G Model
BIOPHA-3390; No. of Pages 7 Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
Available online at
ScienceDirect www.sciencedirect.com
Original article
Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance Songbing He a,b,c,1,*, Hao Zhou b,1, Xinguo Zhu b, Shuiqing Hu d, Min Fei e, Daiwei Wan f, Wen Gu b, Xiaodong Yang g, Dongtao Shi h, Jian Zhou b, Jin Zhou b, Zheng Zhu i, Liang Wang b, Dechun Li b, Yanyun Zhang a a
Shanghai Institute of Immunology, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, China Department of General Surgery, the First Affiliated Hospital of Soochow University, Suzhou 215006, China c Washington University School of Medicine, St. Louis, Missouri 63110, USA d Department of Clinical Laboratories, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, China e Jiangsu Institute Hematology, the First Affiliated Hospital of Soochow University, Suzhou 215006, China f Department of General Surgery, the First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510000, China g Department of General Surgery, the Second Affiliated Hospital of Soochow University, Suzhou 215006, China h Department of gastroenterology, the First Affiliated Hospital of Soochow University, Suzhou 215500, China i Department of General Surgery, Jiangsu Shengze Hospital, Suzhou 215228, China b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 27 February 2014 Accepted 17 March 2014
Cancer stem cells (CSCs) have been the focus of intense investigations in cancer research although the cellular origin of CSCs has not been clearly determined. Lgr5 is a regulated target of Wnt/b-catenin signaling, which was first identified as a marker of intestinal stem cells. However, the expression of Lgr5 in human colorectal cancer (CRC) and its clinical clinicopathological significance in CRC patients as well as its correlation with Wnt/b-catenin pathway are not fully explored. Localization and expression of Lgr5 in CRC tissues was performed by immunohistochemical staining. The correlation between its expression levels and clinicopathological features as well as clinical outcomes of patients was analysed. The quantitative expression levels of Lgr5 in various CRC cell lines were determined using real-time RT-PCR. The relationship between Lgr5 expression and Wnt/b-catenin pathway in CRC was also investigated. Obviously elevated expression of Lgr5 was observed in CRC tissues, compared to the paired nontumor tissues. mRNA expression levels of Lgr5 was positively correlated with the expression of b-catenin in CRC tissues. The expression of Lgr5 was various in different CRC cell lines. Low and high expression levels of Lgr5 were significantly correlated with clinicopathological features such as TNM stage, lymph node metastasis and vascular invasion of CRC patients. More importantly, Lgr5 expression in CRC tissues was also associated with tumor angiogenesis as well as clinical outcomes. Taken together, these results suggest that elevated Lgr5 expression might contribute to the development and progression of CRC, and it could also be used a potential unfavorable prognostic biomarker for CRC. A better understanding of molecule mechanisms and the relevance of potential value for Lgr5 in the progression of CRC will help to identify a novel therapeutic strategy for CRC patients. ß 2014 Elsevier Masson SAS. All rights reserved.
Keywords: Colorectal cancer Lgr5 Cancer stem cells b-catenin Prognosis
1. Introduction Colorectal cancer (CRC) is one of the most common malignant cancers in China as well as the western world, which has the third
* Corresponding author. Shanghai Institute of Immunology, Shanghai Jiao Tong University School of Medicine, 225 South Chongqing Road, Shanghai 200025, China. Tel.: +8613812613662. E-mail address: [email protected] (S. He). 1 These authors contributed equally to this work.
highest incidence and the fourth highest mortality rate [1–3]. Many treatment protocols have been applied to CRC, but they have not resulted in a complete cure, which may be due to CRC stem cells (CSCs) that are resistant to chemotherapy and radiation, and may enable the recurrence of CRC [4]. CSCs comprise small subpopulation of cells displaying stem cell properties, such as the capability of self-renewal, asymmetric cell differentiation, which are thought to play critical roles in the development and maintenance of a malignant neoplasm [5,6]. Thus, a thorough understanding specific biomarker of CSCs is critical for elucidation
http://dx.doi.org/10.1016/j.biopha.2014.03.016 0753-3322/ß 2014 Elsevier Masson SAS. All rights reserved.
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 2
S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
of mechanisms on carcinogenesis and search for curative therapeutic strategies. It is generally accepted that activation mutations of APC or bcatenin gene in the Wnt pathway plays a pivotal role in the CRC tumorigenesis, which is associated with about 90% of human CRC [7,8]. Meanwhile, recent study also showed the evidence for important roles of Wnt signaling in the stem cells maintenance and development [9]. Leucine-rich repeat-containing G-proteincoupled receptor 5 (Lgr5), a member of G-protein-coupled receptor (GPCR) family of proteins, is also a regulated target of Wnt signaling, was first identified as a marker of intestinal stem cells [10]. Evidence for the existence of colon CSCs has been the most convincing, with Lgr5+ cells of particular interest in CSCs studies [11,12]. Subsequent studies have demonstrated that Lgr5 protein was overexpressed in several solid malignant tumors and Lgr5 has a close association with initiation and recurrence of different cancer types [13–15]. Moreover, crypt Lgr5+ stem cells in intestine have been observed to be represented as the cells of origin for intestinal cancer [11]. Significantly, research has further demonstrated that Lgr5 plays a role in tumor progression likely due to mutational activation of the Wnt/b-catenin pathway [16]. However, the expression of Lgr5 in human CRC and its clinical clinicopathological significance as well as the correlation between Lgr5 expression and Wnt/b-catenin pathway in CRC are not fully explored. In the current study, first, we examined the expression level of Lgr5 in human CRC tissues and various CRC cell lines. Next, we analyzed the clinical clinicopathological correlation of the Lgr5 expression levels in CRC patients. Finally, the relationship between Lgr5 expression and Wnt/b-catenin pathway in CRC was also investigated.
2. Materials and methods 2.1. Patients and specimens Tissue samples from 53 CRC patients were collected during surgical resections performed at the Department of General Surgery, the First Affiliated Hospital of Soochow University between 2009 and 2010. The paired non-tumor tissues samples were used as controls. None of the patients had received any preoperative chemotherapy, radiotherapy or immunotherapy. Tumors were staged according to the American Joint Committee on Cancer (AJCC) pathologic tumor-lymph node metastasis (TNM) classification. Fifty patients were followed up for survival. Informed consent was obtained from all study subjects before sample collection and these samples were used according to ethical standards. 2.2. Cell lines and culture The human CRC cell lines (SW620, Caco-2, SW480, LoVo, and HCT116) were preserved in our institute. Cell lines were seeded in 6-well plate at a density of 1.5 105/well and maintained in RPMI1640 (Invitrogen, USA) supplemented with 10% fetal bovine serum (FBS; Sijiqing Biological Engineering Materials Co., Hangzhou, China) at 37 8C in a humidified atmosphere containing 5% CO2. 2.3. Immunohistochemistry (IHC) Sections were subjected to routine immunohistochemical (IHC) staining as previously described [17]. Samples were fixed in 10% neutral formaldehyde, embedded in paraffin, and sliced. Briefly, the paraffin-embedded tissues were serially cut into 4 mm sections, dewaxed, and rehydrated. Sections were then blocked
with peroxide and non-immune animal serum and incubated sequentially with rabbit antibody to human Lgr5 (Abcam, Cambridge, MA, USA) and Mouse anti-human CD34 monoclonal antibody (Beijing Zhongshan Biotechnology Co., Ltd, China), and biotin-labeled goat anti-rabbit IgG. Finally, the sections were stained with DBA, counterstained with hematoxylin, dehydrated, cleared in xylene, and fixed. 2.4. Evaluation of the IHC results IHC staining was independently examined by two clinical pathologists who were unaware of the patient outcome. Interpretation and evaluation of IHC results was as previously described [18]. Vascular endothelial cells or clusters of brown-stained cells were defined as microvasculature as long as they formed clear boundaries with adjacent capillaries, tumor cells or other connective tissue. The mean value of Lgr5+ cells and the density of CD34 were calculated in the 5 selected fields. The median value of Lgr5+ cells was used to categorize the 53 tumor tissues into Lgr5+ high and low frequency groups. 2.5. Quantitative real-time PCR (qRT-PCR) The mRNA expression of Lgr5 in CRC cell lines was quantified by qRT-PCR. Total RNA was isolated from cells using Trizol Reagent (Invitrogen) and quantified. cDNA was synthesized from 5 mg of RNA using AMV reverse transcriptase (Fermentas, USA) according to the manufacturer’s instructions. Lgr5 was amplified from the cDNA by qRT-PCR. The PCR conditions consisted of 5 min at 95 8C one cycle, 30 s at 95 8C, 30 s at 55 8C, 30 s at 72 8C, and 7 min at 72 8C 35 cycles. The primer sequences were 50 CTCCCAGGTCTGGTGTGTTG -30 (forward) and 50 -GAGGTCTAGGTAGGAGGTGAAG -30 (reverse) for Lgr5; 50 -TGCCAAGTGGGTGGTATAGAG-30 (forward) and 50 -TGGGATGGTGGGTGTAAGAG-30 (reverse) for b-catenin; 50 -TGTGGGCATCAATGGATTTGGV-30 (forward) and 50 -ACACCATGTATTCCGGGTCAAT -30 (reverse) for GAPDH. 2.6. Statistical analysis Statistical analysis was performed with SPSS17.0 software (SPSS Inc, Chicago, USA). Data are expressed as the mean standard deviation (SD). The correlation between Lgr5 expression and MVD was determined by Pearson correlation analysis, and the correlation between IHC results and clinical pathological characteristics was determined by Fisher’s exact test. Survival was estimated by the Kaplan-Meier method and compared by the log-rank test. Multivariate analysis of prognostic factors was performed using the Cox proportional hazards model. A value of P < 0.05 was considered statistically significant.
3. Results 3.1. Expression of Lgr5 was increased in CRC tissues comparing to the paired non-tumor tissues To elucidate the role of Lgr5 in colorectal tumorigenesis, we firstly investigate the expression of Lgr5 in primary CRC tissues by IHC staining. As shown in Fig. 1, expression of Lgr5 protein was found mostly in the cytoplasm and membrane of cancer cells in CRC tissues. As reports in many studies, Lgr5+ cells moved up to the crypt surface in a patchy distribution pattern and diffused in some cases of CRC tissues. In the 53 cases of CRC patients, 38 cases (78.6%) were positive for Lgr5 expression, among whom 24 (45.3%) were at strong level of Lgr5 expression. On the contrary, Lgr5 was
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
3
Fig. 1. Representative immunohistochemical staining of Lgr5 in CRC tissues and the paired non-tumor tissues. H&E staining of CRC tissues (a) and the paired non-tumor tissues (b). c: positive Lgr5 immunohistochemical staining in CRC tissues. d: negative Lgr5 immunohistochemical staining in paired non-tumor tissues. Original magnification 400 (a–d).
negative or weakly expressed in the paired non-tumor colorectal tissues (P < 0.01, Table 1). 3.2. Expression of Lgr5 was varied in CRC cell lines Based on the expression pattern in CRC tissues, we next detected the Lgr5 expression in a panel of CRC cell lines (SW620, Caco-2, SW480, LoVo, and HCT116) Using qRT-PCR. Similar to previous studies, our results showed that Lgr5 expression was varied in five different CRC cell lines. There is a high expression in three CRC cell lines (SW620, Caco-2, and SW480) and a relatively low expression in the other two CRC cell lines (LoVo and HCT116) (Fig. 2). Table 1 Immunohistochemical staining of Lgr5 in CRC tissues. Lgr5 expression
CRC tissues (n)
Paired non-tumor tissues (n)
– + ++ +++ Total P value
7 8 14 24 53
31 15 6 1 53 < 0.01
CRC: colorectal cancer; –: negative; +: weakly positive; ++: positive; +++: strongly positive.
Fig. 2. Varied Lgr5 expression in different CRC cell lines. Relative expression levels of Lgr5 mRNA in five CRC cell lines (SW620, Caco-2, SW480, LoVo, and HCT116) were detected by qRT-PCR. Results are given as average value of the gray in three target genes and internal controls from three independent experiments.
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
4
Table 2 Correlation of Lgr5 expression with clinicopathological features in CRC. Clinicopathological parameters
Case no.
Lgr5 expression
P value
Low (%)
High (%)
Total cases Gender Male Female Age > 60 years < 60 years BMI > 30 kg/m2 < 30 kg/m2 Tumor size < 5 cm > 5 cm Differentiation Well Moderate Poor TNM stage I II III IV Lymph node metastasis Positive Negative Vascular invasion Positive Negative Distant metastasis Positive Negative
53
15 (28.3)
38 (71.7)
29 24
7 (24.1) 5 (20.1)
22 (75.9) 19 (79.9)
31 22
7 (22.6) 6 (27.3)
24 (77.4) 16 (72.7)
15 38
4 (26.7) 12 (31.6)
11 (73.3) 26 (68.4)
36 17
9 (25.0) 3 (17.7)
27 (75.0) 14 (82.3)
15 19 19
3 (20.0) 5 (26.3) 3 (15.8)
13 (80.0) 14 (73.7) 16 (84.2)
9 21 16 7
5 8 3 1
4 13 15 6
35 18
5 (14.3) 8 (44.4)
30 (85.7) 10 (55.6)
13 40
2 (8.7) 13 (32.5)
11 (91.3) 27 (67.5)
7 46
2 (28.6) 14 (30.4)
5 (71.4) 32 (69.6)
> 0.05
> 0.05
> 0.05
> 0.05
> 0.05
< 0.05 (55.6) (38.1) (18.8) (14.3)
(44.4) (61.9) (81.2) (85.7) < 0.05
< 0.01
> 0.05
CRC: colorectal cancer; BMI: body mass index; TNM: tumor-lymph node metastasis.
3.3. Lgr5 expression in CRC tissues correlated with clinicopathologic parameters The correlation between the Lgr5 expression and clinicopathological features in CRC patients was analyzed in terms of significantly elevated expression level of Lgr5 in CRC tissues. Here we subdivided the CRC cases in two groups according to the Lgr5 expression levels (low and high). Correlation analysis demonstrated that the Lgr5 expression was significantly correlated with TNM stage (P < 0.05), lymph node metastasis (P < 0.05) and vascular invasion (P < 0.01), but it was not correlated with gender, age, BMI, tumor size, differentiation, and distant metastasis of the patients (Table 2). Thus, our results suggest that elevated Lgr5 expression might not only contribute to the development and progression of CRC, but also it could be used a potential unfavorable prognostic biomarker for CRC. 3.4. Lgr5 expression in CRC tissues correlated with tumor angiogenesis Considering that the Lgr5 expression was correlated with the vascular invasion in CRC tissues, we next further investigated the correlation between Lgr5 expression and tumor angiogenesis in CRC. Vascular endothelial cells were detected using a mouse anti-human
CD34 monoclonal antibody, and tumor angiogenesis was evaluated by calculating microvessel density (MVD). Statistically, Lgr5 expression was significantly correlated with MVD in 25 CRC tissues, as determined by the Pearson correlation analysis (P < 0.05, Table 3 and Fig. 3). This suggests that Lgr5 might be involved in tumor angiogenesis and in the promotion of vascular formation of CRC, thereby further facilitating tumor proliferation and metastasis. 3.5. Lgr5 expression in CRC tissues was associated with poor clinical outcomes Among 53 CRC patients, follow up was successful for 50 (94.3%). At the end of the follow-up period for 48 months, 39 of the 50 patients (78.0%) were alive, 11 patients (22.0%) were dead. These patients were also divided into two groups according to the low and high expression levels of Lgr5 in CRC tissues. Follow-up data showed that patients with low level of Lgr5 expression had significantly longer survival time than patients with high level of Lgr5 expression (log-rank test, P = 0.039, Fig. 4). Lgr5 expression was further found to be one of the independent prognostic factor by the Cox proportional hazard model (P < 0.01, Table 4). Therefore, an abnormal high frequency of Lgr5 expression in CRC was correlated with poor prognosis, thereby Lgr5 could be a
Table 3 Correlation of Lgr5 expression with tumor angiogenesis. Groups
CRC tissues Paired non-tumor tissue
Cases (n)
25 25
Lgr5 (n (%))
MVD (n/HPF)
–
+
++
+++
4 (16.0) 13 (52.0)
3 (12.0) 7 (28.0)
8 (32.0) 4 (16.0)
10 (40.0) 1 (4.0)
23.2 4.7 12.3 2.9
P value
< 0.05
CRC: colorectal cancer; MVD: microvessel density; HPF: high power field.
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
5
Fig. 3. Representative immunohistochemical staining of CD34 in two groups of CRC tissues with high (a) and low (b) expression levels of Lgr5. Original magnification 200 (a, b).
Table 4 Cox regression analysis of prognostic factors in CRC. Prognostic variables
HR
Gender Age (years) BMI Tumor size Differentiation TNM stage Lymph node metastasis Vascular invasion Distant metastasis Lgr5 expression
95% CI for HR
1.185 1.429 1.661 1.265 1.998 2.561 1.301 3.374 1.906 2.482
Lower
Higher
0.717 0.989 1.132 1.245 0.774 1.225 0.846 1.275 1.285 1.520
1.476 1.388 1.892 1.948 1.612 3.602 1.205 3.280 2.941 4.283
P value
> 0.05 > 0.05 > 0.05 > 0.05 > 0.05 < 0.05 > 0.05 < 0.05 > 0.05 < 0.01
CRC: colorectal cancer; HR: Hazard ratio; CI: confidence interval; BMI: body mass index; TNM: tumor-lymph node metastasis.
Table 5 Correlation between Lgr5 and P-catenin expression in CRC tissues. P-catenin expression Fig. 4. Correlation between levels of Lgr5+ cells in CRC tissues and patient survival (n = 50). Survival curves of 50 CRC patients with different Lgr5+ levels are shown. Kaplan-Meier survival curves for high expression of Lgr5+ group were significantly different (log-rank test, P = 0.039) from the low expression group.
potential biomarker indicating poor clinical outcome in CRC patients. 3.6. Lgr5 expression correlated with b-catenin expression in CRC tissues Given Lgr5 is a regulated target of Wnt/b-catenin signaling, the relationship between Lgr5 and the canonical Wnt pathway of bcatenin was also investigated in our study. Statistical analysis of qRT-PCR results showed that mRNA expression levels of Lgr5 and b-catenin in CRC tissues was significantly higher than in paired non-tumor tissues. In addition, the expression of Lgr5 was positively correlated with the expression of b-catenin in CRC tissues (P < 0.05, Table 5).
4. Discussion In the present study, we observed an obviously evaluated expression of Lgr5 in CRC tissues and various expression levels in different CRC cell lines. Furthermore, the clinical clinicopathological
Low (n) High (n)
Lgr5 expression Low (n)
High (n)
11 4
7 31
r
P value
–0.077
0.025
CRC: colorectal cancer.
significance of Lgr5 expression in CRC patients was also demonstrated. Finally, the correlation of Lgr5 expression and Wnt/bcatenin signaling pathway was investigated. Taken together, these data suggest a critical role of Lgr5 in the progression of human CRC. In recent years, CSCs have been the focus of intense investigations in cancer research, which provides an attractive cellular mechanism to account for the therapeutic refractoriness and dormant behavior exhibited by many tumors [19]. Although the cellular origin of CSCs has not been clearly determined, GCRs have been hypothesized to be closely associated with CSCs in tumorigenesis. Lgr5 is a member of GPCR family of proteins and is also a regulated target of Wnt pathway [20]. Recent analyses on human tissues indicated a possible role of Lgr5 expressing cells in the development of various tumors and proposed possible prognostic importance of these cells [14,21–24]. An apparent difference in Lgr5+ cells distribution among different tumorigenesis stages was observed in various studies, which suggest that the shifts of Lgr5+ cells location towards the lower crypt maybe an early event in the premalignant transformation of stem cells and play a role in the development and progression of CRC [22,25]. Herein, in our study, we firstly
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 6
S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
observed significantly higher LGR5 expression in a large cohort of human CRC tissues and different expression in a panel of CRC cell lines. More importantly, Lgr5 levels significantly correlated with clinical characteristics of CRC patients including TNM stage, lymph node metastasis and vascular invasion as well as clinical outcome. Thus, these observations prompted us to explore the potential role of Lgr5 in the development of CRC. Our findings also suggested that the involvement of Lgr5 maybe not only in early events but also in late events in CRC tumorigenesis, and it could be a potential new therapeutic target for the treatment of CRC patients. As to the underlying molecular mechanism, most of studies have provided direct evidence that Lgr5 becomes part of the Wnt/ b-catenin signaling pathway. However, internalization of Lgr5 does not appear to be essential for potentiating the canonical Wnt signaling pathway [26,27]. We also investigated the relationship between Lgr5 expression and b-catenin expression in CRC tissues and the results showed the positive correlation, which is consisted with most of the studies. However, few studies put forward the opposite points. Walker et al. [28] observed that expression profiling revealed enhanced Wnt signalling and upregulation of EMT genes upon knockdown of Lgr5, with opposite changes in Lgr5 over-expressing cells. Likewise, Garcia et al. [29] investigated the role of Lgr5 during ileal development using Lgr5 null/LacZNeoR knock-in mice. The deregulation of Lgr5 expression was associated with over-expression of Wnt target genes in the intervillus epithelium. Together, their data suggested Lgr5 as a negative regulator of the Wnt pathway in the developing intestine. It is important to address several limitations to our study. Firstly, some further functional studies including comparing the proliferation, cell cycle, and sensitivity to the chemotherapy in CRC should be performed after separating the Lgr5+ and Lgr5– cells from CRC tissues, which may ultimately confirm the potential CRC marker for CSCs. Secondly, the role of Lgr5 in the progress of CRC in vivo should be further studied. Finally, we should continue to explore the mechanisms underlying the effect of Lgr5 to the biological behavior of CRC especially in Wnt pathway, which is of importance of its clinical implications and targeted therapeutic interventions in CRC. Evidences have defined the roles of various autophagy related genes and related pathway in the regulation of tumor progression and the maintenance, expansion and differentiation of various CSCs [30,31]. Our up-to-date study reported that Ambra1, a key autophagy related gene, served a pro-survival role in CRC cells, and autophagy improves the aggressiveness of CRC cells and their ability to adapt to apoptotic stimuli [32]. Thus, an intriguing alternative hypothesis for the relationship between autophagy and Lgr5+ CRC cells could be investigated. On the other hand, recent studies have indicated that microRNAs play crucial roles in the CSCs considering as the origin of cancer and contribute to the recurrence and metastasis [33,34]. We have previously shown that there is an aberrant expression of miRNA-199a-3p in CRC tissues and its clinical significance [35]. So it seems to be interesting and important to explore the mechanism underlying the mutual relationship between miRNA and Lgr5+ CRC cells. In conclusion, our current study demonstrated the overexpression of Lgr5 in human CRC tissues and an important clinicopathological significance, which suggested that Lgr5 may not only play an important role in the progression of CRC but also serve as a relevant candidate marker for diagnosis and novel prognostic indicator in CRC. Lgr5 involved the Wnt/b-catenin signaling pathway in CRC. These findings may facilitate a potential approach to understanding the role of this marker in cancer. Elucidation of Lgr5 functions and the mechanism of its regulation may provide better understanding of colorectal tumorigenesis and may ultimately lead to the development of novel CSCs-based therapeutic strategies against CRC patients.
Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgements This study was supported by Project of Nature Science Foundation of China (81201905, 81301933), China Postdoctoral Science Foundation (2013M540374), Nature Science Research Grants in University of Jiangsu Province of China (12KJB320009), Shanghai Postdoctoral Scientific Program of China (13R21415200), Innovation Program of Shanghai Municipal Education Commission (12YZ050), Science and Technology Research Project of in Science and Technology Bureau of Suzhou City (SYS201220), and sponsored by Jiangsu Health International Exchange Program Sponsorship. References [1] Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin 2013;63(1):11–30. [2] Brenner H, Kloor M, Pox CP. Colorectal cancer. Lancet 2013;S01406736(13):61649–9. [3] Zhu X, Huang Z, Chen Y, Zhou J, Hu S, Zhi Q, et al. Effect of CLN3 silencing by RNA interference on the proliferation and apoptosis of human colorectal cancer cells. Biomed Pharmacother 2014. http://dx.doi.org/10.1016/j.biopha.2013.12.010 [pii:S0753-3322(14)00006-7, Epub ahead of print]. [4] Radtke F, Clevers H. Self-renewal and cancer of the gut: two sides of a coin. Science 2005;307(5717):1904–9. [5] Lobo NA, Shimono Y, Qian D, Clarke MF. The biology of cancer stem cells. Annu Rev Cell Dev Biol 2007;23:675–99. [6] Delude C, Tumorigenesis:. Testing ground for cancer stem cells. Nature 2011;480(7377):S43–5. [7] Cancer Genome Atlas Network. Comprehensive molecular characterization of human colon and rectal cancer. Nature 2012;487(7407):330–7. [8] He S, Yuan Y, Wang L, Yu M, Zhu Y, Zhu X. Effects of cyclin-dependent kinase 8 specific siRNA on the proliferation and apoptosis of colon cancer cells. J Exp Clin Cancer Res 2011;30(1):109. [9] van Es JH, van Gijn ME, Riccio O, van den Born M, Vooijs M, Begthel H, et al. Notch/gamma-secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature 2005;435(7044):959–63. [10] Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, Cozijnsen M, et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 2007;449(7165):1003–7. [11] Barker N, Ridgway RA, van Es JH, van de Wetering M, Begthel H, van den Born M, et al. Crypt stem cells as the cells-of-origin of intestinal cancer. Nature 2009;457(7229):608–11. [12] Vermeulen L, Todaro M, de Sousa Mello F, Sprick MR, Kemper K, Perez Alea M, et al. Single-cell cloning of colon cancer stem cells reveals a multi-lineage differentiation capacity. Proc Natl Acad Sci U S A 2008;105(36):13427–32. [13] Aoki D, Suzuki N, Susumu N, Noda T, Suzuki A, Tamada Y, et al. Establishment and characterization of the RMG-V cell line from human ovarian clear cell adenocarcinoma. Hum Cell 2005;18(3):143–6. [14] Uchida H, Yamazaki K, Fukuma M, Yamada T, Hayashida T, Hasegawa H, et al. Overexpression of leucine-rich repeat-containing G protein-coupled receptor 5 in colorectal cancer. Cancer Sci 2010;101(7):1731–7. [15] Tanese K, Fukuma M, Yamada T, Mori T, Yoshikawa T, Watanabe W, et al. Gprotein-coupled receptor GPR49 is up-regulated in basal cell carcinoma and promotes cell proliferation and tumor formation. Am J Pathol 2008;173(3):835–43. [16] Yui S, Nakamura T, Sato T, Nemoto Y, Mizutani T, Zheng X, et al. Functional engraftment of colon epithelium expanded in vitro from a single adult Lgr5+ stem cell. Nat Med 2012;18(4):618–23. [17] Liu PF, Wu YY, Hu Y, Wang L, He SB, Zhu YB, et al. Silencing of pancreatic adenocarcinoma upregulated factor by RNA interference inhibits the malignant phenotypes in human colorectal cancer cells. Oncol Rep 2013;30(1):213– 20. [18] He SB, Zhao H, Fei M, Wu YG, Wang L, Zhu XG, et al. Expression of co-signaling molecules CD40-CD40L and their growth inhibitory effect on pancreatic cancer in vitro. Oncol Rep 2012;28(1):262–8. [19] Kitamura H, Okudela K, Yazawa T, Sato H, Shimoyamada H. Cancer stem cell: implications in cancer biology and therapy with special reference to lung cancer. Lung Cancer 2009;66(3):275–81. [20] Van der Flier LG, Sabates-Bellver J, Oving I, Haegebarth A, De Palo M, Anti M, et al. The Intestinal Wnt/TCF signature. Gastroenterology 2007;132(2):628– 32. [21] Takahashi H, Ishii H, Nishida N, Takemasa I, Mizushima T, Ikeda M, et al. Significance of Lgr5(+ve) cancer stem cells in the colon and rectum. Ann Surg Oncol 2011;18(4):1166–74.
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx [22] Takeda K, Kinoshita I, Shimizu Y, Matsuno Y, Shichinohe T, Dosaka-Akita H. Expression of LGR5, an intestinal stem cell marker, during each stage of colorectal tumorigenesis. Anticancer Res 2011;31(1):263–70. [23] Becker L, Huang Q, Mashimo H. Lgr5, an intestinal stem cell marker, is abnormally expressed in Barrett’s esophagus and esophageal adenocarcinoma. Dis Esophagus 2010;23(2):168–74. [24] Merlos-Sua´rez A, Barriga FM, Jung P, Iglesias M, Ce´spedes MV, Rossell D, et al. The intestinal stem cell signature identifies colorectal cancer stem cells and predicts disease relapse. Cell Stem Cell 2011;8(5):511–24. [25] Simon E, Petke D, Bo¨ger C, Behrens HM, Warneke V, Ebert M, et al. The spatial distribution of LGR5+ cells correlates with gastric cancer progression. PLoS One 2012;7(4):e35486. [26] Carmon KS, Lin Q, Gong X, Thomas A, Liu Q. LGR5 interacts and cointernalizes with Wnt receptors to modulate Wnt/b-catenin signaling. Mol Cell Biol 2012;32:2054–64. [27] Ruffner H, Sprunger J, Charlat O, Leighton-Davies J, Grosshans B, Salathe A, et al. R-Spondin potentiates Wnt/b-catenin signaling through orphan receptors LGR4 and LGR5. PLoS One 2012;7:e40976. [28] Walker F, Zhang HH, Odorizzi A, Burgess AW. LGR5 is a negative regulator of tumourigenicity, antagonizes Wnt signalling and regulates cell adhesion in colorectal cancer cell lines. PLoS One 2011;6:e22733.
7
[29] Garcia MI, Ghiani M, Lefort A, Libert F, Strollo S, Vassart G. LGR5 deficiency deregulates Wnt signaling and leads to precocious Paneth cell differentiation in the fetal intestine. Dev Biol 2009;331:58–67. [30] Roy S, Debnath J. Autophagy and tumorigenesis. Semin Immunopathol 2010;32(4):383–96. [31] Rausch V, Liu L, Apel A, Rettig T, Gladkich J, Labsch S, et al. Autophagy mediates survival of pancreatic tumour-initiating cells in a hypoxic microenvironment. J Pathol 2012;227(3):325–35. [32] Gu W, Wan DW, Qian QY, Yi B, Gu YL, He ZL, et al. Ambra1 is an essential regulator of autophagy and apoptosis in SW620 cells: pro-survival role of Ambra1. Plos One 2014;9(2):e90151. [33] Sun X, Jiao X, Pestell TG, Fan C, Qin S, Mirabelli E, et al. MicroRNAs and cancer stem cells: the sword and the shield. Oncogene 2013. http://dx.doi.org/ 10.1038/onc.2013.492 [Epub ahead of print]. [34] Bu P, Chen KY, Chen JH, Wang L, Walters J, Shin YJ, et al. A microRNA miR-34aregulated bimodal switch targets notch in colon cancer stem cells. Cell Stem Cell 2013;12(5):602–15. [35] Wan DW, He SB, Xie BH, Xu GH, Gu W, Shen CL, et al. Aberrant expression of miR-199a-3p and its clinical significance in colorectal cancers. Med Oncol 2013;30:378.
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
BIOPHA-3390; No. of Pages 7 Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
Available online at
ScienceDirect www.sciencedirect.com
Original article
Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance Songbing He a,b,c,1,*, Hao Zhou b,1, Xinguo Zhu b, Shuiqing Hu d, Min Fei e, Daiwei Wan f, Wen Gu b, Xiaodong Yang g, Dongtao Shi h, Jian Zhou b, Jin Zhou b, Zheng Zhu i, Liang Wang b, Dechun Li b, Yanyun Zhang a a
Shanghai Institute of Immunology, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, China Department of General Surgery, the First Affiliated Hospital of Soochow University, Suzhou 215006, China c Washington University School of Medicine, St. Louis, Missouri 63110, USA d Department of Clinical Laboratories, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, China e Jiangsu Institute Hematology, the First Affiliated Hospital of Soochow University, Suzhou 215006, China f Department of General Surgery, the First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510000, China g Department of General Surgery, the Second Affiliated Hospital of Soochow University, Suzhou 215006, China h Department of gastroenterology, the First Affiliated Hospital of Soochow University, Suzhou 215500, China i Department of General Surgery, Jiangsu Shengze Hospital, Suzhou 215228, China b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 27 February 2014 Accepted 17 March 2014
Cancer stem cells (CSCs) have been the focus of intense investigations in cancer research although the cellular origin of CSCs has not been clearly determined. Lgr5 is a regulated target of Wnt/b-catenin signaling, which was first identified as a marker of intestinal stem cells. However, the expression of Lgr5 in human colorectal cancer (CRC) and its clinical clinicopathological significance in CRC patients as well as its correlation with Wnt/b-catenin pathway are not fully explored. Localization and expression of Lgr5 in CRC tissues was performed by immunohistochemical staining. The correlation between its expression levels and clinicopathological features as well as clinical outcomes of patients was analysed. The quantitative expression levels of Lgr5 in various CRC cell lines were determined using real-time RT-PCR. The relationship between Lgr5 expression and Wnt/b-catenin pathway in CRC was also investigated. Obviously elevated expression of Lgr5 was observed in CRC tissues, compared to the paired nontumor tissues. mRNA expression levels of Lgr5 was positively correlated with the expression of b-catenin in CRC tissues. The expression of Lgr5 was various in different CRC cell lines. Low and high expression levels of Lgr5 were significantly correlated with clinicopathological features such as TNM stage, lymph node metastasis and vascular invasion of CRC patients. More importantly, Lgr5 expression in CRC tissues was also associated with tumor angiogenesis as well as clinical outcomes. Taken together, these results suggest that elevated Lgr5 expression might contribute to the development and progression of CRC, and it could also be used a potential unfavorable prognostic biomarker for CRC. A better understanding of molecule mechanisms and the relevance of potential value for Lgr5 in the progression of CRC will help to identify a novel therapeutic strategy for CRC patients. ß 2014 Elsevier Masson SAS. All rights reserved.
Keywords: Colorectal cancer Lgr5 Cancer stem cells b-catenin Prognosis
1. Introduction Colorectal cancer (CRC) is one of the most common malignant cancers in China as well as the western world, which has the third
* Corresponding author. Shanghai Institute of Immunology, Shanghai Jiao Tong University School of Medicine, 225 South Chongqing Road, Shanghai 200025, China. Tel.: +8613812613662. E-mail address: [email protected] (S. He). 1 These authors contributed equally to this work.
highest incidence and the fourth highest mortality rate [1–3]. Many treatment protocols have been applied to CRC, but they have not resulted in a complete cure, which may be due to CRC stem cells (CSCs) that are resistant to chemotherapy and radiation, and may enable the recurrence of CRC [4]. CSCs comprise small subpopulation of cells displaying stem cell properties, such as the capability of self-renewal, asymmetric cell differentiation, which are thought to play critical roles in the development and maintenance of a malignant neoplasm [5,6]. Thus, a thorough understanding specific biomarker of CSCs is critical for elucidation
http://dx.doi.org/10.1016/j.biopha.2014.03.016 0753-3322/ß 2014 Elsevier Masson SAS. All rights reserved.
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 2
S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
of mechanisms on carcinogenesis and search for curative therapeutic strategies. It is generally accepted that activation mutations of APC or bcatenin gene in the Wnt pathway plays a pivotal role in the CRC tumorigenesis, which is associated with about 90% of human CRC [7,8]. Meanwhile, recent study also showed the evidence for important roles of Wnt signaling in the stem cells maintenance and development [9]. Leucine-rich repeat-containing G-proteincoupled receptor 5 (Lgr5), a member of G-protein-coupled receptor (GPCR) family of proteins, is also a regulated target of Wnt signaling, was first identified as a marker of intestinal stem cells [10]. Evidence for the existence of colon CSCs has been the most convincing, with Lgr5+ cells of particular interest in CSCs studies [11,12]. Subsequent studies have demonstrated that Lgr5 protein was overexpressed in several solid malignant tumors and Lgr5 has a close association with initiation and recurrence of different cancer types [13–15]. Moreover, crypt Lgr5+ stem cells in intestine have been observed to be represented as the cells of origin for intestinal cancer [11]. Significantly, research has further demonstrated that Lgr5 plays a role in tumor progression likely due to mutational activation of the Wnt/b-catenin pathway [16]. However, the expression of Lgr5 in human CRC and its clinical clinicopathological significance as well as the correlation between Lgr5 expression and Wnt/b-catenin pathway in CRC are not fully explored. In the current study, first, we examined the expression level of Lgr5 in human CRC tissues and various CRC cell lines. Next, we analyzed the clinical clinicopathological correlation of the Lgr5 expression levels in CRC patients. Finally, the relationship between Lgr5 expression and Wnt/b-catenin pathway in CRC was also investigated.
2. Materials and methods 2.1. Patients and specimens Tissue samples from 53 CRC patients were collected during surgical resections performed at the Department of General Surgery, the First Affiliated Hospital of Soochow University between 2009 and 2010. The paired non-tumor tissues samples were used as controls. None of the patients had received any preoperative chemotherapy, radiotherapy or immunotherapy. Tumors were staged according to the American Joint Committee on Cancer (AJCC) pathologic tumor-lymph node metastasis (TNM) classification. Fifty patients were followed up for survival. Informed consent was obtained from all study subjects before sample collection and these samples were used according to ethical standards. 2.2. Cell lines and culture The human CRC cell lines (SW620, Caco-2, SW480, LoVo, and HCT116) were preserved in our institute. Cell lines were seeded in 6-well plate at a density of 1.5 105/well and maintained in RPMI1640 (Invitrogen, USA) supplemented with 10% fetal bovine serum (FBS; Sijiqing Biological Engineering Materials Co., Hangzhou, China) at 37 8C in a humidified atmosphere containing 5% CO2. 2.3. Immunohistochemistry (IHC) Sections were subjected to routine immunohistochemical (IHC) staining as previously described [17]. Samples were fixed in 10% neutral formaldehyde, embedded in paraffin, and sliced. Briefly, the paraffin-embedded tissues were serially cut into 4 mm sections, dewaxed, and rehydrated. Sections were then blocked
with peroxide and non-immune animal serum and incubated sequentially with rabbit antibody to human Lgr5 (Abcam, Cambridge, MA, USA) and Mouse anti-human CD34 monoclonal antibody (Beijing Zhongshan Biotechnology Co., Ltd, China), and biotin-labeled goat anti-rabbit IgG. Finally, the sections were stained with DBA, counterstained with hematoxylin, dehydrated, cleared in xylene, and fixed. 2.4. Evaluation of the IHC results IHC staining was independently examined by two clinical pathologists who were unaware of the patient outcome. Interpretation and evaluation of IHC results was as previously described [18]. Vascular endothelial cells or clusters of brown-stained cells were defined as microvasculature as long as they formed clear boundaries with adjacent capillaries, tumor cells or other connective tissue. The mean value of Lgr5+ cells and the density of CD34 were calculated in the 5 selected fields. The median value of Lgr5+ cells was used to categorize the 53 tumor tissues into Lgr5+ high and low frequency groups. 2.5. Quantitative real-time PCR (qRT-PCR) The mRNA expression of Lgr5 in CRC cell lines was quantified by qRT-PCR. Total RNA was isolated from cells using Trizol Reagent (Invitrogen) and quantified. cDNA was synthesized from 5 mg of RNA using AMV reverse transcriptase (Fermentas, USA) according to the manufacturer’s instructions. Lgr5 was amplified from the cDNA by qRT-PCR. The PCR conditions consisted of 5 min at 95 8C one cycle, 30 s at 95 8C, 30 s at 55 8C, 30 s at 72 8C, and 7 min at 72 8C 35 cycles. The primer sequences were 50 CTCCCAGGTCTGGTGTGTTG -30 (forward) and 50 -GAGGTCTAGGTAGGAGGTGAAG -30 (reverse) for Lgr5; 50 -TGCCAAGTGGGTGGTATAGAG-30 (forward) and 50 -TGGGATGGTGGGTGTAAGAG-30 (reverse) for b-catenin; 50 -TGTGGGCATCAATGGATTTGGV-30 (forward) and 50 -ACACCATGTATTCCGGGTCAAT -30 (reverse) for GAPDH. 2.6. Statistical analysis Statistical analysis was performed with SPSS17.0 software (SPSS Inc, Chicago, USA). Data are expressed as the mean standard deviation (SD). The correlation between Lgr5 expression and MVD was determined by Pearson correlation analysis, and the correlation between IHC results and clinical pathological characteristics was determined by Fisher’s exact test. Survival was estimated by the Kaplan-Meier method and compared by the log-rank test. Multivariate analysis of prognostic factors was performed using the Cox proportional hazards model. A value of P < 0.05 was considered statistically significant.
3. Results 3.1. Expression of Lgr5 was increased in CRC tissues comparing to the paired non-tumor tissues To elucidate the role of Lgr5 in colorectal tumorigenesis, we firstly investigate the expression of Lgr5 in primary CRC tissues by IHC staining. As shown in Fig. 1, expression of Lgr5 protein was found mostly in the cytoplasm and membrane of cancer cells in CRC tissues. As reports in many studies, Lgr5+ cells moved up to the crypt surface in a patchy distribution pattern and diffused in some cases of CRC tissues. In the 53 cases of CRC patients, 38 cases (78.6%) were positive for Lgr5 expression, among whom 24 (45.3%) were at strong level of Lgr5 expression. On the contrary, Lgr5 was
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
3
Fig. 1. Representative immunohistochemical staining of Lgr5 in CRC tissues and the paired non-tumor tissues. H&E staining of CRC tissues (a) and the paired non-tumor tissues (b). c: positive Lgr5 immunohistochemical staining in CRC tissues. d: negative Lgr5 immunohistochemical staining in paired non-tumor tissues. Original magnification 400 (a–d).
negative or weakly expressed in the paired non-tumor colorectal tissues (P < 0.01, Table 1). 3.2. Expression of Lgr5 was varied in CRC cell lines Based on the expression pattern in CRC tissues, we next detected the Lgr5 expression in a panel of CRC cell lines (SW620, Caco-2, SW480, LoVo, and HCT116) Using qRT-PCR. Similar to previous studies, our results showed that Lgr5 expression was varied in five different CRC cell lines. There is a high expression in three CRC cell lines (SW620, Caco-2, and SW480) and a relatively low expression in the other two CRC cell lines (LoVo and HCT116) (Fig. 2). Table 1 Immunohistochemical staining of Lgr5 in CRC tissues. Lgr5 expression
CRC tissues (n)
Paired non-tumor tissues (n)
– + ++ +++ Total P value
7 8 14 24 53
31 15 6 1 53 < 0.01
CRC: colorectal cancer; –: negative; +: weakly positive; ++: positive; +++: strongly positive.
Fig. 2. Varied Lgr5 expression in different CRC cell lines. Relative expression levels of Lgr5 mRNA in five CRC cell lines (SW620, Caco-2, SW480, LoVo, and HCT116) were detected by qRT-PCR. Results are given as average value of the gray in three target genes and internal controls from three independent experiments.
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
4
Table 2 Correlation of Lgr5 expression with clinicopathological features in CRC. Clinicopathological parameters
Case no.
Lgr5 expression
P value
Low (%)
High (%)
Total cases Gender Male Female Age > 60 years < 60 years BMI > 30 kg/m2 < 30 kg/m2 Tumor size < 5 cm > 5 cm Differentiation Well Moderate Poor TNM stage I II III IV Lymph node metastasis Positive Negative Vascular invasion Positive Negative Distant metastasis Positive Negative
53
15 (28.3)
38 (71.7)
29 24
7 (24.1) 5 (20.1)
22 (75.9) 19 (79.9)
31 22
7 (22.6) 6 (27.3)
24 (77.4) 16 (72.7)
15 38
4 (26.7) 12 (31.6)
11 (73.3) 26 (68.4)
36 17
9 (25.0) 3 (17.7)
27 (75.0) 14 (82.3)
15 19 19
3 (20.0) 5 (26.3) 3 (15.8)
13 (80.0) 14 (73.7) 16 (84.2)
9 21 16 7
5 8 3 1
4 13 15 6
35 18
5 (14.3) 8 (44.4)
30 (85.7) 10 (55.6)
13 40
2 (8.7) 13 (32.5)
11 (91.3) 27 (67.5)
7 46
2 (28.6) 14 (30.4)
5 (71.4) 32 (69.6)
> 0.05
> 0.05
> 0.05
> 0.05
> 0.05
< 0.05 (55.6) (38.1) (18.8) (14.3)
(44.4) (61.9) (81.2) (85.7) < 0.05
< 0.01
> 0.05
CRC: colorectal cancer; BMI: body mass index; TNM: tumor-lymph node metastasis.
3.3. Lgr5 expression in CRC tissues correlated with clinicopathologic parameters The correlation between the Lgr5 expression and clinicopathological features in CRC patients was analyzed in terms of significantly elevated expression level of Lgr5 in CRC tissues. Here we subdivided the CRC cases in two groups according to the Lgr5 expression levels (low and high). Correlation analysis demonstrated that the Lgr5 expression was significantly correlated with TNM stage (P < 0.05), lymph node metastasis (P < 0.05) and vascular invasion (P < 0.01), but it was not correlated with gender, age, BMI, tumor size, differentiation, and distant metastasis of the patients (Table 2). Thus, our results suggest that elevated Lgr5 expression might not only contribute to the development and progression of CRC, but also it could be used a potential unfavorable prognostic biomarker for CRC. 3.4. Lgr5 expression in CRC tissues correlated with tumor angiogenesis Considering that the Lgr5 expression was correlated with the vascular invasion in CRC tissues, we next further investigated the correlation between Lgr5 expression and tumor angiogenesis in CRC. Vascular endothelial cells were detected using a mouse anti-human
CD34 monoclonal antibody, and tumor angiogenesis was evaluated by calculating microvessel density (MVD). Statistically, Lgr5 expression was significantly correlated with MVD in 25 CRC tissues, as determined by the Pearson correlation analysis (P < 0.05, Table 3 and Fig. 3). This suggests that Lgr5 might be involved in tumor angiogenesis and in the promotion of vascular formation of CRC, thereby further facilitating tumor proliferation and metastasis. 3.5. Lgr5 expression in CRC tissues was associated with poor clinical outcomes Among 53 CRC patients, follow up was successful for 50 (94.3%). At the end of the follow-up period for 48 months, 39 of the 50 patients (78.0%) were alive, 11 patients (22.0%) were dead. These patients were also divided into two groups according to the low and high expression levels of Lgr5 in CRC tissues. Follow-up data showed that patients with low level of Lgr5 expression had significantly longer survival time than patients with high level of Lgr5 expression (log-rank test, P = 0.039, Fig. 4). Lgr5 expression was further found to be one of the independent prognostic factor by the Cox proportional hazard model (P < 0.01, Table 4). Therefore, an abnormal high frequency of Lgr5 expression in CRC was correlated with poor prognosis, thereby Lgr5 could be a
Table 3 Correlation of Lgr5 expression with tumor angiogenesis. Groups
CRC tissues Paired non-tumor tissue
Cases (n)
25 25
Lgr5 (n (%))
MVD (n/HPF)
–
+
++
+++
4 (16.0) 13 (52.0)
3 (12.0) 7 (28.0)
8 (32.0) 4 (16.0)
10 (40.0) 1 (4.0)
23.2 4.7 12.3 2.9
P value
< 0.05
CRC: colorectal cancer; MVD: microvessel density; HPF: high power field.
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
5
Fig. 3. Representative immunohistochemical staining of CD34 in two groups of CRC tissues with high (a) and low (b) expression levels of Lgr5. Original magnification 200 (a, b).
Table 4 Cox regression analysis of prognostic factors in CRC. Prognostic variables
HR
Gender Age (years) BMI Tumor size Differentiation TNM stage Lymph node metastasis Vascular invasion Distant metastasis Lgr5 expression
95% CI for HR
1.185 1.429 1.661 1.265 1.998 2.561 1.301 3.374 1.906 2.482
Lower
Higher
0.717 0.989 1.132 1.245 0.774 1.225 0.846 1.275 1.285 1.520
1.476 1.388 1.892 1.948 1.612 3.602 1.205 3.280 2.941 4.283
P value
> 0.05 > 0.05 > 0.05 > 0.05 > 0.05 < 0.05 > 0.05 < 0.05 > 0.05 < 0.01
CRC: colorectal cancer; HR: Hazard ratio; CI: confidence interval; BMI: body mass index; TNM: tumor-lymph node metastasis.
Table 5 Correlation between Lgr5 and P-catenin expression in CRC tissues. P-catenin expression Fig. 4. Correlation between levels of Lgr5+ cells in CRC tissues and patient survival (n = 50). Survival curves of 50 CRC patients with different Lgr5+ levels are shown. Kaplan-Meier survival curves for high expression of Lgr5+ group were significantly different (log-rank test, P = 0.039) from the low expression group.
potential biomarker indicating poor clinical outcome in CRC patients. 3.6. Lgr5 expression correlated with b-catenin expression in CRC tissues Given Lgr5 is a regulated target of Wnt/b-catenin signaling, the relationship between Lgr5 and the canonical Wnt pathway of bcatenin was also investigated in our study. Statistical analysis of qRT-PCR results showed that mRNA expression levels of Lgr5 and b-catenin in CRC tissues was significantly higher than in paired non-tumor tissues. In addition, the expression of Lgr5 was positively correlated with the expression of b-catenin in CRC tissues (P < 0.05, Table 5).
4. Discussion In the present study, we observed an obviously evaluated expression of Lgr5 in CRC tissues and various expression levels in different CRC cell lines. Furthermore, the clinical clinicopathological
Low (n) High (n)
Lgr5 expression Low (n)
High (n)
11 4
7 31
r
P value
–0.077
0.025
CRC: colorectal cancer.
significance of Lgr5 expression in CRC patients was also demonstrated. Finally, the correlation of Lgr5 expression and Wnt/bcatenin signaling pathway was investigated. Taken together, these data suggest a critical role of Lgr5 in the progression of human CRC. In recent years, CSCs have been the focus of intense investigations in cancer research, which provides an attractive cellular mechanism to account for the therapeutic refractoriness and dormant behavior exhibited by many tumors [19]. Although the cellular origin of CSCs has not been clearly determined, GCRs have been hypothesized to be closely associated with CSCs in tumorigenesis. Lgr5 is a member of GPCR family of proteins and is also a regulated target of Wnt pathway [20]. Recent analyses on human tissues indicated a possible role of Lgr5 expressing cells in the development of various tumors and proposed possible prognostic importance of these cells [14,21–24]. An apparent difference in Lgr5+ cells distribution among different tumorigenesis stages was observed in various studies, which suggest that the shifts of Lgr5+ cells location towards the lower crypt maybe an early event in the premalignant transformation of stem cells and play a role in the development and progression of CRC [22,25]. Herein, in our study, we firstly
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 6
S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
observed significantly higher LGR5 expression in a large cohort of human CRC tissues and different expression in a panel of CRC cell lines. More importantly, Lgr5 levels significantly correlated with clinical characteristics of CRC patients including TNM stage, lymph node metastasis and vascular invasion as well as clinical outcome. Thus, these observations prompted us to explore the potential role of Lgr5 in the development of CRC. Our findings also suggested that the involvement of Lgr5 maybe not only in early events but also in late events in CRC tumorigenesis, and it could be a potential new therapeutic target for the treatment of CRC patients. As to the underlying molecular mechanism, most of studies have provided direct evidence that Lgr5 becomes part of the Wnt/ b-catenin signaling pathway. However, internalization of Lgr5 does not appear to be essential for potentiating the canonical Wnt signaling pathway [26,27]. We also investigated the relationship between Lgr5 expression and b-catenin expression in CRC tissues and the results showed the positive correlation, which is consisted with most of the studies. However, few studies put forward the opposite points. Walker et al. [28] observed that expression profiling revealed enhanced Wnt signalling and upregulation of EMT genes upon knockdown of Lgr5, with opposite changes in Lgr5 over-expressing cells. Likewise, Garcia et al. [29] investigated the role of Lgr5 during ileal development using Lgr5 null/LacZNeoR knock-in mice. The deregulation of Lgr5 expression was associated with over-expression of Wnt target genes in the intervillus epithelium. Together, their data suggested Lgr5 as a negative regulator of the Wnt pathway in the developing intestine. It is important to address several limitations to our study. Firstly, some further functional studies including comparing the proliferation, cell cycle, and sensitivity to the chemotherapy in CRC should be performed after separating the Lgr5+ and Lgr5– cells from CRC tissues, which may ultimately confirm the potential CRC marker for CSCs. Secondly, the role of Lgr5 in the progress of CRC in vivo should be further studied. Finally, we should continue to explore the mechanisms underlying the effect of Lgr5 to the biological behavior of CRC especially in Wnt pathway, which is of importance of its clinical implications and targeted therapeutic interventions in CRC. Evidences have defined the roles of various autophagy related genes and related pathway in the regulation of tumor progression and the maintenance, expansion and differentiation of various CSCs [30,31]. Our up-to-date study reported that Ambra1, a key autophagy related gene, served a pro-survival role in CRC cells, and autophagy improves the aggressiveness of CRC cells and their ability to adapt to apoptotic stimuli [32]. Thus, an intriguing alternative hypothesis for the relationship between autophagy and Lgr5+ CRC cells could be investigated. On the other hand, recent studies have indicated that microRNAs play crucial roles in the CSCs considering as the origin of cancer and contribute to the recurrence and metastasis [33,34]. We have previously shown that there is an aberrant expression of miRNA-199a-3p in CRC tissues and its clinical significance [35]. So it seems to be interesting and important to explore the mechanism underlying the mutual relationship between miRNA and Lgr5+ CRC cells. In conclusion, our current study demonstrated the overexpression of Lgr5 in human CRC tissues and an important clinicopathological significance, which suggested that Lgr5 may not only play an important role in the progression of CRC but also serve as a relevant candidate marker for diagnosis and novel prognostic indicator in CRC. Lgr5 involved the Wnt/b-catenin signaling pathway in CRC. These findings may facilitate a potential approach to understanding the role of this marker in cancer. Elucidation of Lgr5 functions and the mechanism of its regulation may provide better understanding of colorectal tumorigenesis and may ultimately lead to the development of novel CSCs-based therapeutic strategies against CRC patients.
Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgements This study was supported by Project of Nature Science Foundation of China (81201905, 81301933), China Postdoctoral Science Foundation (2013M540374), Nature Science Research Grants in University of Jiangsu Province of China (12KJB320009), Shanghai Postdoctoral Scientific Program of China (13R21415200), Innovation Program of Shanghai Municipal Education Commission (12YZ050), Science and Technology Research Project of in Science and Technology Bureau of Suzhou City (SYS201220), and sponsored by Jiangsu Health International Exchange Program Sponsorship. References [1] Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin 2013;63(1):11–30. [2] Brenner H, Kloor M, Pox CP. Colorectal cancer. Lancet 2013;S01406736(13):61649–9. [3] Zhu X, Huang Z, Chen Y, Zhou J, Hu S, Zhi Q, et al. Effect of CLN3 silencing by RNA interference on the proliferation and apoptosis of human colorectal cancer cells. Biomed Pharmacother 2014. http://dx.doi.org/10.1016/j.biopha.2013.12.010 [pii:S0753-3322(14)00006-7, Epub ahead of print]. [4] Radtke F, Clevers H. Self-renewal and cancer of the gut: two sides of a coin. Science 2005;307(5717):1904–9. [5] Lobo NA, Shimono Y, Qian D, Clarke MF. The biology of cancer stem cells. Annu Rev Cell Dev Biol 2007;23:675–99. [6] Delude C, Tumorigenesis:. Testing ground for cancer stem cells. Nature 2011;480(7377):S43–5. [7] Cancer Genome Atlas Network. Comprehensive molecular characterization of human colon and rectal cancer. Nature 2012;487(7407):330–7. [8] He S, Yuan Y, Wang L, Yu M, Zhu Y, Zhu X. Effects of cyclin-dependent kinase 8 specific siRNA on the proliferation and apoptosis of colon cancer cells. J Exp Clin Cancer Res 2011;30(1):109. [9] van Es JH, van Gijn ME, Riccio O, van den Born M, Vooijs M, Begthel H, et al. Notch/gamma-secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature 2005;435(7044):959–63. [10] Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, Cozijnsen M, et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 2007;449(7165):1003–7. [11] Barker N, Ridgway RA, van Es JH, van de Wetering M, Begthel H, van den Born M, et al. Crypt stem cells as the cells-of-origin of intestinal cancer. Nature 2009;457(7229):608–11. [12] Vermeulen L, Todaro M, de Sousa Mello F, Sprick MR, Kemper K, Perez Alea M, et al. Single-cell cloning of colon cancer stem cells reveals a multi-lineage differentiation capacity. Proc Natl Acad Sci U S A 2008;105(36):13427–32. [13] Aoki D, Suzuki N, Susumu N, Noda T, Suzuki A, Tamada Y, et al. Establishment and characterization of the RMG-V cell line from human ovarian clear cell adenocarcinoma. Hum Cell 2005;18(3):143–6. [14] Uchida H, Yamazaki K, Fukuma M, Yamada T, Hayashida T, Hasegawa H, et al. Overexpression of leucine-rich repeat-containing G protein-coupled receptor 5 in colorectal cancer. Cancer Sci 2010;101(7):1731–7. [15] Tanese K, Fukuma M, Yamada T, Mori T, Yoshikawa T, Watanabe W, et al. Gprotein-coupled receptor GPR49 is up-regulated in basal cell carcinoma and promotes cell proliferation and tumor formation. Am J Pathol 2008;173(3):835–43. [16] Yui S, Nakamura T, Sato T, Nemoto Y, Mizutani T, Zheng X, et al. Functional engraftment of colon epithelium expanded in vitro from a single adult Lgr5+ stem cell. Nat Med 2012;18(4):618–23. [17] Liu PF, Wu YY, Hu Y, Wang L, He SB, Zhu YB, et al. Silencing of pancreatic adenocarcinoma upregulated factor by RNA interference inhibits the malignant phenotypes in human colorectal cancer cells. Oncol Rep 2013;30(1):213– 20. [18] He SB, Zhao H, Fei M, Wu YG, Wang L, Zhu XG, et al. Expression of co-signaling molecules CD40-CD40L and their growth inhibitory effect on pancreatic cancer in vitro. Oncol Rep 2012;28(1):262–8. [19] Kitamura H, Okudela K, Yazawa T, Sato H, Shimoyamada H. Cancer stem cell: implications in cancer biology and therapy with special reference to lung cancer. Lung Cancer 2009;66(3):275–81. [20] Van der Flier LG, Sabates-Bellver J, Oving I, Haegebarth A, De Palo M, Anti M, et al. The Intestinal Wnt/TCF signature. Gastroenterology 2007;132(2):628– 32. [21] Takahashi H, Ishii H, Nishida N, Takemasa I, Mizushima T, Ikeda M, et al. Significance of Lgr5(+ve) cancer stem cells in the colon and rectum. Ann Surg Oncol 2011;18(4):1166–74.
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
G Model
BIOPHA-3390; No. of Pages 7 S. He et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx [22] Takeda K, Kinoshita I, Shimizu Y, Matsuno Y, Shichinohe T, Dosaka-Akita H. Expression of LGR5, an intestinal stem cell marker, during each stage of colorectal tumorigenesis. Anticancer Res 2011;31(1):263–70. [23] Becker L, Huang Q, Mashimo H. Lgr5, an intestinal stem cell marker, is abnormally expressed in Barrett’s esophagus and esophageal adenocarcinoma. Dis Esophagus 2010;23(2):168–74. [24] Merlos-Sua´rez A, Barriga FM, Jung P, Iglesias M, Ce´spedes MV, Rossell D, et al. The intestinal stem cell signature identifies colorectal cancer stem cells and predicts disease relapse. Cell Stem Cell 2011;8(5):511–24. [25] Simon E, Petke D, Bo¨ger C, Behrens HM, Warneke V, Ebert M, et al. The spatial distribution of LGR5+ cells correlates with gastric cancer progression. PLoS One 2012;7(4):e35486. [26] Carmon KS, Lin Q, Gong X, Thomas A, Liu Q. LGR5 interacts and cointernalizes with Wnt receptors to modulate Wnt/b-catenin signaling. Mol Cell Biol 2012;32:2054–64. [27] Ruffner H, Sprunger J, Charlat O, Leighton-Davies J, Grosshans B, Salathe A, et al. R-Spondin potentiates Wnt/b-catenin signaling through orphan receptors LGR4 and LGR5. PLoS One 2012;7:e40976. [28] Walker F, Zhang HH, Odorizzi A, Burgess AW. LGR5 is a negative regulator of tumourigenicity, antagonizes Wnt signalling and regulates cell adhesion in colorectal cancer cell lines. PLoS One 2011;6:e22733.
7
[29] Garcia MI, Ghiani M, Lefort A, Libert F, Strollo S, Vassart G. LGR5 deficiency deregulates Wnt signaling and leads to precocious Paneth cell differentiation in the fetal intestine. Dev Biol 2009;331:58–67. [30] Roy S, Debnath J. Autophagy and tumorigenesis. Semin Immunopathol 2010;32(4):383–96. [31] Rausch V, Liu L, Apel A, Rettig T, Gladkich J, Labsch S, et al. Autophagy mediates survival of pancreatic tumour-initiating cells in a hypoxic microenvironment. J Pathol 2012;227(3):325–35. [32] Gu W, Wan DW, Qian QY, Yi B, Gu YL, He ZL, et al. Ambra1 is an essential regulator of autophagy and apoptosis in SW620 cells: pro-survival role of Ambra1. Plos One 2014;9(2):e90151. [33] Sun X, Jiao X, Pestell TG, Fan C, Qin S, Mirabelli E, et al. MicroRNAs and cancer stem cells: the sword and the shield. Oncogene 2013. http://dx.doi.org/ 10.1038/onc.2013.492 [Epub ahead of print]. [34] Bu P, Chen KY, Chen JH, Wang L, Walters J, Shin YJ, et al. A microRNA miR-34aregulated bimodal switch targets notch in colon cancer stem cells. Cell Stem Cell 2013;12(5):602–15. [35] Wan DW, He SB, Xie BH, Xu GH, Gu W, Shen CL, et al. Aberrant expression of miR-199a-3p and its clinical significance in colorectal cancers. Med Oncol 2013;30:378.
Please cite this article in press as: He S, et al. Expression of Lgr5, a marker of intestinal stem cells, in colorectal cancer and its clinicopathological significance. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.03.016
