Gene 555 (2015) 140–149
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
The homologous genes Vangl1 and Vangl2 are required for embryo implantation in the uterus of mice during early pregnancy☆ Hailing Zhang, Xuemei Chen, Yi Zhao, Rufei Gao, Yanqing Geng, Yubin Ding, Xueqing Liu, Yingxiong Wang, Junlin He ⁎ Laboratory of Reproductive Biology, School of Public Health, Chongqing Medical University, Box 197, No.1 Yixueyuan Road, Yuzhong District, 400016 Chongqing, PR China
a r t i c l e
i n f o
Article history: Received 11 December 2013 Received in revised form 16 July 2014 Accepted 30 October 2014 Available online 1 November 2014 Keywords: Vangl1 Vangl2 Early pregnancy Embryo implantation Mouse
a b s t r a c t Vangl1 and Vangl2 are homologous genes belonging to the group of highly conserved planar cell polarity proteins. It has been shown that Vangl1 and Vangl2 are essential for embryonic development, cell adhesion, migration and polarity. We examined the expression of Vangl1 and Vangl2 in the uterus of mice during early pregnancy. They are upregulated in the endometrium of peri-implantation and reached the peak on D5. Vangl1 mRNA is widely distributed in the luminal epithelium, glandular epithelium and stromal cells in the endometrium, while its protein only appeared in the stromal cells. The localization of Vangl2 protein overlapped with its mRNA. In addition, expression of Vangl1 in the endometrium of pseudopregnant mice was lower than that of pregnant mice, whereas the level of Vangl2 was not significantly different, suggesting that expression of Vangl1 is induced by embryo. Further study showed that implantation would be suppressed after silencing expressions of Vangl1 and Vangl2 by uterine injection with antisense oligonucleotides. These findings suggest that Vangl1 and Vangl2 may play a key role in the embryo implantation of mice. © 2014 Elsevier B.V. All rights reserved.
1. Introduction The Wnt signaling pathway is an ancient and evolutionarily conserved pathway that regulates crucial aspects of cell fate determination, migration, polarity, neural patterning and organogenesis during embryonic development (Komiya and Habas, 2008). The extracellular Wnt signal stimulates several intracellular signal transduction cascades, including the canonical Wnt/β-catenin dependent pathway and the non-canonical β-catenin-independent pathway, which can be divided into the Planar Cell Polarity (PCP) pathway and the Wnt/Ca2+ pathway (Habas and Dawid, 2005). The aberrant expression of Wnt gene, as Wnt5a, Wnt11, and Wnt7a, would result in abnormal implantation and decidual dysfunction in mice (Mericskay et al., 2004). Wnt/βcatenin signaling is crucial for embryo implantation, and the dysregulation of β-catenin would affect glandular formation, decidualization and eventually lead to fertility (Jeong et al., 2009; Mohamed et al., 2005). The Wnt/PCP pathway, which can be stimulated by the non-canonical Wnt ligands, such as Wnt5a or Wnt11, is involved in tissue morphogenesis, directed cell migration, cell adhesion and polarity-cellular
Abbreviations: NTDs, Neural Tube Defects; A-ODNS, antisense oligonucleotides; LE, luminal epithelium; GE, glandular epithelium; S, stromal; DE, decidua; EM, embryo. ☆ Funding: This work was supported by grants from the National Natural Science Foundation of China (Nos. 31271246, 30973195). ⁎ Corresponding author. E-mail address: [email protected] (J. He).
http://dx.doi.org/10.1016/j.gene.2014.10.055 0378-1119/© 2014 Elsevier B.V. All rights reserved.
processes that are required for embryo implantation (Komiya and Habas, 2008; Wu et al., 2011). During embryo implantation, epithelial cells transit from a columnar to cuboidal phenotype approaching implantation, and junctions between neighboring epithelial cells are required to establish and maintain base-apical cell polarity (Etienne-Manneville, 2008; Nallasamy et al., 2012). However, it is unknown whether the Wnt/PCP signaling pathway directly participates in embryo implantation. Mammalian Vangl proteins are highly conserved transmembrane (TM) membrane proteins, and they are composed of four putative TM domains in the N-terminus that were identified in two Vangl homologous genes in each species included Vangl1 and Vangl2 (Kibar et al., 2001). There is N80% consensus in the protein sequence of the cytoplasmic portion of Vangl1 and Vangl2, conferring structural homologies that reflect functional similarity (Torban et al., 2008). Vangl proteins play a key developmental role in the Wnt/PCP signaling pathway as they are constituent proteins in the Frizzled, Disheveled, Flamingo, Prickle, and Diego complexes (Adler, 2002; Mlodzik, 2002), regulating cytoskeleton, cell adhesion, migration, polarity and embryonic development (Wu et al., 2011). Vangl1 is expressed in the developing neural tube, and it is located in the floor plate and notochord (Torban et al., 2008). Vangl2 is expressed in the developing olfactory organs, the bronchial tree and some tube organs (Phillips et al., 2005; Henderson et al., 2006; Torban et al., 2007; Yates et al., 2010a,b). Loss-of-function in Vangl1 and Vangl2 would cause Neural Tube Defects (NTDs) during embryonic development. Recently, four mutation types of Vangl1 were identified in patients with NTDs, including familial types (V239I and
H. Zhang et al. / Gene 555 (2015) 140–149
141
Table 1 Primers of Vangl1, Vangl2 and β-actin for real-time PCR. Gene
GenBank accession no.
Sense primers (5′ → 3′)
Antisense primers(5′ → 3′)
Product size (bp)
Vangl1 Vangl2 β-actin
NM_177545 NM_033509 NM_007393
AAGCAAAGAGCGGATGTG TCAGGGTGACGGTTGACTT CCTGAGGCTCTTTTCCAGCC
CGATGGCAAGGTAGTGGA CTTGTAGGAATAGCCCGAGTA TAGAGGTCTTTACGGATGTCAACGT
196 172 120
R274Q), a sporadic type (M328T) and a spontaneous mutation (V239I) appearing in a familial setting (Reynolds et al., 2010). Furthermore, mutations in Vangl2 were heterozygous in fetuses with a cranial NTD: S84F (737C → T), R353C (1543C → T), and F437S (1796 T → C), with these mutations producing lethal effects on the embryo (Lei et al., 2010). The molecular mechanism for these defects is associated with Vangl1 and Vangl2 in the PCP pathway, directing embryonic convergent extension, polarized cell division, cell differentiation and cilia orientation (Barrow, 2006; Karner et al., 2006). As a principal component of the Wnt/PCP signaling pathway, our aim is to study the role of Vangl1 and Vangl2 in embryo implantation. Because the mechanism of embryo implantation in mice is similar to human (Lee and DeMayo, 2004), mice were employed to carry out the study. We first detected the expression profile of Vangl1 and Vangl2 in the endometrium of pregnant and pseudopregnant mice. Further functional study was performed by uterine injection with antisense oligonucleotides (A-ODNS), and then counted the number of implantation sites to observe the effect of silencing their expression in endometrium on implantation. 2. Materials and methods 2.1. Animal models and experimental design National Institutes of Health mice were obtained from the Animal Facility of Chong Qing Medical University, Chongqing, China (Certificate: SICXK[19] 2007 – 0001). 6–8 week old female mice (25–30 g) were caged in a specific pathogen-free animal room under a controlled environment, with a 14 h light and 10 h dark cycle. The estrus females were mated with fertile males or vasectomized males to induce pregnancy (D1 = day of positive vaginal plug) or pseudopregnancy (PD1 = day of positive vaginal plug). Pregnant mice were divided into six groups (D1, D2, D3, D4, D5 and D6), and pseudopregnant mice were divided into three groups (PD4, PD5 and PD6), (20 mice in each group). 20 pregnant mice on D3 were used for the Vangl1 and Vangl2 functional experiments. The mice in each group were killed in the morning for tissue collection. Trypan blue was injected into the tail veins to identify the implantation sites. Part of the mouse endometria tissue was collected and stored in liquid nitrogen for real-time quantitative polymerase chain reaction (qPCR) and Western blotting (WB), and the rest part of the uteri tissue was fixed in 4% paraformaldehyde and embedded in paraffin for immunohistochemistry (IHC) and in situ hybridization (ISH). All animal procedures were approved by the Ethical Committee of Chongqing Medical University. 2.2. Real-time PCR Total RNA was extracted from mouse endometrial tissues using Trizol reagent (Invitrogen, CA, USA), according to the manufacturer's instructions. Quantification and purity assessment were performed by optical density measurements at 260 and 280 nm. Integrity of the total RNA was examined by agarose gel electrophoresis. Total RNA was converted to cDNA and the expression of Vangl1 in the cDNA samples was determined using a SYBR Primescript™ RT-PCR kit (TAKARA, Dalian, China). β-Actin was used as a reference gene for each sample. Specific primers were designed (Shanghai GeneCore BioTechnologies Co., Ltd, China), and the primer sequences are shown in Table 1. The real-time PCR conditions were as follows: initial denaturation at 95 °C for 10 s,
40 cycles of 15 s at 95 °C (denaturation) and 30 s at 56 °C (annealing and extension). All real-time PCR experiments were repeated three times for each sample. Relative gene expression levels were analyzed using the 2− ΔΔCT method (Schmittgen and Livak, 2008). Expression levels of Vangl1 and Vangl2 were obtained by normalizing the amount of cDNA to that of β-actin.
2.3. In situ hybridization In situ hybridization was performed using a universal digoxigeninlabeled probe hybridization kit (Beijing Dingguo Biosciences Inc., China). According to the manufacturer's instructions, sections (4 μm) were cut, deparaffinized and rehydrated. The endogenous peroxidase activity was quenched by incubation with 0.5% hydrogen peroxide in methanol for 30 min at room temperature, and then incubated with 50 μl proteinase K solution for 10 min at 37 °C. Sections were then washed three times for 3 min each and incubated with 50 μl of prehybridization solution for 3 h at 37 °C. After shaking off excess liquid, sections were incubated with hybridization solution containing 2 μg/ml of the hydridization probe (Invitrogen, CA, USA). The sequences for the digoxigenin-labeled probes for Vangl1 and Vangl2 were as follows: Vangl1: 5′-CCT GCG TTC GTG TTC GGC CTC TTCA TAA TAC AAC TCG TTG-3′; Vangl2: 5′-AGC AGG ATG AGC AGC TTG AAG GCC ACG GAG ATG AAG AGG C-3′ (Liu et al., 2008). Reaction conditions were as follows: initial denaturation at 95 °C for 5 s and overnight at 37 °C. The next day, the section was blocked for 30 min at 37 °C, followed by incubation for 1 h with rabbit anti-digoxin IgG and then incubated for 1 h with AP-Goat anti-rabbit IgG at 37 °C. The reaction product was detected using a BCIP/NBT Chromogenic agent kit (Boster, Wuhan, China). The localization of mRNA was analyzed and quantified using Medical Image Analysis Software (Beihang University, China), blue-violet staining was considered to be a positive signal.
2.4. Western blotting Total proteins were extracted from the mouse endometrium using cell lysis buffer for Western blotting and immunoprecipitation (Beyotime, Jiangsu, China). The protein concentration was measured using the BCA Protein Assay kit (Beyotime, Jiangsu, China). Samples were boiled in 5× SDS sample loading buffer for 10 min and separated by SDS-polyacrylamide gel electrophoresis. The proteins were then transferred electrophoretically onto polyvinylidene difluoride membranes (BioRad, California, USA). The membrane was then blocked for 1 h at room temperature in PBST containing 5% skimmed milk powder. It was then incubated with anti-Vangl1 antibodies (1:500, sc-166844, Santa Cruz), anti-Vangl2 antibodies (1:500, sc-46561, Santa Cruz), or mouse monoclonal anti-β-actin antibodies (1:500,ZA-09,Zhongshan Golden Bridge Biotechnology Co., LTD., Beijing) overnight at 4 °C. Next, the membranes were washed for four times with PBST (5 min each time), followed by incubation for 1 h with a secondary antibody conjugated with horseradish peroxidase (Zhongshan Golden Bridge Biotechnology Co., LTD., Beijing). The membranes were washed three times in PBST and the antibodies were detected by enhanced chemiluminescence (ECL) using the appropriate ECL reagents (Merck Millipore, USA), and quantified by densitometry using Quantity One software (BioRad, California, USA).
142
H. Zhang et al. / Gene 555 (2015) 140–149
H. Zhang et al. / Gene 555 (2015) 140–149
143
Fig. 2. The protein levels of Vangl1 and Vangl2 during D1 to D6 of pregnancy in the mouse uterus. Immunohistochemistry analysis of Vangl1 (A) and Vangl2 (B) proteins in the mouse uterus. Yellowish-brown staining was considered to be positive. CON: negative control; LE: luminal epithelium; GE: glandular epithelium; S: stromal; EM: embryo; DE: decidua; scale bar = 100 μm. (C) Western blot analysis of Vangl1 and Vangl2 proteins in the uterus during early pregnancy. Expression levels of β-actin were used as loading control.
Fig. 1. Vangl1 and Vangl2 mRNA levels during D1 to D6 of pregnancy in the mouse uterus. (A) Real-time PCR analysis of Vangl1 and Vangl2 mRNA. β-actin was used as a reference gene (*P b 0.05 vs D1). The location of Vangl1 mRNA (B) and Vangl2 mRNA (C) was examined by in situ hybridization using DIG-labeled oligonucleotides. CON: negative control; LE: luminal epithelium; GE: glandular epithelium; S: stromal; DE: decidua; scale bar = 100 μm.
144
H. Zhang et al. / Gene 555 (2015) 140–149
2.5. Immunohistochemistry The uteri of mice were fixed immediately in 4% paraformaldehyde and embedded in paraffin. 4 μm sections were made and their endogenous peroxidase activity was quenched by incubation with 3% H2O2 for 10 min, followed by rinsing with PBS. Antigen retrieval was performed by incubating the sections in 0.01 M citrate buffer (pH 6.0) at 95 °C for 15 min, followed by cooling at room temperature for 25 min. Nonspecific binding was blocked with 10% (v/v) normal goat serum in PBS for 1 h. The sections were then incubated for 12 h at 4 °C with a primary antibody against Vangl1 (Santa Cruz Biotechnology, Texas, USA) and Vangl2 (Santa Cruz Biotechnology, Texas, USA) then washed three times with PBS, and incubated with a biotin-labeled secondary antibody. To visualize protein expression a chromogenic reaction was performed with a DAB (3,3′-diaminobenzidine) color reagent kit (Zhongshan Golden Bridge Biotechnology Co.), according to the manufacturer's instructions. As a negative control, the Vangl1 primary antibody was replaced with normal mouse IgG. Finally the sections were counterstained with hematoxylin and mounted. Protein expression was analyzed and quantified using Medical Image Analysis Software (Beihang University). Yellowishbrown staining was considered to be positive immunopositive staining. 2.6. Design of antisense oligonucleotide-specific for Vangl1 and Vangl2 The oligodeoxynucleotide (ODNS) sequences were used: Vangl1, sense ODNS (S-ODNS): 5′-ACG GTA ACG ATA CCT ATG GCT TAG G-3′ and antisense ODNS (A-ODNS): 5′-GGA TTC GGT ATC CAT AGC AAT GGC A-3′; Vangl2, sense ODNS (S-ODNS): 5′-CGA TGT TCC GTG CCG CAA GCC TG-3′ and antisense ODNS (A-ODNS): 5′-GTC CGA ACG CCG TGC CTT GTA GC-3′. All the sequences were thiophosphate-modified for extending their half-lives in cells (SBS Genentech Co., Ltd, Beijing, China).
Table 2 Locations of Vangl1 and Vangl2 in the endometrium during D1 to D6.
Vangl1 Vangl2
mRNA Protein mRNA Protein
D1
D2
D3
D4
D5
D6
S S LE GE S LE GE S
S S LE GE S LE GE S
S S LE GE S LE GE S
LE GE S S LE GE S LE GE S
LE GE S S LE GE S LE GE S
LE S DE S DE LE S DE S DE
LE: luminal epithelium; GE: glandular epithelium; S: stromal; DE: decidua.
the endometrium were upregulated from D3, and reached a maximum level on D5. In situ hybridization data showed their location, Vangl1 mRNA was mainly localized in the stromal cells on D1 to D3 of pregnancy, while intense staining was seen in the luminal, glandular epithelium and stromal cells on D4 and D5 of pregnancy. The decidual cells also highly expressed Vangl1 on D6 of pregnancy (Fig. 1B). Vangl2 mRNA was widely localized in the luminal, glandular epithelium and stromal cells during early pregnancy, positive signals were also detected in decidual cells on D6 of pregnancy (Fig. 1C). These results suggested that the levels of Vangl1 and Vangl2 mRNA increased during the period of embryo implantation, which is regarded as D4, D5 and D6 of pregnancy. 3.2. Vangl1 and Vangl2 protein expression in the uterus of mice during early pregnancy Immunohistochemistry and Western blot were performed to visualize the protein expression of Vangl1 and Vangl2 in the endometrium
2.7. Function of Vangl1 and Vangl2 during embryo implantation Twenty mice were given an intrauterine injection with the Vangl1/ Vangl2 S-ODNS or A-ODNS in the afternoon on D3 of pregnancy before implantation. One uterine horn of these mice was injected with 10 μg of A-ODNS, and the contralateral horn was injected with the S-ODNS or double-distilled water (DD water) (Shuang et al., 2011), then the animals were returned to their cages. Twenty four hours later, the mice were killed to obtain the uterus tissues, part of the mouse endometria tissue was collected and stored in liquid nitrogen for real-time PCR and Western blotting, and the rest part of the uteri tissue was fixed in 4% paraformaldehyde and embedded in paraffin for immunohistochemistry (IHC) and in situ hybridization (ISH). Another 10 mice were killed on D8 of pregnancy and the number of implanted embryos was recorded. 2.8. Statistical analysis All the data were analyzed using the Statistical Package for the Social Sciences (SPSS) statistical software (version 16.0, SPSS, Inc., IL, USA). Statistical significance was determined by one-way ANOVA. Post hoc comparisons between the means of the treatment group were made using Fisher's protected least significance difference test. All data are presented as the mean ± standard deviation. Differences were considered to be statistically different at P b 0.05. 3. Results 3.1. Vangl1 and Vangl2 mRNA levels in uterus of mice during early pregnancy In order to observe the possible role of Vangl homologues in the uterus, the spatiotemporal mRNA expression patterns of Vangl1 and Vangl2 were assessed by real-time PCR and in situ hybridization (Fig. 1). As shown in Fig. 1A, the Vangl1 and Vangl2 mRNA levels in
Fig. 3. The different expression profiles of Vangl1 and Vangl2 between pregnancy and pseudopregnancy. The levels of Vangl1 mRNA (A) and Vangl2 (B) mRNA in the uterus on D4, D5, and D6 of pregnancy and pseudopregnancy (*P b 0.05; **P b 0.01). Representative images of in situ hybridizations for Vangl1 mRNA (C) and Vangl2 mRNA (D) in the uterus on D4, D5, and D6 of pregnancy and pseudopregnancy. Representative images of immunohistochemical staining are shown for Vangl1 protein (E) and Vangl2 protein (F) in the mouse uterus of pregnant and pseudopregnant; (G) Western blot analysis of Vangl1 and Vangl2 protein levels; β-actin was used as a loading control. D: day of pregnant; PD: day of pseudopregnancy; CON: negative control; scale bar = 100 μm.
H. Zhang et al. / Gene 555 (2015) 140–149
145
Fig. 3 (continued).
(Fig. 2). Vangl1 was primarily localized in the stromal cells, and decidual cells. Strong positive staining was observed in the endometrium on D5 of pregnancy (Fig. 2A). The protein expression pattern of Vangl2 was different from that of the Vangl1 protein, it was widely distracted in the luminal, glandular epithelium,stromal cells and decidual cells of the endometrium, with the most intense staining observed in the apical edges of the epithelial cell membranes and stromal cells surrounding the embryo on D5 (Fig. 2B). As shown in Fig. 2C, Western blot revealed that both Vangl1 and Vangl2 proteins were upregulated in the endometrium during “implantation window”, especially on D5 of pregnancy. These results confirmed the expression profiles of Vangl1 and Vangl2 in the endometrium during early pregnancy (Table 2). The spatiotemporal specificity of Vangl1 and Vangl2 indicates that they may participate in embryo implantation.
3.3. Comparison of Vangl1 and Vangl2 expression in the endometrium of pregnant and pseudopregnant mice To further study whether the specific expression of Vangl1 and Vangl2 in the uterus of mice was associated with blastocyst, pseudopregnant mice model was built. The expression levels of Vangl1 and Vangl2 in the uterus of pregnant on D4 to D6 were compared with that of pseudopregnant mice. Real-time PCR results showed that the Vangl1 mRNA levels in the uterus of pregnant mice were higher than that of pseudopregnant mice on D4, D5 and D6 (Fig. 3A). The difference was also confirmed by in situ hybridization (Fig. 3C). The expression of the Vangl1 protein was analyzed by immunohistochemistry (Fig. 3E) and Western blotting (Fig. 3G), consistent with mRNA data, the level of Vangl1 protein in the uterus of pseudopregnant mice was significantly lower than that
146
H. Zhang et al. / Gene 555 (2015) 140–149
Fig. 3 (continued).
of pregnant mice on D4, D5, and D6 (Fig. 3G). However, the levels of Vangl2 mRNA and protein in the endometrium were not quantitatively different between pregnant and pseudopregnant mice. As shown in Fig. 3B and D, there was no significant differences in the Vangl2 mRNA
levels between the two groups, while the expression profile of Vangl2 protein was similar with that of Vangl2 mRNA (Fig. 3F and G). These results indicate that the expression of Vangl1 is induced by embryo signal while Vangl2 expression is not affected by embryo.
H. Zhang et al. / Gene 555 (2015) 140–149
147
3.4. Suppression of Vangl1 and Vangl2 expression in uterus of mice by antisense ODNS To explore the potential role of Vangl gene in the embryo implantation, their expressions were suppressed by uterine injection with AODNS, and then the number of implantation sites was analyzed. First, the effect of A-ODNS on Vangl1 and Vangl2 expression was detected. As shown in Fig. 4A, the Vangl1 and Vangl2 mRNA levels in uteri injected with their A-ODNS were significantly lower than those in the contralateral horn treated with S-ODNS (P b 0.05), which was confirmed by in situ hybridization (Fig. 4B and C). Similarly,
Fig. 4 (continued).
immunohistochemistry for Vangl1 and Vangl2 protein showed weaker positive signals in the horn injected with A-ODNS, while intense staining was observed in the control horn injected with S-ODNS or DD water (Fig. 4D and E). Western blot analysis of Vangl1 and Vangl2 protein expression levels was similar to the result obtained from immunohistochemistry (Fig. 4F and G). Taken together, the expression of Vangl1 and Vangl2 was obviously blocked by their specific A-ODNS.
3.5. Inhibition of embryo implantation following silencing the expression of Vangl1 and Vangl2
Fig. 4. Effect of antisense ODNS on the Vangl1 and Vangl2 expression in the mouse uterus. (A) Analysis of the Vangl1 and Vangl2 mRNA levels in the uteri (*P b 0.05). Representative images of in situ hybridizations for Vangl1 mRNA (B) and Vangl2 mRNA (C). Immunohistochemistry for Vangl1 protein (D) and Vangl2 protein (E). Western blot analysis of Vangl1 (F) and Vangl2 (G) protein levels in the uterus. S-ODNS: sense oligodeoxynucleotides; A-ODNS: antisense oligodeoxynucleotides; DD water: double-distilled water; CON: negative control; scale bar = 100 mm.
After injecting mice with Vangl1 and Vangl2 A-ODNS, the number of implanted embryos was analyzed. As shown in Fig. 5, the number of embryos in the right uterine horns was significantly lower than that in the contralateral S-ODN-treated or DD water-treated horns. However, no significant changes in the number of implanted embryos were observed in the S-ODN-treated horns compared with the water-treated control group. Thus, silencing the expression of Vangl1 or Vangl2 would inhibit embryo implantation obviously. They may play a role in embryo implantation.
148
H. Zhang et al. / Gene 555 (2015) 140–149
4. Discussion Members of the Vangl protein family are highly conserved, including Vangl1 and Vangl2, which participate in the Wnt/PCP signaling pathway. Previous studies have shown that Vangl1 and Vangl2 are involved in many biological processes, and are essential for embryonic development, cell adhesion, migration and polarity (Kibar et al., 2001; Barrow, 2006).However, whether Vangl1 and Vangl2 play a role during embryo implantation remains unclear. Our results indicate that these two genes undergo a time-dependent upregulation in the endometrium during the period of embryo implantation. This finding suggests that Vangl1 and Vangl2 might be essential for embryo implantation. In addition, pseudopregnant mice model was used to test whether their expressions were affected by blastocyst attachment. The expression of Vangl1 was lower in uteri of pseudopregnant mice, as compared to that of pregnant mice on D4, D5 and D6. The expression of Vangl2 was not significantly different between the uteri of pregnant and pseudopregnant mice. The results indicate that Vangl2 was less sensitive to blastocyst attachment, while Vangl1 expression is induced by embryonic signaling in the uterus of pregnant mice. A-ODNS were employed to silence the expression of Vangl1 and Vangl2 to test their function in the process of implantation. Our results showed that the expression of Vangl1 and Vangl2 were obviously suppressed by A-ODNS, and the number of implanted embryos in the uterus was significantly reduced after silencing the expression of Vangl1 and Vangl2. Vangl protein family may play a key role during embryo implantation, and the molecular mechanism remains to be elucidated. Vangl1 could regulate the establishment of cytoskeleton by participating in Wnt/PCP signaling way. Cytoskeleton such as microfilament or microtubule is involved in cell mitosis and cell movement, which regulate cell proliferation, differentiation and migration. Similarly, Vangl2, which is a homologous gene of Vangl1, was reported that its ectopic expression could suppress cell growth and clonogenicity by WNT/βcatenin suppression and could be a tumor suppressor gene(TSG) in colorectal cancers (CRCs) (Piazzi et al., 2013). Embryo implantation involves the migration of the uterine epithelium and proliferationand
differentiation of stromal cells. Hence, we speculate that Vangl1 and Vangl2 may contribute to embryo implantation by affecting cell proliferation, differentiation and migration. It has been reported that the Vangl2Lp mutation can result from alternations of cell polarity (Vandenberg and Sassoon, 2009). Successful embryo implantation requires the coordination between blastocyst activation and uterine receptivity, and trophoblast adhesion to the epithelium involves a transition in epithelial apical–basal cell polarity (Nallasamy et al., 2012). Vangl2 expression localized to the apical edges of the epithelial cell membranes in the uteri of mice on D5 (Fig. 2B). Thus, Vangl2 might participate in establishing epithelial cells and embryo tissue polarity during early pregnancy. Interestingly, it is known that Vangl2 knockdown tumor cells exhibit increased activation of secreted matrix metalloprotease (MMP2), higher levels of membrane-localized MMP14, and decreased cell-surface fibronectin (Cantrell and Jessen, 2009), which promotes tumor cell migration and adhesion through degradation of the extracellular matrix (Williams et al., 2012a,b). In a similar process, trophoblast invasion requires the action of MMPs to degrade extracellular matrix proteins and in turn, decidual cells express tissue inhibitors of MMPs (TIMPs) (Estella et al., 2012). Vangl2 may be involved in regulation of embryo implantation through activating MMPs. Further study is needed to elucidate the potential functions of Vangl1 and Vangl2 and related molecular mechanism by which Vangl gene accomplish their mission during implantation. Additionally, we found that Vangl1 mRNA was located in the luminal and glandular epithelium, and stromal cells of the uterus while Vangl1 protein was only expressed in the stromal cells of the uterus. That suggests that expression of Vangl1 in the endometrium may be regulated by post-transcriptional modification, such as microRNA and others. In summary, we revealed the expression patterns of the homologous genes Vangl1 and Vangl2 in the mouse endometrium that has a spatial temporal characteristic during early pregnancy and pseudopregnancy. Moreover, we observed that they participate in embryo implantation in mice. However, the mechanism remains unclear, and we would continue to investigate the roles of Vangl gene in detail during implantation in further study.
Fig. 5. Effect of antisense ODNs of Vangl1 and Vangl2 on the number of implantation sites. Representative uterus of mice on D8 from the Vangl1 treatment group (A), Vangl2 treatment group (B), the left horn was injected with S-ODNS and the right horn was injected with A-ODNS. (C), Representative uterus of mouse from the control group, both uterine horns were injected with DD water. (D), Statistical results of the number of implanted sites on D8 (*P b 0.05).
H. Zhang et al. / Gene 555 (2015) 140–149
Acknowledgments We thank M.D.Yongjiang Zhou for statistical analysis and helpful suggestions. We would especially like to acknowledge Professor Chao Yu for technical assistance from the Life Sciences Institute of Chongqing Medical University. References Adler, P.N., 2002. Planar signaling and morphogenesis in Drosophila. Dev. Cell 2, 525–535. Barrow, J.R., 2006. Wnt/PCP signaling: a veritable polar star in establishing patterns of polarity in embryonic tissues. Semin. Cell Dev. Biol. 17, 185–193. Cantrell, V.A., Jessen, J.R., 2009. The planar cell polarity protein Van Gogh-Like 2 regulates tumor cell migration and matrix metalloproteinase-dependent invasion. Cancer Lett. 287, 54–61. Estella, C., Herrer, I., Atkinson, S.P., Quinonero, A., Martinez, S., Pellicer, A., Simon, C., 2012. Inhibition of histone deacetylase activity in human endometrial stromal cells promotes extracellular matrix remodelling and limits embryo invasion. PLoS One 7, e30508. Etienne-Manneville, S., 2008. Polarity proteins in migration and invasion. Oncogene 27, 6970–6980. Habas, R., Dawid, I.B., 2005. Dishevelled and Wnt signaling: is the nucleus the final frontier? J. Biol. 4, 2. Henderson, D.J., Phillips, H.M., Chaudhry, B., 2006. Vang-like 2 and noncanonical Wnt signaling in outflow tract development. Trends Cardiovasc. Med. 16, 38–45. Jeong, J.W., Lee, H.S., Franco, H.L., Broaddus, R.R., Taketo, M.M., Tsai, S.Y., Lydon, J.P., DeMayo, F.J., 2009. Beta-catenin mediates glandular formation and dysregulation of beta-catenin induces hyperplasia formation in the murine uterus. Oncogene 28, 31–40. Karner, C., Wharton Jr., K.A., Carroll, T.J., 2006. Planar cell polarity and vertebrate organogenesis. Semin. Cell Dev. Biol. 17, 194–203. Kibar, Z., Vogan, K.J., Groulx, N., Justice, M.J., Underhill, D.A., Gros, P., 2001. Ltap, a mammalian homolog of Drosophila Strabismus/Van Gogh, is altered in the mouse neural tube mutant Loop-tail. Nat. Genet. 28, 251–255. Komiya, Y., Habas, R., 2008. Wnt signal transduction pathways. Organogenesis 4, 68–75. Lee, K.Y., DeMayo, F.J., 2004. Animal models of implantation. Reproduction 128, 679–695. Lei, Y.P., Zhang, T., Li, H., Wu, B.L., Jin, L., Wang, H.Y., 2010. VANGL2 mutations in human cranial neural-tube defects. N. Engl. J. Med. 362, 2232–2235. Liu, J., Qi, J., Zhu, J., Zhang, L., Liang, Y., Ning, Q., Luo, X., 2008. Effects of retinoic acid on the expressions of Vangl1 and vangl2 in mouse fetuses. J. Neurogenet. 22, 167–179. Mericskay, M., Kitajewski, J., Sassoon, D., 2004. Wnt5a is required for proper epithelial– mesenchymal interactions in the uterus. Development 131, 2061–2072. Mlodzik, M., 2002. Planar cell polarization: do the same mechanisms regulate Drosophila tissue polarity and vertebrate gastrulation? Trends Genet. 18, 564–571. Mohamed, O.A., Jonnaert, M., Labelle-Dumais, C., Kuroda, K., Clarke, H.J., Dufort, D., 2005. Uterine Wnt/beta-catenin signaling is required for implantation. Proc. Natl. Acad. Sci. U. S. A. 102, 8579–8584.
149
Nallasamy, S., Li, Q., Bagchi, M.K., Bagchi, I.C., 2012. Msx homeobox genes critically regulate embryo implantation by controlling paracrine signaling between uterine stroma and epithelium. PLoS Genet. 8, e1002500. Phillips, H.M., Murdoch, J.N., Chaudhry, B., Copp, A.J., Henderson, D.J., 2005. Vangl2 acts via RhoA signaling to regulate polarized cell movements during development of the proximal outflow tract. Circ. Res. 96, 292–299. Piazzi, G., Selgrad, M., Garcia, M., Ceccarelli, C., Fini, L., Bianchi, P., Laghi, L., D'Angelo, L., Paterini, P., Malfertheiner, P., Chieco, P., Boland, C.R., Bazzoli, F., Ricciardiello, L., 2013. Van-Gogh-like 2 antagonises the canonical WNT pathway and is methylated in colorectal cancers. Br. J. Cancer 108, 1750–1756. Reynolds, A., McDearmid, J.R., Lachance, S., De Marco, P., Merello, E., Capra, V., Gros, P., Drapeau, P., Kibar, Z., 2010. VANGL1 rare variants associated with neural tube defects affect convergent extension in zebrafish. Mech. Dev. 127, 385–392. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108. Shuang, L., Xuemei, C., Yubin, D., Xueqing, L., Yingxiong, W., Junlin, H., 2011. Expression of translationally controlled tumor protein (TCTP) in the uterus of mice of early pregnancy and its possible significance during embryo implantation. Hum. Reprod. 26 (11), 2972–2980. Torban, E., Wang, H.J., Patenaude, A.M., Riccomagno, M., Daniels, E., Epstein, D., Gros, P., 2007. Tissue, cellular and sub-cellular localization of the Vangl2 protein during embryonic development: effect of the Lp mutation. Gene Expr. Patterns 7, 346–354. Torban, E., Patenaude, A.M., Leclerc, S., Rakowiecki, S., Gauthier, S., Andelfinger, G., Epstein, D.J., Gros, P., 2008. Genetic interaction between members of the Vangl family causes neural tube defects in mice. Proc. Natl. Acad. Sci. U. S. A. 105, 3449–3454. Vandenberg, A.L., Sassoon, D.A., 2009. Non-canonical Wnt signaling regulates cell polarity in female reproductive tract development via Van Gogh-like 2. Development 136, 1559–1570. Williams, B.B., Cantrell, V.A., Mundell, N.A., Bennett, A.C., Quick, R.E., Jessen, J.R., 2012a. VANGL2 regulates membrane trafficking of MMP14 to control cell polarity and migration. J. Cell Sci. 125, 2141–2147. Williams, B.B., Mundell, N., Dunlap, J., Jessen, J., 2012b. The planar cell polarity protein VANGL2 coordinates remodeling of the extracellular matrix. Commun. Integr. Biol. 5, 325–328. Wu, G., Huang, X., Hua, Y., Mu, D., 2011. Roles of planar cell polarity pathways in the development of neural [correction of neutral] tube defects. J. Biomed. Sci. 18, 66. Yates, L.L., Papakrivopoulou, J., Long, D.A., Goggolidou, P., Connolly, J.O., Woolf, A.S., Dean, C.H., 2010a. The planar cell polarity gene Vangl2 is required for mammalian kidneybranching morphogenesis and glomerular maturation. Hum. Mol. Genet. 19, 4663–4676. Yates, L.L., Schnatwinkel, C., Murdoch, J.N., Bogani, D., Formstone, C.J., Townsend, S., Greenfield, A., Niswander, L.A., Dean, C.H., 2010b. The PCP genes Celsr1 and Vangl2 are required for normal lung branching morphogenesis. Hum. Mol. Genet. 19, 2251–2267.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
The homologous genes Vangl1 and Vangl2 are required for embryo implantation in the uterus of mice during early pregnancy☆ Hailing Zhang, Xuemei Chen, Yi Zhao, Rufei Gao, Yanqing Geng, Yubin Ding, Xueqing Liu, Yingxiong Wang, Junlin He ⁎ Laboratory of Reproductive Biology, School of Public Health, Chongqing Medical University, Box 197, No.1 Yixueyuan Road, Yuzhong District, 400016 Chongqing, PR China
a r t i c l e
i n f o
Article history: Received 11 December 2013 Received in revised form 16 July 2014 Accepted 30 October 2014 Available online 1 November 2014 Keywords: Vangl1 Vangl2 Early pregnancy Embryo implantation Mouse
a b s t r a c t Vangl1 and Vangl2 are homologous genes belonging to the group of highly conserved planar cell polarity proteins. It has been shown that Vangl1 and Vangl2 are essential for embryonic development, cell adhesion, migration and polarity. We examined the expression of Vangl1 and Vangl2 in the uterus of mice during early pregnancy. They are upregulated in the endometrium of peri-implantation and reached the peak on D5. Vangl1 mRNA is widely distributed in the luminal epithelium, glandular epithelium and stromal cells in the endometrium, while its protein only appeared in the stromal cells. The localization of Vangl2 protein overlapped with its mRNA. In addition, expression of Vangl1 in the endometrium of pseudopregnant mice was lower than that of pregnant mice, whereas the level of Vangl2 was not significantly different, suggesting that expression of Vangl1 is induced by embryo. Further study showed that implantation would be suppressed after silencing expressions of Vangl1 and Vangl2 by uterine injection with antisense oligonucleotides. These findings suggest that Vangl1 and Vangl2 may play a key role in the embryo implantation of mice. © 2014 Elsevier B.V. All rights reserved.
1. Introduction The Wnt signaling pathway is an ancient and evolutionarily conserved pathway that regulates crucial aspects of cell fate determination, migration, polarity, neural patterning and organogenesis during embryonic development (Komiya and Habas, 2008). The extracellular Wnt signal stimulates several intracellular signal transduction cascades, including the canonical Wnt/β-catenin dependent pathway and the non-canonical β-catenin-independent pathway, which can be divided into the Planar Cell Polarity (PCP) pathway and the Wnt/Ca2+ pathway (Habas and Dawid, 2005). The aberrant expression of Wnt gene, as Wnt5a, Wnt11, and Wnt7a, would result in abnormal implantation and decidual dysfunction in mice (Mericskay et al., 2004). Wnt/βcatenin signaling is crucial for embryo implantation, and the dysregulation of β-catenin would affect glandular formation, decidualization and eventually lead to fertility (Jeong et al., 2009; Mohamed et al., 2005). The Wnt/PCP pathway, which can be stimulated by the non-canonical Wnt ligands, such as Wnt5a or Wnt11, is involved in tissue morphogenesis, directed cell migration, cell adhesion and polarity-cellular
Abbreviations: NTDs, Neural Tube Defects; A-ODNS, antisense oligonucleotides; LE, luminal epithelium; GE, glandular epithelium; S, stromal; DE, decidua; EM, embryo. ☆ Funding: This work was supported by grants from the National Natural Science Foundation of China (Nos. 31271246, 30973195). ⁎ Corresponding author. E-mail address: [email protected] (J. He).
http://dx.doi.org/10.1016/j.gene.2014.10.055 0378-1119/© 2014 Elsevier B.V. All rights reserved.
processes that are required for embryo implantation (Komiya and Habas, 2008; Wu et al., 2011). During embryo implantation, epithelial cells transit from a columnar to cuboidal phenotype approaching implantation, and junctions between neighboring epithelial cells are required to establish and maintain base-apical cell polarity (Etienne-Manneville, 2008; Nallasamy et al., 2012). However, it is unknown whether the Wnt/PCP signaling pathway directly participates in embryo implantation. Mammalian Vangl proteins are highly conserved transmembrane (TM) membrane proteins, and they are composed of four putative TM domains in the N-terminus that were identified in two Vangl homologous genes in each species included Vangl1 and Vangl2 (Kibar et al., 2001). There is N80% consensus in the protein sequence of the cytoplasmic portion of Vangl1 and Vangl2, conferring structural homologies that reflect functional similarity (Torban et al., 2008). Vangl proteins play a key developmental role in the Wnt/PCP signaling pathway as they are constituent proteins in the Frizzled, Disheveled, Flamingo, Prickle, and Diego complexes (Adler, 2002; Mlodzik, 2002), regulating cytoskeleton, cell adhesion, migration, polarity and embryonic development (Wu et al., 2011). Vangl1 is expressed in the developing neural tube, and it is located in the floor plate and notochord (Torban et al., 2008). Vangl2 is expressed in the developing olfactory organs, the bronchial tree and some tube organs (Phillips et al., 2005; Henderson et al., 2006; Torban et al., 2007; Yates et al., 2010a,b). Loss-of-function in Vangl1 and Vangl2 would cause Neural Tube Defects (NTDs) during embryonic development. Recently, four mutation types of Vangl1 were identified in patients with NTDs, including familial types (V239I and
H. Zhang et al. / Gene 555 (2015) 140–149
141
Table 1 Primers of Vangl1, Vangl2 and β-actin for real-time PCR. Gene
GenBank accession no.
Sense primers (5′ → 3′)
Antisense primers(5′ → 3′)
Product size (bp)
Vangl1 Vangl2 β-actin
NM_177545 NM_033509 NM_007393
AAGCAAAGAGCGGATGTG TCAGGGTGACGGTTGACTT CCTGAGGCTCTTTTCCAGCC
CGATGGCAAGGTAGTGGA CTTGTAGGAATAGCCCGAGTA TAGAGGTCTTTACGGATGTCAACGT
196 172 120
R274Q), a sporadic type (M328T) and a spontaneous mutation (V239I) appearing in a familial setting (Reynolds et al., 2010). Furthermore, mutations in Vangl2 were heterozygous in fetuses with a cranial NTD: S84F (737C → T), R353C (1543C → T), and F437S (1796 T → C), with these mutations producing lethal effects on the embryo (Lei et al., 2010). The molecular mechanism for these defects is associated with Vangl1 and Vangl2 in the PCP pathway, directing embryonic convergent extension, polarized cell division, cell differentiation and cilia orientation (Barrow, 2006; Karner et al., 2006). As a principal component of the Wnt/PCP signaling pathway, our aim is to study the role of Vangl1 and Vangl2 in embryo implantation. Because the mechanism of embryo implantation in mice is similar to human (Lee and DeMayo, 2004), mice were employed to carry out the study. We first detected the expression profile of Vangl1 and Vangl2 in the endometrium of pregnant and pseudopregnant mice. Further functional study was performed by uterine injection with antisense oligonucleotides (A-ODNS), and then counted the number of implantation sites to observe the effect of silencing their expression in endometrium on implantation. 2. Materials and methods 2.1. Animal models and experimental design National Institutes of Health mice were obtained from the Animal Facility of Chong Qing Medical University, Chongqing, China (Certificate: SICXK[19] 2007 – 0001). 6–8 week old female mice (25–30 g) were caged in a specific pathogen-free animal room under a controlled environment, with a 14 h light and 10 h dark cycle. The estrus females were mated with fertile males or vasectomized males to induce pregnancy (D1 = day of positive vaginal plug) or pseudopregnancy (PD1 = day of positive vaginal plug). Pregnant mice were divided into six groups (D1, D2, D3, D4, D5 and D6), and pseudopregnant mice were divided into three groups (PD4, PD5 and PD6), (20 mice in each group). 20 pregnant mice on D3 were used for the Vangl1 and Vangl2 functional experiments. The mice in each group were killed in the morning for tissue collection. Trypan blue was injected into the tail veins to identify the implantation sites. Part of the mouse endometria tissue was collected and stored in liquid nitrogen for real-time quantitative polymerase chain reaction (qPCR) and Western blotting (WB), and the rest part of the uteri tissue was fixed in 4% paraformaldehyde and embedded in paraffin for immunohistochemistry (IHC) and in situ hybridization (ISH). All animal procedures were approved by the Ethical Committee of Chongqing Medical University. 2.2. Real-time PCR Total RNA was extracted from mouse endometrial tissues using Trizol reagent (Invitrogen, CA, USA), according to the manufacturer's instructions. Quantification and purity assessment were performed by optical density measurements at 260 and 280 nm. Integrity of the total RNA was examined by agarose gel electrophoresis. Total RNA was converted to cDNA and the expression of Vangl1 in the cDNA samples was determined using a SYBR Primescript™ RT-PCR kit (TAKARA, Dalian, China). β-Actin was used as a reference gene for each sample. Specific primers were designed (Shanghai GeneCore BioTechnologies Co., Ltd, China), and the primer sequences are shown in Table 1. The real-time PCR conditions were as follows: initial denaturation at 95 °C for 10 s,
40 cycles of 15 s at 95 °C (denaturation) and 30 s at 56 °C (annealing and extension). All real-time PCR experiments were repeated three times for each sample. Relative gene expression levels were analyzed using the 2− ΔΔCT method (Schmittgen and Livak, 2008). Expression levels of Vangl1 and Vangl2 were obtained by normalizing the amount of cDNA to that of β-actin.
2.3. In situ hybridization In situ hybridization was performed using a universal digoxigeninlabeled probe hybridization kit (Beijing Dingguo Biosciences Inc., China). According to the manufacturer's instructions, sections (4 μm) were cut, deparaffinized and rehydrated. The endogenous peroxidase activity was quenched by incubation with 0.5% hydrogen peroxide in methanol for 30 min at room temperature, and then incubated with 50 μl proteinase K solution for 10 min at 37 °C. Sections were then washed three times for 3 min each and incubated with 50 μl of prehybridization solution for 3 h at 37 °C. After shaking off excess liquid, sections were incubated with hybridization solution containing 2 μg/ml of the hydridization probe (Invitrogen, CA, USA). The sequences for the digoxigenin-labeled probes for Vangl1 and Vangl2 were as follows: Vangl1: 5′-CCT GCG TTC GTG TTC GGC CTC TTCA TAA TAC AAC TCG TTG-3′; Vangl2: 5′-AGC AGG ATG AGC AGC TTG AAG GCC ACG GAG ATG AAG AGG C-3′ (Liu et al., 2008). Reaction conditions were as follows: initial denaturation at 95 °C for 5 s and overnight at 37 °C. The next day, the section was blocked for 30 min at 37 °C, followed by incubation for 1 h with rabbit anti-digoxin IgG and then incubated for 1 h with AP-Goat anti-rabbit IgG at 37 °C. The reaction product was detected using a BCIP/NBT Chromogenic agent kit (Boster, Wuhan, China). The localization of mRNA was analyzed and quantified using Medical Image Analysis Software (Beihang University, China), blue-violet staining was considered to be a positive signal.
2.4. Western blotting Total proteins were extracted from the mouse endometrium using cell lysis buffer for Western blotting and immunoprecipitation (Beyotime, Jiangsu, China). The protein concentration was measured using the BCA Protein Assay kit (Beyotime, Jiangsu, China). Samples were boiled in 5× SDS sample loading buffer for 10 min and separated by SDS-polyacrylamide gel electrophoresis. The proteins were then transferred electrophoretically onto polyvinylidene difluoride membranes (BioRad, California, USA). The membrane was then blocked for 1 h at room temperature in PBST containing 5% skimmed milk powder. It was then incubated with anti-Vangl1 antibodies (1:500, sc-166844, Santa Cruz), anti-Vangl2 antibodies (1:500, sc-46561, Santa Cruz), or mouse monoclonal anti-β-actin antibodies (1:500,ZA-09,Zhongshan Golden Bridge Biotechnology Co., LTD., Beijing) overnight at 4 °C. Next, the membranes were washed for four times with PBST (5 min each time), followed by incubation for 1 h with a secondary antibody conjugated with horseradish peroxidase (Zhongshan Golden Bridge Biotechnology Co., LTD., Beijing). The membranes were washed three times in PBST and the antibodies were detected by enhanced chemiluminescence (ECL) using the appropriate ECL reagents (Merck Millipore, USA), and quantified by densitometry using Quantity One software (BioRad, California, USA).
142
H. Zhang et al. / Gene 555 (2015) 140–149
H. Zhang et al. / Gene 555 (2015) 140–149
143
Fig. 2. The protein levels of Vangl1 and Vangl2 during D1 to D6 of pregnancy in the mouse uterus. Immunohistochemistry analysis of Vangl1 (A) and Vangl2 (B) proteins in the mouse uterus. Yellowish-brown staining was considered to be positive. CON: negative control; LE: luminal epithelium; GE: glandular epithelium; S: stromal; EM: embryo; DE: decidua; scale bar = 100 μm. (C) Western blot analysis of Vangl1 and Vangl2 proteins in the uterus during early pregnancy. Expression levels of β-actin were used as loading control.
Fig. 1. Vangl1 and Vangl2 mRNA levels during D1 to D6 of pregnancy in the mouse uterus. (A) Real-time PCR analysis of Vangl1 and Vangl2 mRNA. β-actin was used as a reference gene (*P b 0.05 vs D1). The location of Vangl1 mRNA (B) and Vangl2 mRNA (C) was examined by in situ hybridization using DIG-labeled oligonucleotides. CON: negative control; LE: luminal epithelium; GE: glandular epithelium; S: stromal; DE: decidua; scale bar = 100 μm.
144
H. Zhang et al. / Gene 555 (2015) 140–149
2.5. Immunohistochemistry The uteri of mice were fixed immediately in 4% paraformaldehyde and embedded in paraffin. 4 μm sections were made and their endogenous peroxidase activity was quenched by incubation with 3% H2O2 for 10 min, followed by rinsing with PBS. Antigen retrieval was performed by incubating the sections in 0.01 M citrate buffer (pH 6.0) at 95 °C for 15 min, followed by cooling at room temperature for 25 min. Nonspecific binding was blocked with 10% (v/v) normal goat serum in PBS for 1 h. The sections were then incubated for 12 h at 4 °C with a primary antibody against Vangl1 (Santa Cruz Biotechnology, Texas, USA) and Vangl2 (Santa Cruz Biotechnology, Texas, USA) then washed three times with PBS, and incubated with a biotin-labeled secondary antibody. To visualize protein expression a chromogenic reaction was performed with a DAB (3,3′-diaminobenzidine) color reagent kit (Zhongshan Golden Bridge Biotechnology Co.), according to the manufacturer's instructions. As a negative control, the Vangl1 primary antibody was replaced with normal mouse IgG. Finally the sections were counterstained with hematoxylin and mounted. Protein expression was analyzed and quantified using Medical Image Analysis Software (Beihang University). Yellowishbrown staining was considered to be positive immunopositive staining. 2.6. Design of antisense oligonucleotide-specific for Vangl1 and Vangl2 The oligodeoxynucleotide (ODNS) sequences were used: Vangl1, sense ODNS (S-ODNS): 5′-ACG GTA ACG ATA CCT ATG GCT TAG G-3′ and antisense ODNS (A-ODNS): 5′-GGA TTC GGT ATC CAT AGC AAT GGC A-3′; Vangl2, sense ODNS (S-ODNS): 5′-CGA TGT TCC GTG CCG CAA GCC TG-3′ and antisense ODNS (A-ODNS): 5′-GTC CGA ACG CCG TGC CTT GTA GC-3′. All the sequences were thiophosphate-modified for extending their half-lives in cells (SBS Genentech Co., Ltd, Beijing, China).
Table 2 Locations of Vangl1 and Vangl2 in the endometrium during D1 to D6.
Vangl1 Vangl2
mRNA Protein mRNA Protein
D1
D2
D3
D4
D5
D6
S S LE GE S LE GE S
S S LE GE S LE GE S
S S LE GE S LE GE S
LE GE S S LE GE S LE GE S
LE GE S S LE GE S LE GE S
LE S DE S DE LE S DE S DE
LE: luminal epithelium; GE: glandular epithelium; S: stromal; DE: decidua.
the endometrium were upregulated from D3, and reached a maximum level on D5. In situ hybridization data showed their location, Vangl1 mRNA was mainly localized in the stromal cells on D1 to D3 of pregnancy, while intense staining was seen in the luminal, glandular epithelium and stromal cells on D4 and D5 of pregnancy. The decidual cells also highly expressed Vangl1 on D6 of pregnancy (Fig. 1B). Vangl2 mRNA was widely localized in the luminal, glandular epithelium and stromal cells during early pregnancy, positive signals were also detected in decidual cells on D6 of pregnancy (Fig. 1C). These results suggested that the levels of Vangl1 and Vangl2 mRNA increased during the period of embryo implantation, which is regarded as D4, D5 and D6 of pregnancy. 3.2. Vangl1 and Vangl2 protein expression in the uterus of mice during early pregnancy Immunohistochemistry and Western blot were performed to visualize the protein expression of Vangl1 and Vangl2 in the endometrium
2.7. Function of Vangl1 and Vangl2 during embryo implantation Twenty mice were given an intrauterine injection with the Vangl1/ Vangl2 S-ODNS or A-ODNS in the afternoon on D3 of pregnancy before implantation. One uterine horn of these mice was injected with 10 μg of A-ODNS, and the contralateral horn was injected with the S-ODNS or double-distilled water (DD water) (Shuang et al., 2011), then the animals were returned to their cages. Twenty four hours later, the mice were killed to obtain the uterus tissues, part of the mouse endometria tissue was collected and stored in liquid nitrogen for real-time PCR and Western blotting, and the rest part of the uteri tissue was fixed in 4% paraformaldehyde and embedded in paraffin for immunohistochemistry (IHC) and in situ hybridization (ISH). Another 10 mice were killed on D8 of pregnancy and the number of implanted embryos was recorded. 2.8. Statistical analysis All the data were analyzed using the Statistical Package for the Social Sciences (SPSS) statistical software (version 16.0, SPSS, Inc., IL, USA). Statistical significance was determined by one-way ANOVA. Post hoc comparisons between the means of the treatment group were made using Fisher's protected least significance difference test. All data are presented as the mean ± standard deviation. Differences were considered to be statistically different at P b 0.05. 3. Results 3.1. Vangl1 and Vangl2 mRNA levels in uterus of mice during early pregnancy In order to observe the possible role of Vangl homologues in the uterus, the spatiotemporal mRNA expression patterns of Vangl1 and Vangl2 were assessed by real-time PCR and in situ hybridization (Fig. 1). As shown in Fig. 1A, the Vangl1 and Vangl2 mRNA levels in
Fig. 3. The different expression profiles of Vangl1 and Vangl2 between pregnancy and pseudopregnancy. The levels of Vangl1 mRNA (A) and Vangl2 (B) mRNA in the uterus on D4, D5, and D6 of pregnancy and pseudopregnancy (*P b 0.05; **P b 0.01). Representative images of in situ hybridizations for Vangl1 mRNA (C) and Vangl2 mRNA (D) in the uterus on D4, D5, and D6 of pregnancy and pseudopregnancy. Representative images of immunohistochemical staining are shown for Vangl1 protein (E) and Vangl2 protein (F) in the mouse uterus of pregnant and pseudopregnant; (G) Western blot analysis of Vangl1 and Vangl2 protein levels; β-actin was used as a loading control. D: day of pregnant; PD: day of pseudopregnancy; CON: negative control; scale bar = 100 μm.
H. Zhang et al. / Gene 555 (2015) 140–149
145
Fig. 3 (continued).
(Fig. 2). Vangl1 was primarily localized in the stromal cells, and decidual cells. Strong positive staining was observed in the endometrium on D5 of pregnancy (Fig. 2A). The protein expression pattern of Vangl2 was different from that of the Vangl1 protein, it was widely distracted in the luminal, glandular epithelium,stromal cells and decidual cells of the endometrium, with the most intense staining observed in the apical edges of the epithelial cell membranes and stromal cells surrounding the embryo on D5 (Fig. 2B). As shown in Fig. 2C, Western blot revealed that both Vangl1 and Vangl2 proteins were upregulated in the endometrium during “implantation window”, especially on D5 of pregnancy. These results confirmed the expression profiles of Vangl1 and Vangl2 in the endometrium during early pregnancy (Table 2). The spatiotemporal specificity of Vangl1 and Vangl2 indicates that they may participate in embryo implantation.
3.3. Comparison of Vangl1 and Vangl2 expression in the endometrium of pregnant and pseudopregnant mice To further study whether the specific expression of Vangl1 and Vangl2 in the uterus of mice was associated with blastocyst, pseudopregnant mice model was built. The expression levels of Vangl1 and Vangl2 in the uterus of pregnant on D4 to D6 were compared with that of pseudopregnant mice. Real-time PCR results showed that the Vangl1 mRNA levels in the uterus of pregnant mice were higher than that of pseudopregnant mice on D4, D5 and D6 (Fig. 3A). The difference was also confirmed by in situ hybridization (Fig. 3C). The expression of the Vangl1 protein was analyzed by immunohistochemistry (Fig. 3E) and Western blotting (Fig. 3G), consistent with mRNA data, the level of Vangl1 protein in the uterus of pseudopregnant mice was significantly lower than that
146
H. Zhang et al. / Gene 555 (2015) 140–149
Fig. 3 (continued).
of pregnant mice on D4, D5, and D6 (Fig. 3G). However, the levels of Vangl2 mRNA and protein in the endometrium were not quantitatively different between pregnant and pseudopregnant mice. As shown in Fig. 3B and D, there was no significant differences in the Vangl2 mRNA
levels between the two groups, while the expression profile of Vangl2 protein was similar with that of Vangl2 mRNA (Fig. 3F and G). These results indicate that the expression of Vangl1 is induced by embryo signal while Vangl2 expression is not affected by embryo.
H. Zhang et al. / Gene 555 (2015) 140–149
147
3.4. Suppression of Vangl1 and Vangl2 expression in uterus of mice by antisense ODNS To explore the potential role of Vangl gene in the embryo implantation, their expressions were suppressed by uterine injection with AODNS, and then the number of implantation sites was analyzed. First, the effect of A-ODNS on Vangl1 and Vangl2 expression was detected. As shown in Fig. 4A, the Vangl1 and Vangl2 mRNA levels in uteri injected with their A-ODNS were significantly lower than those in the contralateral horn treated with S-ODNS (P b 0.05), which was confirmed by in situ hybridization (Fig. 4B and C). Similarly,
Fig. 4 (continued).
immunohistochemistry for Vangl1 and Vangl2 protein showed weaker positive signals in the horn injected with A-ODNS, while intense staining was observed in the control horn injected with S-ODNS or DD water (Fig. 4D and E). Western blot analysis of Vangl1 and Vangl2 protein expression levels was similar to the result obtained from immunohistochemistry (Fig. 4F and G). Taken together, the expression of Vangl1 and Vangl2 was obviously blocked by their specific A-ODNS.
3.5. Inhibition of embryo implantation following silencing the expression of Vangl1 and Vangl2
Fig. 4. Effect of antisense ODNS on the Vangl1 and Vangl2 expression in the mouse uterus. (A) Analysis of the Vangl1 and Vangl2 mRNA levels in the uteri (*P b 0.05). Representative images of in situ hybridizations for Vangl1 mRNA (B) and Vangl2 mRNA (C). Immunohistochemistry for Vangl1 protein (D) and Vangl2 protein (E). Western blot analysis of Vangl1 (F) and Vangl2 (G) protein levels in the uterus. S-ODNS: sense oligodeoxynucleotides; A-ODNS: antisense oligodeoxynucleotides; DD water: double-distilled water; CON: negative control; scale bar = 100 mm.
After injecting mice with Vangl1 and Vangl2 A-ODNS, the number of implanted embryos was analyzed. As shown in Fig. 5, the number of embryos in the right uterine horns was significantly lower than that in the contralateral S-ODN-treated or DD water-treated horns. However, no significant changes in the number of implanted embryos were observed in the S-ODN-treated horns compared with the water-treated control group. Thus, silencing the expression of Vangl1 or Vangl2 would inhibit embryo implantation obviously. They may play a role in embryo implantation.
148
H. Zhang et al. / Gene 555 (2015) 140–149
4. Discussion Members of the Vangl protein family are highly conserved, including Vangl1 and Vangl2, which participate in the Wnt/PCP signaling pathway. Previous studies have shown that Vangl1 and Vangl2 are involved in many biological processes, and are essential for embryonic development, cell adhesion, migration and polarity (Kibar et al., 2001; Barrow, 2006).However, whether Vangl1 and Vangl2 play a role during embryo implantation remains unclear. Our results indicate that these two genes undergo a time-dependent upregulation in the endometrium during the period of embryo implantation. This finding suggests that Vangl1 and Vangl2 might be essential for embryo implantation. In addition, pseudopregnant mice model was used to test whether their expressions were affected by blastocyst attachment. The expression of Vangl1 was lower in uteri of pseudopregnant mice, as compared to that of pregnant mice on D4, D5 and D6. The expression of Vangl2 was not significantly different between the uteri of pregnant and pseudopregnant mice. The results indicate that Vangl2 was less sensitive to blastocyst attachment, while Vangl1 expression is induced by embryonic signaling in the uterus of pregnant mice. A-ODNS were employed to silence the expression of Vangl1 and Vangl2 to test their function in the process of implantation. Our results showed that the expression of Vangl1 and Vangl2 were obviously suppressed by A-ODNS, and the number of implanted embryos in the uterus was significantly reduced after silencing the expression of Vangl1 and Vangl2. Vangl protein family may play a key role during embryo implantation, and the molecular mechanism remains to be elucidated. Vangl1 could regulate the establishment of cytoskeleton by participating in Wnt/PCP signaling way. Cytoskeleton such as microfilament or microtubule is involved in cell mitosis and cell movement, which regulate cell proliferation, differentiation and migration. Similarly, Vangl2, which is a homologous gene of Vangl1, was reported that its ectopic expression could suppress cell growth and clonogenicity by WNT/βcatenin suppression and could be a tumor suppressor gene(TSG) in colorectal cancers (CRCs) (Piazzi et al., 2013). Embryo implantation involves the migration of the uterine epithelium and proliferationand
differentiation of stromal cells. Hence, we speculate that Vangl1 and Vangl2 may contribute to embryo implantation by affecting cell proliferation, differentiation and migration. It has been reported that the Vangl2Lp mutation can result from alternations of cell polarity (Vandenberg and Sassoon, 2009). Successful embryo implantation requires the coordination between blastocyst activation and uterine receptivity, and trophoblast adhesion to the epithelium involves a transition in epithelial apical–basal cell polarity (Nallasamy et al., 2012). Vangl2 expression localized to the apical edges of the epithelial cell membranes in the uteri of mice on D5 (Fig. 2B). Thus, Vangl2 might participate in establishing epithelial cells and embryo tissue polarity during early pregnancy. Interestingly, it is known that Vangl2 knockdown tumor cells exhibit increased activation of secreted matrix metalloprotease (MMP2), higher levels of membrane-localized MMP14, and decreased cell-surface fibronectin (Cantrell and Jessen, 2009), which promotes tumor cell migration and adhesion through degradation of the extracellular matrix (Williams et al., 2012a,b). In a similar process, trophoblast invasion requires the action of MMPs to degrade extracellular matrix proteins and in turn, decidual cells express tissue inhibitors of MMPs (TIMPs) (Estella et al., 2012). Vangl2 may be involved in regulation of embryo implantation through activating MMPs. Further study is needed to elucidate the potential functions of Vangl1 and Vangl2 and related molecular mechanism by which Vangl gene accomplish their mission during implantation. Additionally, we found that Vangl1 mRNA was located in the luminal and glandular epithelium, and stromal cells of the uterus while Vangl1 protein was only expressed in the stromal cells of the uterus. That suggests that expression of Vangl1 in the endometrium may be regulated by post-transcriptional modification, such as microRNA and others. In summary, we revealed the expression patterns of the homologous genes Vangl1 and Vangl2 in the mouse endometrium that has a spatial temporal characteristic during early pregnancy and pseudopregnancy. Moreover, we observed that they participate in embryo implantation in mice. However, the mechanism remains unclear, and we would continue to investigate the roles of Vangl gene in detail during implantation in further study.
Fig. 5. Effect of antisense ODNs of Vangl1 and Vangl2 on the number of implantation sites. Representative uterus of mice on D8 from the Vangl1 treatment group (A), Vangl2 treatment group (B), the left horn was injected with S-ODNS and the right horn was injected with A-ODNS. (C), Representative uterus of mouse from the control group, both uterine horns were injected with DD water. (D), Statistical results of the number of implanted sites on D8 (*P b 0.05).
H. Zhang et al. / Gene 555 (2015) 140–149
Acknowledgments We thank M.D.Yongjiang Zhou for statistical analysis and helpful suggestions. We would especially like to acknowledge Professor Chao Yu for technical assistance from the Life Sciences Institute of Chongqing Medical University. References Adler, P.N., 2002. Planar signaling and morphogenesis in Drosophila. Dev. Cell 2, 525–535. Barrow, J.R., 2006. Wnt/PCP signaling: a veritable polar star in establishing patterns of polarity in embryonic tissues. Semin. Cell Dev. Biol. 17, 185–193. Cantrell, V.A., Jessen, J.R., 2009. The planar cell polarity protein Van Gogh-Like 2 regulates tumor cell migration and matrix metalloproteinase-dependent invasion. Cancer Lett. 287, 54–61. Estella, C., Herrer, I., Atkinson, S.P., Quinonero, A., Martinez, S., Pellicer, A., Simon, C., 2012. Inhibition of histone deacetylase activity in human endometrial stromal cells promotes extracellular matrix remodelling and limits embryo invasion. PLoS One 7, e30508. Etienne-Manneville, S., 2008. Polarity proteins in migration and invasion. Oncogene 27, 6970–6980. Habas, R., Dawid, I.B., 2005. Dishevelled and Wnt signaling: is the nucleus the final frontier? J. Biol. 4, 2. Henderson, D.J., Phillips, H.M., Chaudhry, B., 2006. Vang-like 2 and noncanonical Wnt signaling in outflow tract development. Trends Cardiovasc. Med. 16, 38–45. Jeong, J.W., Lee, H.S., Franco, H.L., Broaddus, R.R., Taketo, M.M., Tsai, S.Y., Lydon, J.P., DeMayo, F.J., 2009. Beta-catenin mediates glandular formation and dysregulation of beta-catenin induces hyperplasia formation in the murine uterus. Oncogene 28, 31–40. Karner, C., Wharton Jr., K.A., Carroll, T.J., 2006. Planar cell polarity and vertebrate organogenesis. Semin. Cell Dev. Biol. 17, 194–203. Kibar, Z., Vogan, K.J., Groulx, N., Justice, M.J., Underhill, D.A., Gros, P., 2001. Ltap, a mammalian homolog of Drosophila Strabismus/Van Gogh, is altered in the mouse neural tube mutant Loop-tail. Nat. Genet. 28, 251–255. Komiya, Y., Habas, R., 2008. Wnt signal transduction pathways. Organogenesis 4, 68–75. Lee, K.Y., DeMayo, F.J., 2004. Animal models of implantation. Reproduction 128, 679–695. Lei, Y.P., Zhang, T., Li, H., Wu, B.L., Jin, L., Wang, H.Y., 2010. VANGL2 mutations in human cranial neural-tube defects. N. Engl. J. Med. 362, 2232–2235. Liu, J., Qi, J., Zhu, J., Zhang, L., Liang, Y., Ning, Q., Luo, X., 2008. Effects of retinoic acid on the expressions of Vangl1 and vangl2 in mouse fetuses. J. Neurogenet. 22, 167–179. Mericskay, M., Kitajewski, J., Sassoon, D., 2004. Wnt5a is required for proper epithelial– mesenchymal interactions in the uterus. Development 131, 2061–2072. Mlodzik, M., 2002. Planar cell polarization: do the same mechanisms regulate Drosophila tissue polarity and vertebrate gastrulation? Trends Genet. 18, 564–571. Mohamed, O.A., Jonnaert, M., Labelle-Dumais, C., Kuroda, K., Clarke, H.J., Dufort, D., 2005. Uterine Wnt/beta-catenin signaling is required for implantation. Proc. Natl. Acad. Sci. U. S. A. 102, 8579–8584.
149
Nallasamy, S., Li, Q., Bagchi, M.K., Bagchi, I.C., 2012. Msx homeobox genes critically regulate embryo implantation by controlling paracrine signaling between uterine stroma and epithelium. PLoS Genet. 8, e1002500. Phillips, H.M., Murdoch, J.N., Chaudhry, B., Copp, A.J., Henderson, D.J., 2005. Vangl2 acts via RhoA signaling to regulate polarized cell movements during development of the proximal outflow tract. Circ. Res. 96, 292–299. Piazzi, G., Selgrad, M., Garcia, M., Ceccarelli, C., Fini, L., Bianchi, P., Laghi, L., D'Angelo, L., Paterini, P., Malfertheiner, P., Chieco, P., Boland, C.R., Bazzoli, F., Ricciardiello, L., 2013. Van-Gogh-like 2 antagonises the canonical WNT pathway and is methylated in colorectal cancers. Br. J. Cancer 108, 1750–1756. Reynolds, A., McDearmid, J.R., Lachance, S., De Marco, P., Merello, E., Capra, V., Gros, P., Drapeau, P., Kibar, Z., 2010. VANGL1 rare variants associated with neural tube defects affect convergent extension in zebrafish. Mech. Dev. 127, 385–392. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108. Shuang, L., Xuemei, C., Yubin, D., Xueqing, L., Yingxiong, W., Junlin, H., 2011. Expression of translationally controlled tumor protein (TCTP) in the uterus of mice of early pregnancy and its possible significance during embryo implantation. Hum. Reprod. 26 (11), 2972–2980. Torban, E., Wang, H.J., Patenaude, A.M., Riccomagno, M., Daniels, E., Epstein, D., Gros, P., 2007. Tissue, cellular and sub-cellular localization of the Vangl2 protein during embryonic development: effect of the Lp mutation. Gene Expr. Patterns 7, 346–354. Torban, E., Patenaude, A.M., Leclerc, S., Rakowiecki, S., Gauthier, S., Andelfinger, G., Epstein, D.J., Gros, P., 2008. Genetic interaction between members of the Vangl family causes neural tube defects in mice. Proc. Natl. Acad. Sci. U. S. A. 105, 3449–3454. Vandenberg, A.L., Sassoon, D.A., 2009. Non-canonical Wnt signaling regulates cell polarity in female reproductive tract development via Van Gogh-like 2. Development 136, 1559–1570. Williams, B.B., Cantrell, V.A., Mundell, N.A., Bennett, A.C., Quick, R.E., Jessen, J.R., 2012a. VANGL2 regulates membrane trafficking of MMP14 to control cell polarity and migration. J. Cell Sci. 125, 2141–2147. Williams, B.B., Mundell, N., Dunlap, J., Jessen, J., 2012b. The planar cell polarity protein VANGL2 coordinates remodeling of the extracellular matrix. Commun. Integr. Biol. 5, 325–328. Wu, G., Huang, X., Hua, Y., Mu, D., 2011. Roles of planar cell polarity pathways in the development of neural [correction of neutral] tube defects. J. Biomed. Sci. 18, 66. Yates, L.L., Papakrivopoulou, J., Long, D.A., Goggolidou, P., Connolly, J.O., Woolf, A.S., Dean, C.H., 2010a. The planar cell polarity gene Vangl2 is required for mammalian kidneybranching morphogenesis and glomerular maturation. Hum. Mol. Genet. 19, 4663–4676. Yates, L.L., Schnatwinkel, C., Murdoch, J.N., Bogani, D., Formstone, C.J., Townsend, S., Greenfield, A., Niswander, L.A., Dean, C.H., 2010b. The PCP genes Celsr1 and Vangl2 are required for normal lung branching morphogenesis. Hum. Mol. Genet. 19, 2251–2267.
