 (2 mg/mouse) and RU486 (progesterone [PR] antagonist; 2 mg/mouse; M8046, Sigma). The mice were killed, and the uteri were collected at 6 hours after each treatment.
Abbreviations: qPCR, quantitative polymerase chain reaction.
Real-Time qPCR Total RNA was extracted from the mouse endometrial tissues using RNAiso Plus Reagent (Takara, China) according to the manufacturer’s protocol. Quantification and purity were assessed by optical density measurement at 260 nm and 280 nm. The integrity of the total RNA was examined using agarose gel electrophoresis. Reverse transcription was performed in a 20-mL reaction system using the PrimeScript RT Reagent Kit (Takara). The specific primers for Drosha, CyclinD3, Igfbp1, and b-actin for qPCR were designed and synthesized by Sangon Biotech Co. Ltd. (Shanghai, China). The sequences of the primers for qPCR are shown in Table 1. The PCR reaction was performed using the BioRad iQ5 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc, Hercules, California). Experiments were performed in triplicate for each sample, and the 2DDCt method was used to calculate the relative expression of Drosha, CyclinD3, and Igfbp1 in endometria on different pregnancy days with b-actin as an internal control.29
Western Blotting Analyses Proteins were extracted from the endometria of mice from each group using radioimmunoprecipitation assay lysis buffer containing 1% phenylmethylsulfonyl fluoride (Beyotime Biotechnology, China) to prevent protein degradation. Protein concentrations were determined using the bicinchoninic acid (BCA) method according to the manufacturer’s instructions (Beyotime Biotechnology). Protein samples were electrophoresed through 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis gels and then transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, Massachusetts). Immunoblotting was performed using a goat monoclonal DROSHA antibody at a 1:1000 dilution (D28B1; Cell Signaling Technology, Danvers, Massachusetts). A mouse monoclonal b-actin antibody (clone: AC-15) at a 1:2000 dilution (A5441, Sigma) was used to ensure equal loading of the samples. Rabbit anti-goat immunoglobulin (IgG), and goat anti-mouse IgG secondary antibodies were incubated to detect DROSHA and b-actin, respectively. The positive bands were detected by a chemiluminescent reaction (Millipore). Image collection and the densitometry analysis were performed using Quantity One version 4.6.2 analysis software.
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
Zhang et al
3
Immunohistochemistry The tissue sections were deparaffinized in xylene and rehydrated in descending concentrations of ethanol, followed by antigen retrieval and cooling to room temperature (RT). The following experiments were performed using HistostainTMPlus Kits (ZSGB-BIO, China), and a chromogenic reaction was performed with 3,30-diaminobenzidine (ZSGB-BIO) according to the manufacturer’s protocol. The primary antibody used in this study was a rabbit monoclonal DROSHA antibody at a 1:50 dilution (D28B1, CST). As a negative control, the primary antibodies were replaced with phosphate buffered saline. The sections were counterstained with hematoxylin and mounted with resinene. The images were then obtained using an Olympus microscope (BX40, Japan).
Isolation of Uterine Stromal Cells and In Vitro Decidualization Uterine horns from D4 pseudopregnant mice were split longitudinally to expose the uterine lumen. After washing thoroughly with Hanks’ balanced salt solution (HBSS; BOSTER, China), uterine tissues were placed in 5 mL HBSS containing 1% (wt/vol) trypsin (BOSTER) and 6 mg/mL dispase (Roche, Indianapolis, Indiana) for 1 hour at 4 C followed by 1 hour at RT and then 10 minutes at 37 C. The digested uteri were gently shaken to dislodge sheets of luminal epithelial cells. After the supernatant containing sheets of epithelial cells was discarded, the remaining tissues were rinsed 3 times with HBSS and incubated in 2 mL HBSS containing 0.15 mg/mL collagenase I (Invitrogen, Carlsbad, California) at 37 C for 30 minutes. The digested uteri were then vigorously shaken until the supernatant became turbid with dispersed stromal cells. The stromal cells were purified through a 70-mm nylon filter and then centrifuged, and the pellet was washed twice with HBSS and resuspended in complete medium consisting of Dulbecco Modified Eagle medium (DMEM)-nutrient mixture F-12 Ham (DMEM-F12; Sigma) with 10% heat-inactivated fetal bovine serum (FBS, Biological Industries, Inc, Israel). Cells were plated at 2 105 cells per 6-well cell culture plate in phenolred-free culture medium (DMEM/Hams F-12, 1:1) with 10% charcoal-stripped FBS and 10 U/mL penicillin–streptomycin solution (Co222, Beyotime). After incubation for 1 hour, the unattached cells were removed by several washes with fresh phenol red-free culture medium (DMEM/Ham F-12, 1:1), and cell culture was continued after the addition of fresh phenolred-free culture medium (DMEM/Ham’s F-12, 1:1) containing 10% charcoal-stripped FBS, 10 U/mL penicillin–streptomycin solution, 10 nmol/L E2, and 1 mmol/L P4.
Statistical Analysis The collected data were analyzed with SPSS13.0 (Chicago). The relative expression of mRNA and protein between IS and IIS was determined using Student t test. The relative expression of mRNA and protein during early pregnancy and
pseudopregnancy was determined using one-way analysis of variance (ANOVA). The number of ISs after injection was determined using one-way ANOVA. Differences were considered statistically significant if P < .05. Data were expressed as the mean + standard error of the mean.
Results Expression of Drosha in the Uteri During Early Pregnancy To investigate the function of DROSHA, we examined the expression level of Drosha mRNA and protein in endometria using real-time qPCR, IHC, and WB analyses. Our results showed that during early pregnancy, Drosha mRNA levels trended to be upregulated around the implantation window and reached a peak on d6 of pregnancy and were reduced thereafter (Figure 1A). Drosha mRNA levels at ISs were significantly higher than that at IISs on d5 of pregnancy (P < .05; Figure 1B). The DROSHA protein expression pattern was the same as the mRNA (Figure 1C and D).The quantitative figures of Figure 1C and D are shown in Figure 1E and F, respectively. Next, we analyzed the localization of DROSHA in the mouse uterus on d0 to d7 of pregnancy using IHC. Its expression remained at low levels in the uterine epithelium and stromal on d1 to d4 and in the interimplantation tissue on d5 to d7 of pregnancy5 and was mainly in the uterine epithelium on d1 to d4 and in decidualizing stromal cells surrounding the implanted embryo on d5 to d7.
Expression of Drosha in the Uteri During Early Pseudopregnancy To further determine whether the expression of Drosha was induced by competent blastocysts, we examined the expression of Drosha during early pseudopregnancy using real-time qPCR, IHC, and WB analyses. The levels of Drosha mRNA on Pd5 were slightly higher (no significant difference) than that on other pseudopregnant days (P > .05; Figure 2A). The DROSHA protein levels were detected using WB analyses (Figure 2B). The quantitative figure of Figure 2B is shown in Figure 2C. The localization of DROSHA protein during early pseudopregnancy using IHC is shown in Figure 2D. We found that its expression remained at low levels in the uterine epithelium and stroma on days 1 to 7. The protein expression level was consistent with the results obtained from real-time qPCR.
Expression of Drosha is Regulated by P4 in the Mouse Uterus The principal hormones that direct uterine receptivity are ovarian P4 and E2. P4 is essential for implantation and pregnancy maintenance in all mammals studied. We explored the correlation of the presence of DROSHA in the implanting uterus with the steroid hormones E2 and P4. Western blotting analyses revealed that P4 treatment significantly increased the expression of DROSHA compared with corn oil treatment, whereas
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
4
Reproductive Sciences
Figure 1. Expression of Drosha in the uteri during early pregnancy. A, Relative expression of Drosha mRNA from d0 to d7 as determined using qPCR,*P < .05. B, Relative expression of Drosha mRNA at IS and IIS on d5 as determined using qPCR,*P < .05. C, The level of DROSHA protein expression during d0 to d7 examined using WB analyses. b-Actin was used as a control. D, DROSHA relative protein expression at IS and IIS on d5. E, Quantitative presentation of data shown in C,*P < .05. F, Quantitative presentation of data shown in D, *P < .05. G, The localization of DROSHA protein as determined using IHC. The yellowish-brown stain indicates a positive signal. Con indicates the negative control; IS, implantation sites; IIS, interimplantation sites; Le, luminal epithelium; Ge, glandular epithelium; S, stroma; mRNA, messenger RNA; WB, Western blotting; IHC, immunohistochemistry; qPCR, quantitative polymerase chain reaction. (The color version of this figure is available in the online version at http://rs.sagepub.com/.)
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
Zhang et al
5
Figure 2. Expression of Drosha in uteri early pseudopregnancy. A, Relative expression of Drosha mRNA from Pd0 to Pd7 as determined using qPCR. B, The levels of DROSHA protein during Pd0 to Pd7 examined using WB analyses. b-Actin was used as a control. C, Quantitative presentation of data shown in B, *P < .05. D, The localization of DROSHA protein as determined using IHC. The yellowish-brown stain indicates a positive signal. Con indicates the negative control. Le indicates luminal epithelium; Ge, glandular epithelium; S, stroma; mRNA, messenger RNA; WB, Western blotting; IHC, immunohistochemistry; qPCR, quantitative polymerase chain reaction. (The color version of this figure is available in the online version at http://rs.sagepub.com/.)
this induction was significantly blocked by cotreatment with the PR antagonist RU486. Moreover, compared with corn oil treatment, there was no significant difference after E2 treatment (Figure 3A and B). These results indicated that the upregulation of DROSHA after P4 treatment was nuclear PR dependent. Similarly, the localization of DROSHA after steroid hormone processing is shown in Figure 3C. After corn oil and steroid hormone treatment, we found that Drosha was not expressed in the corn oil group. The E2 group showed a small amount of expression in stromal cells and glandular epithelium cells. The expression of Drosha in the P4 and E2 þ P4 groups was significantly stronger than that in the control. After steroid hormone and inhibitor treatment, the expression of Drosha was lower or not expressed. The quantitative figure of Figure 3A is shown in Figure 3B.
Expression of Drosha in the Mouse Uterus During Artificially Induced Decidualization To confirm whether the induction of Drosha expression in decidualizing stromal cells was affected by implanting blastocysts, we examined the expression of DROSHA in artificially induced decidualization. The expression of DROSHA in artificially induced decidualization was higher than that in control (Figure 4A and B). Next, we detected the spatiotemporal expression of DROSHA in the mouse uterus during
artificially induced decidualization using IHC. We found that its expression of DROSHA was higher than that of control. Taken together, these results indicated that DROSHA was involved in stromal cell decidualization. The quantitative figure of Figure 4A is shown in Figure 4B.
Expression of Drosha Increases During Decidualization of Stromal Cells in Culture To further explore the role of Drosha in the decidualization of mouse uterine stromal cells, we established a mouse primary stromal cell culture system. The purity of isolated uterine stromal cells was monitored by vimentin immunofluorescence staining (Figure 5A-C). At 24 to 72 hours after P4 and E2 treatment, stromal cells exhibited the morphological characteristics of mature decidual cells in culture (Figure 5D-F). Western blotting and real-time qPCR analyses revealed the expression of Drosha (Figure 5G and H) and decidualization marker genes including Cyclin D3 (mRNA, Figure 5I) and Igfbp1 (mRNA, Figure 5J), which exhibited a similar upregulation in cultured decidualizing stromal cells. We observed that the expression of Drosha was gradually induced at both the mRNA and protein levels (Figure 5G and H). The progression of decidualization of stromal cells in culture reinforces the idea that DROSHA plays a role during stromal decidualization.
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
6
Reproductive Sciences
Figure 3. Expression of Drosha is regulated by P4 in the mouse uterus. A, The levels of DROSHA protein in the mouse uterus after steroid hormone treatments. b-Actin was used as a control. B, Quantitative presentation of data shown in A, *P < .05. C, The localization of DROSHA protein as determined using IHC. The yellowish-brown stain indicates a positive signal. Con indicates the negative control. Le indicates luminal epithelium; Ge, glandular epithelium; S, stroma; IHC, immunohistochemistry. (The color version of this figure is available in the online version at http://rs.sagepub.com/.)
Figure 4. Expression of Drosha in the mouse uterus during artificially induced decidualization. A, The levels of DROSHA protein in the mouse uterus during artificially induced decidualization as examined using WB analyses. b-Actin was used as a control. B, Quantitative presentation of data shown in A. *P < .05. C, The localization of DROSHA protein as determined using IHC. The yellowish-brown stain indicates a positive signal. Con indicates the negative control. Le indicates luminal epithelium; Ge, glandular epithelium; S, stroma.ID, artificially induced decidualization. DC, decidualization cell; IHC, immunohistochemistry; WB, Western blotting. (The color version of this figure is available in the online version at http://rs.sagepub.com/.) Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
Zhang et al
7
Figure 5. Expression of Drosha increases during decidualization of stromal cells in culture. A-C, Immunocytochemical analysis of VIMENTIN protein in primary stromal cells (DAPI). D-F, Morphology of stromal cells cultured for 24, 48, and 72 hours. G, The levels of DROSHA protein after steroid hormone treatments during decidualization of stromal cells in culture as examined using WB analyses. b-Actin was used as a control. H-J, Relative expression of Drosha, CyclinD3, and Igfbp1 mRNA from 0 to 72 hours after steroid hormone treatment as determined using qPCR,*P < .05. qPCR indicates quantitative polymerase chain reaction; DAPI, 40 ,6-diamidino-2-phenylindole; WB, Western blotting.
Discussion Embryo implantation is a complicated process that requires interaction between the uterus and blastocysts, and differential expression of different genes is crucial for this process. Our data showed that the expression of Drosha mRNA and protein in the endometrium was upregulated and reached a peak on d6 of pregnancy and was reduced thereafter. Drosha mRNA and protein expression levels at ISs were significantly higher than that at IIS on d5 of pregnancy. These data indicated that DROSHA might participate in embryo implantation. Because DROSHA is an miRNA-processing enzyme, which is required for the maturation of miRNAs, and recent reports have shown that miRNAs are involved in implantation by regulating their target genes,30,31 we speculated that DROSHA plays a role in embryo implantation. We examined the expression pattern of DROSHA during implantation and
found that DROSHA was gradually upregulated around the implantation window and reached a peak on d6 of pregnancy and was reduced thereafter. Moreover, the mRNA level at ISs was significantly higher than that at IISs on d5 of pregnancy. To further explore whether the expression of Drosha is induced by competent blastocysts, the expression pattern of Drosha in early pseudopregnancy was investigated and we found that the expression pattern was not obviously different between d4 and d6. We found that the expression of Drosha may not be directly affected by implanted blastocysts. The normal decidualization of uterine stromal cells is necessary for successful embryo implantation because decidual cells provide nutrition to the developing embryo, protect it from maternal immune responses, and regulate trophoblast invasion into the endometrium.32 However, the complexity of this dynamic process makes it difficult to understand the molecular mechanisms governing uterine stromal cell
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
8
Reproductive Sciences
decidualization. In our study, Drosha is expressed in decidualizing stromal cells under artificially induced decidualization. Using an induced decidualization culture system of mouse primary stromal cells, we observed that the expression of DROSHA was strongly increased during the decidualization process. These data showed that DROSHA was involved in decidualization. The principal hormones that direct uterine receptivity are ovarian P4 and E2, and P4 is essential for implantation and pregnancy maintenance in all mammals studied.9,10 Furthermore, timely regulation of the expression of embryonic and maternal endometrial growth factors and cytokines plays a major role in determining the fate of the embryo.1-5,7 Some research has shown that E2 and PR P4 mediate uterine epithelial-stromal crosstalk to promote embryo implantation33 and that P4 regulates a number of genes in both the uterine epithelium and stroma, which mediate this crosstalk to regulate embryo implantation.34 Our results showed that the expression of Drosha was mainly localized in the uterine epithelium during d1 to d4 and in the stroma around the IS during d5 to d7. Thus, we examined the effect of E2 and P4 on DROSHA expression in the mouse uterus after steroid hormone treatments. We found that the expression of DROSHA in uteri was upregulated by P4 treatment in ovariectomized mice. These findings provided direct evidence that DROSHA is regulated by P4 and showed that the decidualization process is dependent mainly on PR signaling pathways and is regulated by various molecular and genetic pathways.35 After isolation of uterine stromal cells and in vitro decidualization, we found that Drosha plays a role in the decidualization process with the passage of time. Embryo implantation requires a reciprocal interaction between the blastocyst and endometrium and is associated with complicated regulatory mechanisms. Since their discovery, miRNAs have become prominent regulatory candidates, providing missing links for many biological pathways.36 MicroRNAs have been shown to regulate the expression of a large number of genes and play key roles in many biological processes, such as proliferation, differentiation, and apoptosis.37 Thus, we speculated that when the process of implantation occurs, the organism requires a large number of miRNAs to ensure a perfect pregnancy. DROSHA might play an important role in early pregnancy as a critical enzyme essential for posttranscriptional miRNA processing. The possible function pathway of Drosha in embryo implantation is as follows:
Overall, we found that Drosha exhibited spatial-temporal expression in the mouse uterus and that its expression at ISs was higher than that at IISs on d5. Our experiments also showed that the expression of DROSHA was regulated by P4 in the mouse uterus and participated in decidualization. Taken together, these findings suggest that DROSHA plays a role in the process of embryo implantation in mice. Acknowledgments The authors would like to thank all of the members in our research group for their technical support.
Declaration of Conflicting Interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Science and Technology Commission of Yuzhong District, Chongqing, China (number: 20130125).
References 1. Singh M, Chaudhry P, Asselin E. Bridging endometrial receptivity and implantation: network of hormones, cytokines, and growth factors. J Endocrinol. 2011;210(1):5-14. 2. Horne AW, White JO, Lalani EN. The endometrium and embryo implantation. A receptive endometrium depends on more than hormonal influences. BMJ. 2000;321(7272):1301-1302. 3. Ma WG, Song H, Das SK, Paria BC, Dey SK. Estrogen is a critical determinant that specifies the duration of the window of uterine receptivity for implantation. Proc Natl Acad Sci U S A. 2003;100(5):2963-2968. 4. Achache H, Revel A. Endometrial receptivity markers, the journey to successful embryo implantation. Hum Reprod Update. 2006;12(6):731-746. 5. Bazer FW, Spencer TE, Johnson GA, Burghardt RC, Wu G. Comparative aspects of implantation. Reproduction. 2009; 138(2):195-209. 6. Large MJ, Wetendorf M, Lanz RB, et al. The epidermal growth factor receptor critically regulates endometrial function during early pregnancy. PLoS Genet. 2014;10(6):e1004451. 7. Rashid NA, Lalitkumar S, Lalitkumar PG, Gemzell-Danielsson K. Endometrial receptivity and human embryo implantation. Am J Reprod Immunol. 2011;(66 suppl 1):23-30. 8. Schafer-Somi S. Cytokines during early pregnancy of mammals: a review. Anim Reprod Sci. 2003;75(1-2):73-94. 9. Makrigiannakis A, Minas V, Kalantaridou SN, Nikas G, Chrousos GP. Hormonal and cytokine regulation of early implantation. Trends Endocrinol Metab. 2006;17(5):178-185. 10. Salehnia M, Zavareh S. The effects of progesterone on oocyte maturation and embryo development. Int J Fertil Steril. 2013; 7(2):74-81. 11. Guzeloglu-Kayisli O, Kayisli UA, Taylor HS. The role of growth factors and cytokines during implantation: endocrine and paracrine interactions. Semin Reprod Med. 2009;27(1):62-79.
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
Zhang et al
9
12. Galliano D, Pellicer A. MicroRNA and implantation. Fertil Steril. 2014;101(6):1531-1544. 13. Geng Y, He J, Ding Y, et al. The differential expression of MicroRNAs between implantation sites and interimplantation sites in early pregnancy in mice and their potential functions. Reprod Sci. 2014;21(10):1296-1306. 14. Hu SJ, Ren G, Liu JL, et al. MicroRNA expression and regulation in mouse uterus during embryo implantation. J Biol Chem. 2008; 283(34):23473-23484. 15. Chakrabarty A, Tranguch S, Daikoku T, Jensen K, Furneaux H, Dey SK. MicroRNA regulation of cyclooxygenase-2 during embryo implantation. Proc Natl Acad Sci U S A. 2007;104(38): 15144-15149. 16. Ma XH, Hu SJ, Ni H, et al. Serial analysis of gene expression in mouse uterus at the implantation site. J Biol Chem. 2006;281(14): 9351-9360. 17. Felekkis K, Touvana E, Stefanou C, Deltas C. microRNAs: a newly described class of encoded molecules that play a role in health and disease. Hippokratia. 2010;14(4):236-240. 18. Kuehbacher A, Urbich C, Zeiher AM, Dimmeler S. Role of Dicer and Drosha for endothelial microRNA expression and angiogenesis. Circ Res. 2007;101(1):59-68. 19. Blahna MT, Hata A. Regulation of miRNA biogenesis as an integrated component of growth factor signaling. Curr Opin Cell Biol. 2013;25(2):233-240. 20. Gregory RI, Shiekhattar R. MicroRNA biogenesis and cancer. Cancer Res. 2005;65(9):3509-3512. 21. Chiosea S, Jelezcova E, Chandran U, et al. Up-regulation of dicer, a component of the MicroRNA machinery, in prostate adenocarcinoma. Am J Pathol. 2006;169(5):1812-1820. 22. Kumar MS, Lu J, Mercer KL, Golub TR, Jacks T. Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nat Genet. 2007;39(5):673-677. 23. Karube Y, Tanaka H, Osada H, et al. Reduced expression of Dicer associated with poor prognosis in lung cancer patients. Cancer Sci. 2005;96(2):111-115. 24. Thomson JM, Newman M, Parker JS, Morin-Kensicki EM, Wright T, Hammond SM. Extensive post-transcriptional regulation of
25.
26.
27.
28. 29.
30.
31.
32.
33. 34.
35.
36.
37.
microRNAs and its implications for cancer. Genes Dev. 2006; 20(16):2202-2207. Merritt WM, Lin YG, Han LY, et al. Dicer, Drosha, and outcomes in patients with ovarian cancer. N Engl J Med. 2008;359(25): 2641-2650. Muralidhar B, Goldstein LD, Ng G, et al. Global microRNA profiles in cervical squamous cell carcinoma depend on Drosha expression levels. J Pathol. 2007;212(4):368-377. Gonzalez G, Behringer RR. Dicer is required for female reproductive tract development and fertility in the mouse. Mol Reprod Dev. 2009;76(7):678-688. Chen X, He J, Ding Y, et al. The role of MTOR in mouse uterus during embryo implantation. Reproduction. 2009;138(2):351-356. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-408. Liu JL, Su RW, Yang ZM. Differential expression profiles of mRNAs, miRNAs and proteins during embryo implantation. Front Biosci (Schol Ed). 2011;3:1511-1519. Su RW, Lei W, Liu JL, et al. The integrative analysis of microRNA and mRNA expression in mouse uterus under delayed implantation and activation. PLoS One. 2010;5(11):e15513. Zhang L, Guo W, Chen Q, Fan X, Zhang Y, Duan E. Adam12 plays a role during uterine decidualization in mice. Cell Tissue Res. 2009;338(3):413-421. Wang H, Dey SK. Roadmap to embryo implantation: clues from mouse models. Nat Rev Genet. 2006;7(3):185-199. Large MJ, DeMayo FJ. The regulation of embryo implantation and endometrial decidualization by progesterone receptor signaling. Mol Cell Endocrinol. 2012;358(2):155-165. Ramathal CY, Bagchi IC, Taylor RN, Bagchi MK. Endometrial decidualization: of mice and men. Semin Reprod Med. 2010; 28(1):17-26. Dior UP, Kogan L, Chill HH, Eizenberg N, Simon A, Revel A. Emerging roles of microRNA in the embryo-endometrium cross talk. Semin Reprod Med. 2014;32(5):402-409. Ha TY. MicroRNAs in human diseases: from cancer to cardiovascular disease. Immune Netw. 2011;11(3):135-154.
Downloaded from rsx.sagepub.com at WESTERN OREGON UNIVERSITY on June 6, 2015
