Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part A journal homepage: www.elsevier.com/locate/cbpa
Expression of stress-related genes in the parthenogenetic forms of the pea aphid, Acyrthosiphon pisum Pavel Jedlička 1, Veronika Jedličková 1, How-Jing Lee ⁎ Department of Entomology, National Taiwan University, Taipei, Taiwan
a r t i c l e
i n f o
Article history: Received 6 August 2014 Received in revised form 24 October 2014 Accepted 11 November 2014 Available online 15 November 2014 Keywords: Acyrthosiphon pisum Aphid polyphenism Nutritional stress Metabolism Gene expression Adipokinetic hormone
a b s t r a c t Aphids are an economically important group of insects that have an intricate life cycle with seasonal polyphenism. This study aimed to explore the physiological background of aphid migration from unfavorable nutritional conditions to a new, intact host plant. Specifically, the relative expression of stress/metabolism-related genes and changes in metabolic reserves were determined for the winged and wingless forms of female pea aphids, Acyrthosiphon pisum, under two different nutritional conditions. The expression level was determined for the following sets of genes: the adipokinetic hormone (AKH) and its receptor, enzymes involved in carbohydrate and lipid metabolism, detoxifying enzymes, and genes encoding exoskeleton/cuticular proteins and cytoskeleton proteins. In both forms, the transcription of the adipokinetic hormone was upregulated during nutritional stress, whereas its receptor mRNA levels remained unchanged. Similarly, the expression of genes engaged in glycogen and triglyceride degradation was elevated. Glycogen reserves and phospholipids appeared to be used during stress. In comparison, nutrient rich reproductively active females of both forms appeared to use triglycerides. Moreover, we revealed changes in the mRNA level of the detoxifying genes delta-class glutathione S-transferase (GST-δ) and cytochrome P450 monooxygenase (CYP450), as well as the CP gene (which encodes exoskeleton/cuticular proteins) and the cofilin gene (the products of which influence cytoskeleton organization). These results indicate the possible correlation between nutritional stress, energy content, AKH, and the stressrelated enzymes of different metabolic pathways in winged and wingless forms of A. pisum. © 2014 Elsevier Inc. All rights reserved.
1. Introduction Aphids (Hemiptera: Aphidoidea) are phloem-feeding insects that are closely associated with a diverse range of plants. These insects have been subject to extensive scientific research because (1) they colonize agricultural plants, leading to considerable economic losses, and (2) they have a complex life cycle, exhibiting polyphenism (i.e., a single genotype induces two or more different phenotypes),including a natural ability to reproduce both asexually and sexually (Dixon, 1998). The ecological background for seasonal polyphenism in aphid colonies has been studied in detail. Therefore, the conditions that cause the switch from wingless exploiters to winged colonizers have been described in detail (Dixon, 1985; Braendle et al., 2006). In comparison, data on the physiological characteristics that reflect the environmental changes in different aphid forms remain limited. In general, winged virginoparas are evolutionary “designated” to guarantee the survival of respective aphid species under unfavorable conditions, because of their ability to fly and produce low numbers of offspring. In contrast, * Corresponding author. Tel./fax: +886 2 2363 6581. E-mail address: [email protected] (H.-J. Lee). 1 Present affiliation: Forestry and Wood Sciences, Czech University of Life Sciences Prague, Prague, Czech Republic.
http://dx.doi.org/10.1016/j.cbpa.2014.11.009 1095-6433/© 2014 Elsevier Inc. All rights reserved.
the enhanced reproductive output of wingless females is beneficial when conditions are favorable. The greater capability of winged aphids to cope with stress has also been documented by Jedlička et al. (2012) and Sláma and Jedlička (2012). The former study characterizes aphid adipokinetic hormone (AKH), while the latter study describes the respiratory metabolism of all asexual and sexual morphs of Acyrthosiphon pisum. The physiological status of winged females is subject to substantial changes. The production of winged aphids increases in certain aphid colonies when a complex of unfavorable conditions arises (e.g. high colony density, insufficient nutrients, and interspecific interactions; Braendle et al., 2006; Brisson, 2010). Freshly emerged winged adults must first endure the existing stress condition, then migrate, colonize a new, safe, and nourishing plant, and finally start to produce offspring (Dixon, 1998). This switch to reproduction is also accompanied by the irreversible proteolysis of the flight muscles, with both processes being controlled by the juvenile hormone (Kobayashi and Ishikawa, 1994). Therefore, the physiology of “stress readiness” in winged forms is expected to be substantially different before and after migration. To elucidate the physiological changes involved in colonization, we compared several characteristics in the two morphs (winged and wingless females) of the model aphid species, A. pisum. Both forms were exposed to different nutritional conditions (i.e., unfavorable versus
P. Jedlička et al. / Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37
favorable conditions) to simulate the natural environment before and after colonization. The metabolic reserves (i.e., water-soluble proteins, reducing and non-reducing free carbohydrates, glycogen, phospholipids, and triglycerides) and the relative expression of stress-related genes were recorded as physiological markers. A gene set was based on current knowledge about aphid stress readiness and resistance to diverse stressors and their possible hormonal control. Thus, we studied the genes encoding the following proteins: adipokinetic hormone and its respective receptor, AKH and AKHR; enzymes involved in the metabolism of carbohydrates (GYP, PKB-α, GYS, and diacetyl/L-xylulose reductase) and lipids (LSD1 and DDHD2); detoxification enzymes (GST-δ, CYP450, and COE); exoskeleton/cuticular proteins (CP and RR1-CP); and proteins linked to cytoskeleton organization and function (actin, cofilin, and tropomyosin). 2. Materials and methods 2.1. Experimental animals A stock of pea aphids (A. pisum) (collected in proximity to Taipei, Taiwan) was maintained in glass beakers (10 cm in diameter) on pea plants (Pisum sativum) in a watered granule-like substrate. The plants were grown in a chamber with a 16-hour photoperiod (long day, LD) at 18 °C. Winged morphs under LD conditions were produced from wingless females maintained under high-density conditions. 2.2. Nutritional stress experiment For the nutritional stress experiments, the stressed pea plants were prepared in advance. Plants older than 3 weeks were infested by aphids for 2 weeks, and then the aphids were removed with a fine brush before the main experiment. These plants were then infested again by a group of 90 freshly emerged wingless females (1–2 days old), of which 45 individuals were collected 3 days later and separated into 9 biological replicates (5 individuals per replicate). These individuals were then weighed, frozen in liquid nitrogen, and stored at −80 °C until further use. The remaining aphids were transferred to young and intact pea plants without crowded conditions, and were left for 7 days. These females were then processed in the same way as the previously described group. The group of winged females was handled in the same way. Thus, after 3 days under stress conditions, all winged aphids were ready to migrate, and were collected from the underside of a net covering the glass beakers. Half of the individuals were immediately processed, while the other half were transferred to fresh plants and left for 7 days before processing. 2.3. Quantification of proteins, free carbohydrates, glycogen, phospholipids, and triglycerides Six biological replicates (5 females per each replicate) of each polyphenic form were collected under specific nutritional conditions (see Section 2.2) and subjected to determination of metabolic reserve. The modified method of the consecutive analyses of each sample was employed (Foray et al., 2012). In brief, all samples were homogenized in 160 μl of 50 mM potassium phosphate buffer (pH 7.0), and centrifuged at 12,000 ×g for 10 min. First, 10 μl supernatant was used to determine the amount of protein by using the standard Bradford reagent assay (Quick Start™ Bradford, Bio-Rad). In the second step, 1150 μl chloroform–methanol mixture (1:1; v/v) was added to the rest of the solution and then vortexed and centrifuged at 1600 ×g for 1 min. The supernatants were transferred to new microcentrifuge tubes (2 ml) and the pellets were stored for the later determination of glycogen. Subsequently, 650 μl double-distilled water was added to the supernatant, vortexed, and centrifuged at 1600 ×g for 1 min again. The aqueous phase that formed was removed and evaporated for the later determination of total free carbohydrates and reducing sugars. Chloroform solvent was added to the remaining organic phase, to make the mixture up
33
to 2 ml, and was mixed vigorously. In the next step, half of the solution was transferred to a separate tube with 100 mg of silicic acid (Sila 200™), gently mixed, and subsequently centrifuged at 180 ×g for 10 min. The 800 μl upper phase was transferred to new microcentrifuge tubes. Both the treated and untreated parts with silicic acid were evaporated and the relative amount of lipids was determined using the sulfophosphovanilin test (Kodrík et al., 2002). The step employing silicic acid was included to bind polar lipids (i.e., monoglycerides, diglycerides, and free fatty acids; designated as phospholipids in the text), from which we determined the relative amount of triglycerides (Foray et al., 2012). The amount of phospholipids was calculated by subtracting the amount of triglycerides from total lipids. Total free carbohydrate (TFC) content was measured using the phenol-sulfuric acid reagent according to Dubois et al. (1956). The amount of reducing sugars was measured using the dinitrosalicylic reagent assay (Miller, 1959). The amount of non-reducing sugars was calculated by subtracting the reducing sugars from TFC. Glycogen content was measured by colorimetric determination using phenol and concentrated sulfuric acid (Dubois et al., 1956) after extracting glycogen in hot alkali (Bueding and Orrell, 1964). All the characteristics were normalized per mg fresh body weight of studied aphids. 2.4. Nucleic acid isolation Total RNA was extracted from the whole bodies of females using TRIzol reagent (Ambion) following the manufacturer's protocol. RNA isolates were treated with RQ1 RNase-Free DNase (Promega) to remove traces of contaminant DNA. 2.5. Quantitative reverse-transcription PCR (q-RT-PCR) The cDNA template was prepared using the High Capacity cDNA Reverse Transcription Kit (ABI) on 1 μg of the corresponding total RNA with random hexamers. q-RT-PCR was performed using the Applied Biosystems StepOnePlus real-time PCR systems with Fast SYBR Green Master Mix (Applied Biosystems). The concentration of each primer was 200 nM. The PCR program was programmed as follows: initial denaturation for 3 min at 95 °C, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. A final melting-curve step was included post-PCR (rising from 60 °C to 95 °C at 0.3 °C intervals) to confirm the absence of any non-specific amplification. The efficiency of each primer pair was assessed by constructing a standard curve through 5 serial dilutions. Each q-RT-PCR experiment consisted of 3 independent biological replicates (5 females per replicate, see Section 2.2), with 3 technical replicates for each parallel group. The abbreviations and descriptions of the target genes, along with their respective primer sequences, are listed in Table 1. The suitability of reference genes (GAPDH, RPL7, and RPL27) was evaluated using mathematical methods implemented in NormFinder (Andersen et al., 2004). Subsequently, RPL27 was determined to be the most reliable control gene, and was used in the subsequent analyses. Changes in the relative gene expression of stressed versus unstressed females are expressed as the fold ratio using the 2−ΔΔCt method (Livak and Schmittgen, 2001). 2.6. Data presentation and statistical analysis The obtained results were plotted using the Prism graphic program (GraphPad Software, version 5.0, San Diego, CA, USA). 3. Results and discussion 3.1. Stress-related changes in the expression of A. pisum adipokinetic hormone and its respective receptor Nutritional stress and migration are connected with enhanced energy consumption mediated by a group of specific neurohormones;
34
P. Jedlička et al. / Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37
Table 1 List of primer sequences used for q-RT-PCR analysis. Target gene abbr. used
Gene accession number
Definition
Forward primer
Reverse primer
AKH AKHR
JQ086350 XM_001945401.2
TGTTGTTGGCCGTGTTCATGTTG GGTGCTCGGTGATCCACTAT
AGTGGCTGTTCAATTCGTGACG ACCATGTGGCATTAGGGTGT
GYP PKB-α
XM_001950725 XM_001948393
TGGTTGGTCGTTCCCTTCAG CCAGATCATTCATGCTTGATG
CCAAACCTGAGCCAATCGTC AAAATACCATCCAATTCTGCTTCA
GYS Diacetyl/L-xylulose reductase LSD1
XM_001950166.2 NM_001126169.2
AKH preprohormone Gonadotropin-releasing hormone II receptor-like Glycogen phosphorylase-like Probable phosphorylase b kinase regulatory subunit alpha-like Putative glycogen [starch] synthase-like Diacetyl/L-xylulose reductase
CGTGGAAAGTCTCCGTGGTC CGCTGTTGGACGTGACGCAAAG
CGGTGGCAAGTCGTCTCTCT AAGCCGTGGACAGGTCCCAATT
GTATTGAGCGTCGTAGACATG
CACGGAGTCTGCACGTTTTA
DDHD2
XM_001950259.2
CGTGGAATACTGTTTATCAGTTGG
TGGTGCCTCTTGTAAAACACAATC
GST-δ CYP450 COE CP RR1-CP Actin Cofilin Tropomyosin GAPDH
NM_001162802 NM_001163211 XM_001945501.2 NM_001134286.1 NM_001172261.1 NM_001142636.1 NM_001126170.2 XM_001947785.2 XM_001943014.2
CCCAAAAGACCCGAAGAAGC AATGCGACCTAATGGCGT CGAATGTAACATGGAATGCGGAAC CTCCCGTAGCAGCACCCATCTA CCGAAAACGCCGCCCAAGTGAT GCCGCAGTCGTACAGATTTCCT CGGCAGACGTCGGGCGTTTTAT GTCCCTTAGCTGGTAACTAAAATTGGCT CTGTTGTTGACTTGACTGTAAGACTT
AGCCCAAGTGGAAGATCCCA TTCGGAATCACTACCACGGATAA TCAGCGTGACATGCACCTTT TCGTGTCCGTATGCTGCTGGTT AACCGGTCTCGTCGGCGTAGTA TCCCATACCGACCATGACTCCTT CGGAACGGGACGCGGGTTTTTA CTGCGTGTAATAATCAAGTACCTACTGCAT TCAATGAAATTCCCGCCTTAGC
RPL7 RPL27
NM_001135898.1 NM_001126221.2
Lipid storage droplets surface-binding protein 1-like Phospholipase DDHD2-like (LOC100165519), mRNA Glutathione S-transferase Cytochrome P450 protein Esterase FE4-like Cuticular protein RR1 cuticle protein 8 (cprr1-8) Actin Twinstar (Tsr) Tropomyosin-2-like Glyceraldehyde-3-phosphate dehydrogenase-like Ribosomal protein L7 (Rpl7) Ribosomal protein L27 (Rpl27)
ATGCGTATTCGTGGTGTGAACC GCTGTCATAATGAAGACCTACGATGA
TGTAGACCAGTTCCCTTACGCT GGTGAAACCTTGTCTACTGTTACATCT
XM_001949727.2
namely, adipokinetic hormones (AKHs) (Kodrík, 2008; Gäde, 2009; Bednářová et al., 2013). AKHs are synthesized, stored, and released by neurosecretory cells from the paired endocrine glands corpora cardiaca (CC), which are connected to the insect brain (Kodrík, 2008). While the nucleotide and protein sequences of AKH and its respective receptor (AKHR) are known for many insect species (Gäde, 2009; Huang et al., 2012), few studies have described the quantitative expression of AKH and its receptor to date (Huang et al., 2012; Jedlička et al., 2012). Table 2 presents the changes in gene expression related to nutritional stress under the experimental conditions, in addition to providing the respective statistical significance. In brief, we recorded 2.13 times higher AKH expression in winged females under nutritional stress than in their unstressed conspecifics. Similarly, the expression of the AKH gene was 2.14 times higher in stressed wingless aphids than that of the unstressed females (Table 2). This demonstration of markedly enhanced AKH transcription levels in both female forms of A. pisum under nutritional stress conditions supplements previous reports that showed an increased titer of bioactive AKH peptide in both the CC and hemolymph after stress induced by toxins and herbicides in certain model insect species (reviewed by Kodrík, 2008). In addition, we compared the expression levels of the studied genes between both polyphenic forms (Table 2). The expression of AKH gene was significantly higher in winged females, i.e., 1.86 and 1.88 times higher under the stress and unstressed conditions, respectively. Thus, we confirmed previous findings that the highest AKH transcription level is related to the winged parthenogenetic female, possibly because of the high energetic demands of this polyphenic form (Jedlička et al., 2012). In contrast, the expression of the corresponding AKH receptor, AKHR, remained stable in both treatments, with no significant difference being found when we compared winged with wingless females (Table 2). Although Huang et al. (2012) reported that the AKHR transcription level declines during the oxidative stress of fat body tissues in Blattella germanica, the response of the AKH ligand-receptor system to nutritional stress in the whole body of A. pisum was limited to just the regulation of the ligand. 3.2. Stress-related changes in the metabolism of energetic reserves of A. pisum AKHs trigger catabolic reactions that provide energy from the insect fat body (Gäde, 2009). Therefore, we aimed to obtain detailed information
about the changes in energy storage by the two forms of A. pisum (Fig. 1), in addition to recording the expression of genes encoding enzymes engaged in the respective biochemical pathways (i.e., metabolism of carbohydrates—GYP, PKB-α, GYS and diacetyl/L-xylulose reductase, and lipids— LSD1 and DDHD2; Table 2). All collected winged and wingless aphids began reproducing when transferred to intact pea plants, with their Table 2 Statistical analysis of gene expression in A. pisum females subjected to nutritional stress. The ratio values that are significantly higher and lower than “1” represent the up- and down-regulation of the relevant gene in the studied group of aphids, respectively. The first two columns represent the fold change in the relative expression levels of stressed females (winged = WD and wingless = WL) compared to unstressed females. The second set of columns shows the gene expression in winged females compared to wingless aphids before and after being subjected to the respective treatments (stressed and unstressed females). Bold-type values represent significant differences between respective conditions or female forms (two tailed t-test; *, **, and *** correspond to p b 0.05, 0.01, and 0.001, respectively). The values represent the mean ± SE (n = 3). The horizontal solid lines separate the studied genes into the functional groups of the proteins that they encode: adipokinetic hormone and its respective receptor, AKH and AKHR; enzymes involved in the metabolism of carbohydrates (GYP, PKB-α, GYS, and diacetyl/L-xylulose reductase) and lipids (LSD1 and DDHD2); detoxification enzymes (GST-δ, CYP450, and COE) and exoskeleton/cuticular proteins (CP and RR1-CP); and proteins linked to cytoskeleton organization and function (actin, cofilin, and tropomyosin). See Table 1, for the list of abbreviations for the genes. Gene
AKH AKHR GYP PKB-α GYS Diacetyl/L-xylulose reductase LSD1 DDHD2 GST-δ CYP450 COE CP RR1-CP Actin Cofilin Tropomyosin
Stressed/unstressed
WD/WL
WD
WL
Stressed
Unstressed
2.13** 0.83 3.97*** 0.72 2.08 0.71 2.11* 2.77* 1.15 0.83 1.05 0.03*** 0.49 1.28 0.66* 1.06
2.14** 0.91 1.04 1.03 1.52 0.65* 2.23* 6.24** 0.72** 1.36** 1.31 0.49* 1.29 1.16 0.51** 1.17
1.86** 0.75 3.10*** 0.95 1.35 0.38** 0.72* 0.70 1.53 0.41*** 0.91 0.10** 0.28** 1.56 1.46** 1.41
1.88** 0.81 0.83 1.22 0.97 0.38* 0.76* 1.34 0.99 0.70* 1.13 1.69* 0.78 1.36 1.11 1.88
P. Jedlička et al. / Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37
fresh body weights increasing to a similar degree (i.e., by 2.2 and 2.1 times in winged and wingless females, respectively; Fig. 1A). The overall free protein content was found 1.2 times higher in stressed wingless females than that of the unstressed aphids (Fig. 1B), because of the insufficient supply of water from the old host plants, which consequently lowered the fresh body weight of the tested aphids (Fig. 1A). Among carbohydrates, glycogen reserves appeared to be used for the survival of A. pisum females subjected to nutritional stress conditions. This hypothesis is supported by noticeably reduced levels of glycogen in nutritionally stressed A. pisum females (4.3 times and 5.1 times lower in winged and wingless females, respectively; Fig. 1C) compared to their nutrient-rich conspecifics (i.e., transferred to fresh pea plants). In addition, the expression of the enzyme responsible for glycogen degradation, i.e., glycogen phosphorylase (GYP), was substantially up-regulated in winged starving females (fold change of 3.97; Table 2). The activity of this enzyme is triggered by the AKH bioactive peptide (Gäde, 2009), which supports our finding of elevated mRNA levels of both genes during nutritional stress. Interestingly, phosphorylase kinase B (PKB-α; an activator of the GYP) and glycogen synthase (GYS; with the opposite function to GYP) expression levels were unchanged after aphid transfer (Table 2). As documented for glycogen, the amount of reducing sugars was remarkably enhanced once the aphids were supplied with phloem sap rich in monosaccharides (3.2 and 2.2 times in winged and wingless females, respectively; Fig. 1D). The metabolism of simple carbohydrates was also supported by significantly increased transcription levels of diacetyl/L-xylulose reductase in well-fed wingless females (Table 2). This enzyme is functionally
35
involved in the uronate cycle of glucose metabolism, with its molecular metabolism being well described in the kidney tissues of some mammalian model species (Nakagawa et al., 2002). The aphid ortholog of this enzyme was also studied in the potato aphid Macrosiphum euphorbiae, with the study showing that different types of abiotic stress influence the expression of this gene (Nguyen et al., 2009). In contrast, the levels of non-reducing di- and oligosaccharides were not influenced by the nutritional stress (Fig. 1E). It has been well documented that oligosaccharides are produced to balance osmotic pressure between the body fluids of aphids and their diet of plant phloem sap (Karley et al., 2005). Thus, the preservation of similar amounts of non-reducing sugars per fresh body weight unit under conditions of nutrient paucity is necessary for aphid survival. After the females of both forms were transferred to nutrient-rich conditions, triglyceride content significantly declined (1.6 and 1.5 times in winged and wingless females, respectively; Fig. 1F). Because all aphids were transferred manually, we may exclude the influence of migratory flight on triglyceride level, as this process was described in long-term flying insects (summarized in Arrese and Soulages, 2010). Thus, this finding supports the general concept that lipids from the fat body are transported to the ovaries and subsequently accumulate in maturating oocytes. They provide energy deposits for processes connected with embryo development (Arrese and Soulages, 2010). Moreover, the amount of free lipid form, phospholipids, increased under nutrient rich conditions in winged females (Fig. 1G), which corresponds to the mobilization of lipids from triglycerides in the fat body and their subsequent transport to the ovaries. To document lipid
Fig. 1. Changes to the metabolic reserves of the winged and wingless females of A. pisum after exposure to nutritional stress conditions. Data were measured in stressed (black bars) and unstressed (gray bars) females of each respective form (winged = WD or wingless = WL). The bars represent the mean ± SD (n = 6). A = fresh body weight (FBW); B = free soluble proteins; C = glycogen content; D = reducing sugars; E = non-reducing sugars; F = triglycerides; G = phospholipids (two tailed t-test; *, **, and *** correspond to p b 0.05, 0.01, and 0.001, respectively).
36
P. Jedlička et al. / Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37
degradation, the expression level of the lipid storage droplet phosphoprotein, LSD1, was recorded (Table 2). Patel et al. (2005) demonstrated that the AKH-mediated activation of LSD1 proteins in lipid droplets accelerates the lipolysis of triglycerides by specific lipases in the insect fat body. In other words, the amount of activated LSD1 protein is positively correlated with the concentration of the AKH neuropeptide in insect hemolymph. Our results support this finding, showing elevated transcription levels of LSD1 under stress conditions (fold change of 2.11 and 2.23 in winged and wingless females, respectively; Table 2) and its hormonal activator AKH during nutritional stress in A. pisum parthenogenetic females (Table 2). In addition, the same expressional pattern was recorded in another studied gene involved in lipolysis, phospholipase DDHD2 (fold change of 2.77 and 6.24 in stressed winged and wingless females, respectively; Table 2). Although lipolytic genes were up-regulated in stressed aphids, the triglyceride level was also noticeably higher than that recorded in well-fed females (Fig. 1F). We speculate that free phospholipids are utilized to fulfill the energetic demands of A. pisum females subjected to insufficient nutritional conditions. However, the massive depletion of triglyceride stores only occurs when aphids reproduce in nutrient-rich environments, with mobilized lipids being immediately used for embryo development (Fig. 1F and G). 3.3. Stress-related changes in the expression of A. pisum detoxification and exoskeleton genes We also analyzed genes that are functionally involved in the aphid response to noxious chemicals. Genes encoding detoxification enzymes and exoskeleton proteins were selected based on micro-arrays studies of aphid strains resistant to pesticides (Puinean et al., 2010; Silva et al., 2012). The delta class is the largest cytosolic subgroup of glutathione S-transferases (GSTs), and has been studied in many model insect species (Zhou et al., 2012). The majority of GST-δ members are engaged in the insect metabolism of xenobiotics (Hemingway et al., 2004). The up-regulation of GST-δ expression in A. pisum wingless females on fresh pea plants (Table 2) may be caused by the need to detoxify secondary metabolites, e.g., lectins (Rahbé et al., 1995), that are present in the phloem sap of young plants (Francis et al., 2005). The production of defensive compounds is a general response of an originally intact plant to herbivorous feeding (Giordanengo et al., 2010). In contrast, nutritional stress elicits 1.36 times higher expression of cytochrome P450 monooxygenase 6 in wingless aphids (Table 2). Moreover, we detected markedly lower transcription levels of CYP450 in winged females compared to their wingless conspecifics on both original and new fresh plants (fold change of 0.41 and 0.70, respectively; Table 2). One member of the carboxylesterase FE4 family, COE, was expressed at a similar level in aphids subjected to both treatments (Table 2). In contrast to the set of enzymes involved in metabolic pathways (Section 3.2), we did not observe any similar tendency between elevated mRNA levels of AKH and detoxifying enzymes during nutritional stress. The representative exoskeleton genes studied here (cuticular proteins CP and RR1-CP) are just two members of the dozens of different structural proteins found in the insect cuticle (Klarskov et al., 1989). While the gene expression of RR1-CP did not show any significant changes in stressed individuals, the expression of CP was downregulated in both forms of A. pisum females subjected to nutritional stress conditions (fold change of 0.03 and 0.49 in winged and wingless females, respectively; Table 2). Therefore, we speculate that the structural protein CP might be an important cuticle component for developing embryos in the parthenogenetic ovaries of reproducing females of A. pisum. 3.4. Stress-related changes in the expression of A. pisum cytoskeleton genes To determine the expected changes accompanying flight muscle breakdown in winged females after the colonization of new plants (Kobayashi and Ishikawa, 1994), we studied the expression of genes
involved in cytoskeleton organization and function. Even though we did not observe any changes in actin and tropomyosin expression after simulated migration (Table 2), the transcription levels of cofilin were significantly higher in starving winged females compared to wingless females (1.46 times; Table 2). Since cofilin is a member of the actindepolymerizing factor family (Chen et al., 2000), this finding may indicate that there is an increase in the turnover of actin filaments in this aphid form before migration flight. Furthermore, supporting the study by Nguyen et al. (2009) on M. euphorbiae, we recorded the downregulated expression of cofilin in both A. pisum forms under the stress condition (fold change of 0.66 and 0.51 in winged and wingless females, respectively; Table 2). This finding supports the role of cofilin in the molecular response of aphids exposed to both nutritional and abiotic stressors (Nguyen et al., 2009), with this protein being connected to the known stress-related mechanism of cell protection from apoptosis described by Chua et al. (2003). The absence of significant differences in actin expression in winged females (Table 2) does not correspond to the data describing the effects of starvation on overall protein content in the indirect flight muscle (IFM) of winged females of A. pisum (Kobayashi and Ishikawa, 1993). They recorded stabilized protein levels in the IFM of starving aphids during five consecutive days after final ecdysis. The amount of proteins dropped when the aphids were supplied food again, and their fresh body weight increased. In contrast to this preceding work, we extracted mRNA from the whole bodies of A. pisum females. Therefore, actin transcript levels were recorded in the tissues of reproducing females, as well as in the tissues of embryos and first instar offspring in the ovaries. This study demonstrated that the expression of the stress hormone, AKH, is markedly up-regulated in parthenogenetic A. pisum females during nutritional stress under experimental conditions. In parallel, the mRNA abundance of genes responsible for glycogen and lipid degradation is also significantly enhanced, with the energy content of reducing sugars, glycogen, and phospholipids being utilized for survival. In contrast, the onset of reproduction after the colonization of a nutrientrich plant is accompanied by using triglyceride stores. Among genes related to insecticide resistance, only CYP450 expression was up-regulated in stressed wingless females, while the transcription levels of the enzyme GST-δ (wingless form only) and the exoskeleton protein CP (both female forms) increased in reproducing A. pisum females after transfer to fresh plants. Furthermore, nutritional stress defense in aphids appears to be related to the reduced expression level of the gene encoding a protein involved in cytoskeleton organization, cofilin. In conclusion, we present the first data revealing the hormonal and metabolic background of nutritional stress-related changes in winged and wingless polyphenic forms of A. pisum.
Acknowledgments This study was financially supported by grants from Ministry of Science and Technology of Taiwan (98-2321-B-002-017-MY3 to How-Jing Lee) and Ministry of Education of Taiwan (10R40044 and 102R4000 to Pavel Jedlička).
References Andersen, C.L., Jensen, J.L., Ørntoft, T.F., 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, 5245–5250. Arrese, E.L., Soulages, J.L., 2010. Insect fat body: energy, metabolism, and regulation. Annu. Rev. Entomol. 55, 207–225. Bednářová, A., Kodrík, D., Krishnan, N., 2013. Unique roles of glucagon and glucagon-like peptides: parallels in understanding the functions of adipokinetic hormones in stress responses in insects. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 164 (1), 91–100. Braendle, C., Davis, G.K., Brisson, J.A., Stern, D.L., 2006. Wing dimorphism in aphids. Heredity 97, 192–199. Brisson, J.A., 2010. Aphid wing dimorphisms: linking environmental and genetic control of trait variation. Philos. Trans. R. Soc. Lond. B Biol. Sci. 365, 605–616.
P. Jedlička et al. / Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37 Bueding, E., Orrell, S.A., 1964. A mild procedure for the isolation of polydisperse glycogen from animal tissues. J. Biol. Chem. 239, 4018–4020. Chen, H., Bernstein, B.W., Bamburg, J.R., 2000. Regulating actin-filament dynamics in vivo. Trends Biochem. Sci. 25 (1), 19–23. Chua, B.T., Volbracht, C., Tan, K.O., Li, R., Victor, C.Y., Peng, L., 2003. Mitochondrial translocation of cofilin is an early step in apoptosis induction. Nat. Cell Biol. 5, 1083–1089. Dixon, A.F.G., 1985. Structure of aphid populations. Annu. Rev. Entomol. 30, 155–174. Dixon, A.F.G., 1998. Aphid Ecology: An Optimization Approach, second ed. Chapman and Hall, London. Dubois, M., Gilles, A., Hamilton, J.K., Rebers, P.A., Smith, F., 1956. Colorimetric method for determination of sugars and related substances. Anal. Chem. 28, 350–355. Foray, V., Pelisson, P.F., Bel-Venner, M.C., Desouhant, E., Venner, S., Menu, F., Giron, D., Rey, B., 2012. A handbook for uncovering the complete energetic budget in insects: the van Handel's method (1985) revisited. Physiol. Entomol. 37, 295–302. Francis, F., Vanhaelen, N., Haubruge, E., 2005. Glutathione S-transferases in the adaptation to plant secondary metabolites in the Myzus persicae aphid. Arch. Insect Biochem. Physiol. 58 (3), 166–174. Gäde, G., 2009. Peptides of the adipokinetic hormone/red pigment-concentrating hormone family: a new take on biodiversity. Ann. N. Y. Acad. Sci. 1163, 125–136. Giordanengo, P., Brunissen, L., Rusterucci, C., Vincent, C., van Bel, A., Dinant, S., Girousse, C., Faucher, M., Bonnemain, J.L., 2010. Compatible plant-aphid interactions: how aphids manipulate plant responses. C. R. Biol. 333 (6-7), 516–523. Hemingway, J., Hawkes, N.J., McCarroll, L., Ranson, H., 2004. The molecular basis of insecticide resistance in mosquitoes. Insect Biochem. Mol. Biol. 34 (7), 653–665. Huang, J.H., Bellés, X., Lee, H.J., 2012. Functional characterization of hypertrehalosemic hormone receptor in relation to hemolymph trehalose and to oxidative stress in the cockroach Blattella germanica. Front. Endocrinol. (Lausanne) 2, 114. Jedlička, P., Steinbauerová, V., Šimek, P., Zahradníčková, H., 2012. Functional characterization of the adipokinetic hormone in the pea aphid, Acyrthosiphon pisum. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 162 (1), 51–58. Karley, A.J., Ashford, D.A., Minto, L.M., Pritchard, J., Douglas, A.E., 2005. The significance of gut sucrase activity for osmoregulation in the pea aphid, Acyrthosiphon pisum. J. Insect Physiol. 51 (12), 1313–1319. Klarskov, K., Højrup, P., Andersen, S.O., Roepstorff, P., 1989. Plasma-desorption mass spectrometry as an aid in protein sequence determination. Application of the method on a cuticular protein from the migratory locust (Locusta migratoria). Biochem. J. 262 (3), 923–930. Kobayashi, M., Ishikawa, H., 1993. Breakdown of indirect flight muscles of alate aphids (Acyrthosiphon pisum) in relation to their flight, feeding and reproductive behavior. J. Insect Physiol. 39 (7), 549–554.
37
Kobayashi, M., Ishikawa, H., 1994. Involvement of juvenile hormone and ubiquitindependent proteolysis in flight muscle breakdown of alate aphid (Acyrthosiphon pisum). J. Insect Physiol. 40 (2), 107–111. Kodrík, D., 2008. Adipokinetic hormone functions that are not associated with insect flight. Physiol. Entomol. 33, 171–180. Kodrík, D., Socha, R., Zemek, R., 2002. Topical application of Pya-AKH stimulates lipid mobilization and locomotion in the flightless bug, Pyrrhocoris apterus (L.) (Heteroptera). Physiol. Entomol. 27, 15–20. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(− Delta Delta C(T)) Method. Methods 25 (4), 402–408. Miller, G.L., 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31, 426–428. Nakagawa, J., Ishikura, S., Asami, J., Isaji, T., Usami, N., Hara, A., Sakurai, T., Tsuritani, K., Oda, K., Takahashi, M., Yoshimoto, M., Otsuka, N., Kitamura, K.J., 2002. Molecular characterization of mammalian dicarbonyl/L-xylulose reductase and its localization in kidney. Biol. Chem. 277 (20), 17883–17891. Nguyen, T.T., Michaud, D., Cloutier, C., 2009. A proteomic analysis of the aphid Macrosiphum euphorbiae under heat and radiation stress. Insect Biochem. Mol. Biol. 39 (1), 20–30. Patel, R.T., Soulages, J.L., Hariharasundaram, B., Arrese, E.L., 2005. Activation of the lipid droplet controls the rate of lipolysis of triglycerides in the insect fat body. J. Biol. Chem. 280 (24), 22624–22631. Puinean, A.M., Foster, S.P., Oliphant, L., Denholm, I., Field, L.M., Millar, N.S., Williamson, M.S., Bass, C., 2010. Amplification of a cytochrome P450 gene is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae. PLoS Genet. 6 (6), e1000999. Rahbé, Y., Sauvion, N., Febvay, G., Peumans, W.J., Gatehouse, A.M.R., 1995. Toxicity of lectins and processing of ingested proteins in the pea aphid Acyrthosiphon pisum. Entomol. Exp. Appl. 76 (2), 143–155. Silva, A.X., Jander, G., Samaniego, H., Ramsey, J.S., Figueroa, C.C., 2012. Insecticide resistance mechanisms in the green peach aphid Myzus persicae (Hemiptera: Aphididae) I: A transcriptomic survey. PLoS One 7 (6), e36366. Sláma, K., Jedlička, P., 2012. Respiratory metabolism of the pea aphid, Acyrthosiphon pisum (Hemipetra: Aphididae). Eur. J. Entomol. 109, 491–502. Zhou, W.W., Li, X.W., Quan, Y.H., Cheng, J., Zhang, C.X., Gurr, G., Zhu, Z.R., 2012. Identification and expression profiles of nine glutathione S-transferase genes from the important rice phloem sap-sucker and virus vector Laodelphax striatellus (Fallén) (Hemiptera: Delphacidae). Pest Manag. Sci. 68 (9), 1296–1305.
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part A journal homepage: www.elsevier.com/locate/cbpa
Expression of stress-related genes in the parthenogenetic forms of the pea aphid, Acyrthosiphon pisum Pavel Jedlička 1, Veronika Jedličková 1, How-Jing Lee ⁎ Department of Entomology, National Taiwan University, Taipei, Taiwan
a r t i c l e
i n f o
Article history: Received 6 August 2014 Received in revised form 24 October 2014 Accepted 11 November 2014 Available online 15 November 2014 Keywords: Acyrthosiphon pisum Aphid polyphenism Nutritional stress Metabolism Gene expression Adipokinetic hormone
a b s t r a c t Aphids are an economically important group of insects that have an intricate life cycle with seasonal polyphenism. This study aimed to explore the physiological background of aphid migration from unfavorable nutritional conditions to a new, intact host plant. Specifically, the relative expression of stress/metabolism-related genes and changes in metabolic reserves were determined for the winged and wingless forms of female pea aphids, Acyrthosiphon pisum, under two different nutritional conditions. The expression level was determined for the following sets of genes: the adipokinetic hormone (AKH) and its receptor, enzymes involved in carbohydrate and lipid metabolism, detoxifying enzymes, and genes encoding exoskeleton/cuticular proteins and cytoskeleton proteins. In both forms, the transcription of the adipokinetic hormone was upregulated during nutritional stress, whereas its receptor mRNA levels remained unchanged. Similarly, the expression of genes engaged in glycogen and triglyceride degradation was elevated. Glycogen reserves and phospholipids appeared to be used during stress. In comparison, nutrient rich reproductively active females of both forms appeared to use triglycerides. Moreover, we revealed changes in the mRNA level of the detoxifying genes delta-class glutathione S-transferase (GST-δ) and cytochrome P450 monooxygenase (CYP450), as well as the CP gene (which encodes exoskeleton/cuticular proteins) and the cofilin gene (the products of which influence cytoskeleton organization). These results indicate the possible correlation between nutritional stress, energy content, AKH, and the stressrelated enzymes of different metabolic pathways in winged and wingless forms of A. pisum. © 2014 Elsevier Inc. All rights reserved.
1. Introduction Aphids (Hemiptera: Aphidoidea) are phloem-feeding insects that are closely associated with a diverse range of plants. These insects have been subject to extensive scientific research because (1) they colonize agricultural plants, leading to considerable economic losses, and (2) they have a complex life cycle, exhibiting polyphenism (i.e., a single genotype induces two or more different phenotypes),including a natural ability to reproduce both asexually and sexually (Dixon, 1998). The ecological background for seasonal polyphenism in aphid colonies has been studied in detail. Therefore, the conditions that cause the switch from wingless exploiters to winged colonizers have been described in detail (Dixon, 1985; Braendle et al., 2006). In comparison, data on the physiological characteristics that reflect the environmental changes in different aphid forms remain limited. In general, winged virginoparas are evolutionary “designated” to guarantee the survival of respective aphid species under unfavorable conditions, because of their ability to fly and produce low numbers of offspring. In contrast, * Corresponding author. Tel./fax: +886 2 2363 6581. E-mail address: [email protected] (H.-J. Lee). 1 Present affiliation: Forestry and Wood Sciences, Czech University of Life Sciences Prague, Prague, Czech Republic.
http://dx.doi.org/10.1016/j.cbpa.2014.11.009 1095-6433/© 2014 Elsevier Inc. All rights reserved.
the enhanced reproductive output of wingless females is beneficial when conditions are favorable. The greater capability of winged aphids to cope with stress has also been documented by Jedlička et al. (2012) and Sláma and Jedlička (2012). The former study characterizes aphid adipokinetic hormone (AKH), while the latter study describes the respiratory metabolism of all asexual and sexual morphs of Acyrthosiphon pisum. The physiological status of winged females is subject to substantial changes. The production of winged aphids increases in certain aphid colonies when a complex of unfavorable conditions arises (e.g. high colony density, insufficient nutrients, and interspecific interactions; Braendle et al., 2006; Brisson, 2010). Freshly emerged winged adults must first endure the existing stress condition, then migrate, colonize a new, safe, and nourishing plant, and finally start to produce offspring (Dixon, 1998). This switch to reproduction is also accompanied by the irreversible proteolysis of the flight muscles, with both processes being controlled by the juvenile hormone (Kobayashi and Ishikawa, 1994). Therefore, the physiology of “stress readiness” in winged forms is expected to be substantially different before and after migration. To elucidate the physiological changes involved in colonization, we compared several characteristics in the two morphs (winged and wingless females) of the model aphid species, A. pisum. Both forms were exposed to different nutritional conditions (i.e., unfavorable versus
P. Jedlička et al. / Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37
favorable conditions) to simulate the natural environment before and after colonization. The metabolic reserves (i.e., water-soluble proteins, reducing and non-reducing free carbohydrates, glycogen, phospholipids, and triglycerides) and the relative expression of stress-related genes were recorded as physiological markers. A gene set was based on current knowledge about aphid stress readiness and resistance to diverse stressors and their possible hormonal control. Thus, we studied the genes encoding the following proteins: adipokinetic hormone and its respective receptor, AKH and AKHR; enzymes involved in the metabolism of carbohydrates (GYP, PKB-α, GYS, and diacetyl/L-xylulose reductase) and lipids (LSD1 and DDHD2); detoxification enzymes (GST-δ, CYP450, and COE); exoskeleton/cuticular proteins (CP and RR1-CP); and proteins linked to cytoskeleton organization and function (actin, cofilin, and tropomyosin). 2. Materials and methods 2.1. Experimental animals A stock of pea aphids (A. pisum) (collected in proximity to Taipei, Taiwan) was maintained in glass beakers (10 cm in diameter) on pea plants (Pisum sativum) in a watered granule-like substrate. The plants were grown in a chamber with a 16-hour photoperiod (long day, LD) at 18 °C. Winged morphs under LD conditions were produced from wingless females maintained under high-density conditions. 2.2. Nutritional stress experiment For the nutritional stress experiments, the stressed pea plants were prepared in advance. Plants older than 3 weeks were infested by aphids for 2 weeks, and then the aphids were removed with a fine brush before the main experiment. These plants were then infested again by a group of 90 freshly emerged wingless females (1–2 days old), of which 45 individuals were collected 3 days later and separated into 9 biological replicates (5 individuals per replicate). These individuals were then weighed, frozen in liquid nitrogen, and stored at −80 °C until further use. The remaining aphids were transferred to young and intact pea plants without crowded conditions, and were left for 7 days. These females were then processed in the same way as the previously described group. The group of winged females was handled in the same way. Thus, after 3 days under stress conditions, all winged aphids were ready to migrate, and were collected from the underside of a net covering the glass beakers. Half of the individuals were immediately processed, while the other half were transferred to fresh plants and left for 7 days before processing. 2.3. Quantification of proteins, free carbohydrates, glycogen, phospholipids, and triglycerides Six biological replicates (5 females per each replicate) of each polyphenic form were collected under specific nutritional conditions (see Section 2.2) and subjected to determination of metabolic reserve. The modified method of the consecutive analyses of each sample was employed (Foray et al., 2012). In brief, all samples were homogenized in 160 μl of 50 mM potassium phosphate buffer (pH 7.0), and centrifuged at 12,000 ×g for 10 min. First, 10 μl supernatant was used to determine the amount of protein by using the standard Bradford reagent assay (Quick Start™ Bradford, Bio-Rad). In the second step, 1150 μl chloroform–methanol mixture (1:1; v/v) was added to the rest of the solution and then vortexed and centrifuged at 1600 ×g for 1 min. The supernatants were transferred to new microcentrifuge tubes (2 ml) and the pellets were stored for the later determination of glycogen. Subsequently, 650 μl double-distilled water was added to the supernatant, vortexed, and centrifuged at 1600 ×g for 1 min again. The aqueous phase that formed was removed and evaporated for the later determination of total free carbohydrates and reducing sugars. Chloroform solvent was added to the remaining organic phase, to make the mixture up
33
to 2 ml, and was mixed vigorously. In the next step, half of the solution was transferred to a separate tube with 100 mg of silicic acid (Sila 200™), gently mixed, and subsequently centrifuged at 180 ×g for 10 min. The 800 μl upper phase was transferred to new microcentrifuge tubes. Both the treated and untreated parts with silicic acid were evaporated and the relative amount of lipids was determined using the sulfophosphovanilin test (Kodrík et al., 2002). The step employing silicic acid was included to bind polar lipids (i.e., monoglycerides, diglycerides, and free fatty acids; designated as phospholipids in the text), from which we determined the relative amount of triglycerides (Foray et al., 2012). The amount of phospholipids was calculated by subtracting the amount of triglycerides from total lipids. Total free carbohydrate (TFC) content was measured using the phenol-sulfuric acid reagent according to Dubois et al. (1956). The amount of reducing sugars was measured using the dinitrosalicylic reagent assay (Miller, 1959). The amount of non-reducing sugars was calculated by subtracting the reducing sugars from TFC. Glycogen content was measured by colorimetric determination using phenol and concentrated sulfuric acid (Dubois et al., 1956) after extracting glycogen in hot alkali (Bueding and Orrell, 1964). All the characteristics were normalized per mg fresh body weight of studied aphids. 2.4. Nucleic acid isolation Total RNA was extracted from the whole bodies of females using TRIzol reagent (Ambion) following the manufacturer's protocol. RNA isolates were treated with RQ1 RNase-Free DNase (Promega) to remove traces of contaminant DNA. 2.5. Quantitative reverse-transcription PCR (q-RT-PCR) The cDNA template was prepared using the High Capacity cDNA Reverse Transcription Kit (ABI) on 1 μg of the corresponding total RNA with random hexamers. q-RT-PCR was performed using the Applied Biosystems StepOnePlus real-time PCR systems with Fast SYBR Green Master Mix (Applied Biosystems). The concentration of each primer was 200 nM. The PCR program was programmed as follows: initial denaturation for 3 min at 95 °C, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. A final melting-curve step was included post-PCR (rising from 60 °C to 95 °C at 0.3 °C intervals) to confirm the absence of any non-specific amplification. The efficiency of each primer pair was assessed by constructing a standard curve through 5 serial dilutions. Each q-RT-PCR experiment consisted of 3 independent biological replicates (5 females per replicate, see Section 2.2), with 3 technical replicates for each parallel group. The abbreviations and descriptions of the target genes, along with their respective primer sequences, are listed in Table 1. The suitability of reference genes (GAPDH, RPL7, and RPL27) was evaluated using mathematical methods implemented in NormFinder (Andersen et al., 2004). Subsequently, RPL27 was determined to be the most reliable control gene, and was used in the subsequent analyses. Changes in the relative gene expression of stressed versus unstressed females are expressed as the fold ratio using the 2−ΔΔCt method (Livak and Schmittgen, 2001). 2.6. Data presentation and statistical analysis The obtained results were plotted using the Prism graphic program (GraphPad Software, version 5.0, San Diego, CA, USA). 3. Results and discussion 3.1. Stress-related changes in the expression of A. pisum adipokinetic hormone and its respective receptor Nutritional stress and migration are connected with enhanced energy consumption mediated by a group of specific neurohormones;
34
P. Jedlička et al. / Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37
Table 1 List of primer sequences used for q-RT-PCR analysis. Target gene abbr. used
Gene accession number
Definition
Forward primer
Reverse primer
AKH AKHR
JQ086350 XM_001945401.2
TGTTGTTGGCCGTGTTCATGTTG GGTGCTCGGTGATCCACTAT
AGTGGCTGTTCAATTCGTGACG ACCATGTGGCATTAGGGTGT
GYP PKB-α
XM_001950725 XM_001948393
TGGTTGGTCGTTCCCTTCAG CCAGATCATTCATGCTTGATG
CCAAACCTGAGCCAATCGTC AAAATACCATCCAATTCTGCTTCA
GYS Diacetyl/L-xylulose reductase LSD1
XM_001950166.2 NM_001126169.2
AKH preprohormone Gonadotropin-releasing hormone II receptor-like Glycogen phosphorylase-like Probable phosphorylase b kinase regulatory subunit alpha-like Putative glycogen [starch] synthase-like Diacetyl/L-xylulose reductase
CGTGGAAAGTCTCCGTGGTC CGCTGTTGGACGTGACGCAAAG
CGGTGGCAAGTCGTCTCTCT AAGCCGTGGACAGGTCCCAATT
GTATTGAGCGTCGTAGACATG
CACGGAGTCTGCACGTTTTA
DDHD2
XM_001950259.2
CGTGGAATACTGTTTATCAGTTGG
TGGTGCCTCTTGTAAAACACAATC
GST-δ CYP450 COE CP RR1-CP Actin Cofilin Tropomyosin GAPDH
NM_001162802 NM_001163211 XM_001945501.2 NM_001134286.1 NM_001172261.1 NM_001142636.1 NM_001126170.2 XM_001947785.2 XM_001943014.2
CCCAAAAGACCCGAAGAAGC AATGCGACCTAATGGCGT CGAATGTAACATGGAATGCGGAAC CTCCCGTAGCAGCACCCATCTA CCGAAAACGCCGCCCAAGTGAT GCCGCAGTCGTACAGATTTCCT CGGCAGACGTCGGGCGTTTTAT GTCCCTTAGCTGGTAACTAAAATTGGCT CTGTTGTTGACTTGACTGTAAGACTT
AGCCCAAGTGGAAGATCCCA TTCGGAATCACTACCACGGATAA TCAGCGTGACATGCACCTTT TCGTGTCCGTATGCTGCTGGTT AACCGGTCTCGTCGGCGTAGTA TCCCATACCGACCATGACTCCTT CGGAACGGGACGCGGGTTTTTA CTGCGTGTAATAATCAAGTACCTACTGCAT TCAATGAAATTCCCGCCTTAGC
RPL7 RPL27
NM_001135898.1 NM_001126221.2
Lipid storage droplets surface-binding protein 1-like Phospholipase DDHD2-like (LOC100165519), mRNA Glutathione S-transferase Cytochrome P450 protein Esterase FE4-like Cuticular protein RR1 cuticle protein 8 (cprr1-8) Actin Twinstar (Tsr) Tropomyosin-2-like Glyceraldehyde-3-phosphate dehydrogenase-like Ribosomal protein L7 (Rpl7) Ribosomal protein L27 (Rpl27)
ATGCGTATTCGTGGTGTGAACC GCTGTCATAATGAAGACCTACGATGA
TGTAGACCAGTTCCCTTACGCT GGTGAAACCTTGTCTACTGTTACATCT
XM_001949727.2
namely, adipokinetic hormones (AKHs) (Kodrík, 2008; Gäde, 2009; Bednářová et al., 2013). AKHs are synthesized, stored, and released by neurosecretory cells from the paired endocrine glands corpora cardiaca (CC), which are connected to the insect brain (Kodrík, 2008). While the nucleotide and protein sequences of AKH and its respective receptor (AKHR) are known for many insect species (Gäde, 2009; Huang et al., 2012), few studies have described the quantitative expression of AKH and its receptor to date (Huang et al., 2012; Jedlička et al., 2012). Table 2 presents the changes in gene expression related to nutritional stress under the experimental conditions, in addition to providing the respective statistical significance. In brief, we recorded 2.13 times higher AKH expression in winged females under nutritional stress than in their unstressed conspecifics. Similarly, the expression of the AKH gene was 2.14 times higher in stressed wingless aphids than that of the unstressed females (Table 2). This demonstration of markedly enhanced AKH transcription levels in both female forms of A. pisum under nutritional stress conditions supplements previous reports that showed an increased titer of bioactive AKH peptide in both the CC and hemolymph after stress induced by toxins and herbicides in certain model insect species (reviewed by Kodrík, 2008). In addition, we compared the expression levels of the studied genes between both polyphenic forms (Table 2). The expression of AKH gene was significantly higher in winged females, i.e., 1.86 and 1.88 times higher under the stress and unstressed conditions, respectively. Thus, we confirmed previous findings that the highest AKH transcription level is related to the winged parthenogenetic female, possibly because of the high energetic demands of this polyphenic form (Jedlička et al., 2012). In contrast, the expression of the corresponding AKH receptor, AKHR, remained stable in both treatments, with no significant difference being found when we compared winged with wingless females (Table 2). Although Huang et al. (2012) reported that the AKHR transcription level declines during the oxidative stress of fat body tissues in Blattella germanica, the response of the AKH ligand-receptor system to nutritional stress in the whole body of A. pisum was limited to just the regulation of the ligand. 3.2. Stress-related changes in the metabolism of energetic reserves of A. pisum AKHs trigger catabolic reactions that provide energy from the insect fat body (Gäde, 2009). Therefore, we aimed to obtain detailed information
about the changes in energy storage by the two forms of A. pisum (Fig. 1), in addition to recording the expression of genes encoding enzymes engaged in the respective biochemical pathways (i.e., metabolism of carbohydrates—GYP, PKB-α, GYS and diacetyl/L-xylulose reductase, and lipids— LSD1 and DDHD2; Table 2). All collected winged and wingless aphids began reproducing when transferred to intact pea plants, with their Table 2 Statistical analysis of gene expression in A. pisum females subjected to nutritional stress. The ratio values that are significantly higher and lower than “1” represent the up- and down-regulation of the relevant gene in the studied group of aphids, respectively. The first two columns represent the fold change in the relative expression levels of stressed females (winged = WD and wingless = WL) compared to unstressed females. The second set of columns shows the gene expression in winged females compared to wingless aphids before and after being subjected to the respective treatments (stressed and unstressed females). Bold-type values represent significant differences between respective conditions or female forms (two tailed t-test; *, **, and *** correspond to p b 0.05, 0.01, and 0.001, respectively). The values represent the mean ± SE (n = 3). The horizontal solid lines separate the studied genes into the functional groups of the proteins that they encode: adipokinetic hormone and its respective receptor, AKH and AKHR; enzymes involved in the metabolism of carbohydrates (GYP, PKB-α, GYS, and diacetyl/L-xylulose reductase) and lipids (LSD1 and DDHD2); detoxification enzymes (GST-δ, CYP450, and COE) and exoskeleton/cuticular proteins (CP and RR1-CP); and proteins linked to cytoskeleton organization and function (actin, cofilin, and tropomyosin). See Table 1, for the list of abbreviations for the genes. Gene
AKH AKHR GYP PKB-α GYS Diacetyl/L-xylulose reductase LSD1 DDHD2 GST-δ CYP450 COE CP RR1-CP Actin Cofilin Tropomyosin
Stressed/unstressed
WD/WL
WD
WL
Stressed
Unstressed
2.13** 0.83 3.97*** 0.72 2.08 0.71 2.11* 2.77* 1.15 0.83 1.05 0.03*** 0.49 1.28 0.66* 1.06
2.14** 0.91 1.04 1.03 1.52 0.65* 2.23* 6.24** 0.72** 1.36** 1.31 0.49* 1.29 1.16 0.51** 1.17
1.86** 0.75 3.10*** 0.95 1.35 0.38** 0.72* 0.70 1.53 0.41*** 0.91 0.10** 0.28** 1.56 1.46** 1.41
1.88** 0.81 0.83 1.22 0.97 0.38* 0.76* 1.34 0.99 0.70* 1.13 1.69* 0.78 1.36 1.11 1.88
P. Jedlička et al. / Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37
fresh body weights increasing to a similar degree (i.e., by 2.2 and 2.1 times in winged and wingless females, respectively; Fig. 1A). The overall free protein content was found 1.2 times higher in stressed wingless females than that of the unstressed aphids (Fig. 1B), because of the insufficient supply of water from the old host plants, which consequently lowered the fresh body weight of the tested aphids (Fig. 1A). Among carbohydrates, glycogen reserves appeared to be used for the survival of A. pisum females subjected to nutritional stress conditions. This hypothesis is supported by noticeably reduced levels of glycogen in nutritionally stressed A. pisum females (4.3 times and 5.1 times lower in winged and wingless females, respectively; Fig. 1C) compared to their nutrient-rich conspecifics (i.e., transferred to fresh pea plants). In addition, the expression of the enzyme responsible for glycogen degradation, i.e., glycogen phosphorylase (GYP), was substantially up-regulated in winged starving females (fold change of 3.97; Table 2). The activity of this enzyme is triggered by the AKH bioactive peptide (Gäde, 2009), which supports our finding of elevated mRNA levels of both genes during nutritional stress. Interestingly, phosphorylase kinase B (PKB-α; an activator of the GYP) and glycogen synthase (GYS; with the opposite function to GYP) expression levels were unchanged after aphid transfer (Table 2). As documented for glycogen, the amount of reducing sugars was remarkably enhanced once the aphids were supplied with phloem sap rich in monosaccharides (3.2 and 2.2 times in winged and wingless females, respectively; Fig. 1D). The metabolism of simple carbohydrates was also supported by significantly increased transcription levels of diacetyl/L-xylulose reductase in well-fed wingless females (Table 2). This enzyme is functionally
35
involved in the uronate cycle of glucose metabolism, with its molecular metabolism being well described in the kidney tissues of some mammalian model species (Nakagawa et al., 2002). The aphid ortholog of this enzyme was also studied in the potato aphid Macrosiphum euphorbiae, with the study showing that different types of abiotic stress influence the expression of this gene (Nguyen et al., 2009). In contrast, the levels of non-reducing di- and oligosaccharides were not influenced by the nutritional stress (Fig. 1E). It has been well documented that oligosaccharides are produced to balance osmotic pressure between the body fluids of aphids and their diet of plant phloem sap (Karley et al., 2005). Thus, the preservation of similar amounts of non-reducing sugars per fresh body weight unit under conditions of nutrient paucity is necessary for aphid survival. After the females of both forms were transferred to nutrient-rich conditions, triglyceride content significantly declined (1.6 and 1.5 times in winged and wingless females, respectively; Fig. 1F). Because all aphids were transferred manually, we may exclude the influence of migratory flight on triglyceride level, as this process was described in long-term flying insects (summarized in Arrese and Soulages, 2010). Thus, this finding supports the general concept that lipids from the fat body are transported to the ovaries and subsequently accumulate in maturating oocytes. They provide energy deposits for processes connected with embryo development (Arrese and Soulages, 2010). Moreover, the amount of free lipid form, phospholipids, increased under nutrient rich conditions in winged females (Fig. 1G), which corresponds to the mobilization of lipids from triglycerides in the fat body and their subsequent transport to the ovaries. To document lipid
Fig. 1. Changes to the metabolic reserves of the winged and wingless females of A. pisum after exposure to nutritional stress conditions. Data were measured in stressed (black bars) and unstressed (gray bars) females of each respective form (winged = WD or wingless = WL). The bars represent the mean ± SD (n = 6). A = fresh body weight (FBW); B = free soluble proteins; C = glycogen content; D = reducing sugars; E = non-reducing sugars; F = triglycerides; G = phospholipids (two tailed t-test; *, **, and *** correspond to p b 0.05, 0.01, and 0.001, respectively).
36
P. Jedlička et al. / Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37
degradation, the expression level of the lipid storage droplet phosphoprotein, LSD1, was recorded (Table 2). Patel et al. (2005) demonstrated that the AKH-mediated activation of LSD1 proteins in lipid droplets accelerates the lipolysis of triglycerides by specific lipases in the insect fat body. In other words, the amount of activated LSD1 protein is positively correlated with the concentration of the AKH neuropeptide in insect hemolymph. Our results support this finding, showing elevated transcription levels of LSD1 under stress conditions (fold change of 2.11 and 2.23 in winged and wingless females, respectively; Table 2) and its hormonal activator AKH during nutritional stress in A. pisum parthenogenetic females (Table 2). In addition, the same expressional pattern was recorded in another studied gene involved in lipolysis, phospholipase DDHD2 (fold change of 2.77 and 6.24 in stressed winged and wingless females, respectively; Table 2). Although lipolytic genes were up-regulated in stressed aphids, the triglyceride level was also noticeably higher than that recorded in well-fed females (Fig. 1F). We speculate that free phospholipids are utilized to fulfill the energetic demands of A. pisum females subjected to insufficient nutritional conditions. However, the massive depletion of triglyceride stores only occurs when aphids reproduce in nutrient-rich environments, with mobilized lipids being immediately used for embryo development (Fig. 1F and G). 3.3. Stress-related changes in the expression of A. pisum detoxification and exoskeleton genes We also analyzed genes that are functionally involved in the aphid response to noxious chemicals. Genes encoding detoxification enzymes and exoskeleton proteins were selected based on micro-arrays studies of aphid strains resistant to pesticides (Puinean et al., 2010; Silva et al., 2012). The delta class is the largest cytosolic subgroup of glutathione S-transferases (GSTs), and has been studied in many model insect species (Zhou et al., 2012). The majority of GST-δ members are engaged in the insect metabolism of xenobiotics (Hemingway et al., 2004). The up-regulation of GST-δ expression in A. pisum wingless females on fresh pea plants (Table 2) may be caused by the need to detoxify secondary metabolites, e.g., lectins (Rahbé et al., 1995), that are present in the phloem sap of young plants (Francis et al., 2005). The production of defensive compounds is a general response of an originally intact plant to herbivorous feeding (Giordanengo et al., 2010). In contrast, nutritional stress elicits 1.36 times higher expression of cytochrome P450 monooxygenase 6 in wingless aphids (Table 2). Moreover, we detected markedly lower transcription levels of CYP450 in winged females compared to their wingless conspecifics on both original and new fresh plants (fold change of 0.41 and 0.70, respectively; Table 2). One member of the carboxylesterase FE4 family, COE, was expressed at a similar level in aphids subjected to both treatments (Table 2). In contrast to the set of enzymes involved in metabolic pathways (Section 3.2), we did not observe any similar tendency between elevated mRNA levels of AKH and detoxifying enzymes during nutritional stress. The representative exoskeleton genes studied here (cuticular proteins CP and RR1-CP) are just two members of the dozens of different structural proteins found in the insect cuticle (Klarskov et al., 1989). While the gene expression of RR1-CP did not show any significant changes in stressed individuals, the expression of CP was downregulated in both forms of A. pisum females subjected to nutritional stress conditions (fold change of 0.03 and 0.49 in winged and wingless females, respectively; Table 2). Therefore, we speculate that the structural protein CP might be an important cuticle component for developing embryos in the parthenogenetic ovaries of reproducing females of A. pisum. 3.4. Stress-related changes in the expression of A. pisum cytoskeleton genes To determine the expected changes accompanying flight muscle breakdown in winged females after the colonization of new plants (Kobayashi and Ishikawa, 1994), we studied the expression of genes
involved in cytoskeleton organization and function. Even though we did not observe any changes in actin and tropomyosin expression after simulated migration (Table 2), the transcription levels of cofilin were significantly higher in starving winged females compared to wingless females (1.46 times; Table 2). Since cofilin is a member of the actindepolymerizing factor family (Chen et al., 2000), this finding may indicate that there is an increase in the turnover of actin filaments in this aphid form before migration flight. Furthermore, supporting the study by Nguyen et al. (2009) on M. euphorbiae, we recorded the downregulated expression of cofilin in both A. pisum forms under the stress condition (fold change of 0.66 and 0.51 in winged and wingless females, respectively; Table 2). This finding supports the role of cofilin in the molecular response of aphids exposed to both nutritional and abiotic stressors (Nguyen et al., 2009), with this protein being connected to the known stress-related mechanism of cell protection from apoptosis described by Chua et al. (2003). The absence of significant differences in actin expression in winged females (Table 2) does not correspond to the data describing the effects of starvation on overall protein content in the indirect flight muscle (IFM) of winged females of A. pisum (Kobayashi and Ishikawa, 1993). They recorded stabilized protein levels in the IFM of starving aphids during five consecutive days after final ecdysis. The amount of proteins dropped when the aphids were supplied food again, and their fresh body weight increased. In contrast to this preceding work, we extracted mRNA from the whole bodies of A. pisum females. Therefore, actin transcript levels were recorded in the tissues of reproducing females, as well as in the tissues of embryos and first instar offspring in the ovaries. This study demonstrated that the expression of the stress hormone, AKH, is markedly up-regulated in parthenogenetic A. pisum females during nutritional stress under experimental conditions. In parallel, the mRNA abundance of genes responsible for glycogen and lipid degradation is also significantly enhanced, with the energy content of reducing sugars, glycogen, and phospholipids being utilized for survival. In contrast, the onset of reproduction after the colonization of a nutrientrich plant is accompanied by using triglyceride stores. Among genes related to insecticide resistance, only CYP450 expression was up-regulated in stressed wingless females, while the transcription levels of the enzyme GST-δ (wingless form only) and the exoskeleton protein CP (both female forms) increased in reproducing A. pisum females after transfer to fresh plants. Furthermore, nutritional stress defense in aphids appears to be related to the reduced expression level of the gene encoding a protein involved in cytoskeleton organization, cofilin. In conclusion, we present the first data revealing the hormonal and metabolic background of nutritional stress-related changes in winged and wingless polyphenic forms of A. pisum.
Acknowledgments This study was financially supported by grants from Ministry of Science and Technology of Taiwan (98-2321-B-002-017-MY3 to How-Jing Lee) and Ministry of Education of Taiwan (10R40044 and 102R4000 to Pavel Jedlička).
References Andersen, C.L., Jensen, J.L., Ørntoft, T.F., 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, 5245–5250. Arrese, E.L., Soulages, J.L., 2010. Insect fat body: energy, metabolism, and regulation. Annu. Rev. Entomol. 55, 207–225. Bednářová, A., Kodrík, D., Krishnan, N., 2013. Unique roles of glucagon and glucagon-like peptides: parallels in understanding the functions of adipokinetic hormones in stress responses in insects. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 164 (1), 91–100. Braendle, C., Davis, G.K., Brisson, J.A., Stern, D.L., 2006. Wing dimorphism in aphids. Heredity 97, 192–199. Brisson, J.A., 2010. Aphid wing dimorphisms: linking environmental and genetic control of trait variation. Philos. Trans. R. Soc. Lond. B Biol. Sci. 365, 605–616.
P. Jedlička et al. / Comparative Biochemistry and Physiology, Part A 180 (2015) 32–37 Bueding, E., Orrell, S.A., 1964. A mild procedure for the isolation of polydisperse glycogen from animal tissues. J. Biol. Chem. 239, 4018–4020. Chen, H., Bernstein, B.W., Bamburg, J.R., 2000. Regulating actin-filament dynamics in vivo. Trends Biochem. Sci. 25 (1), 19–23. Chua, B.T., Volbracht, C., Tan, K.O., Li, R., Victor, C.Y., Peng, L., 2003. Mitochondrial translocation of cofilin is an early step in apoptosis induction. Nat. Cell Biol. 5, 1083–1089. Dixon, A.F.G., 1985. Structure of aphid populations. Annu. Rev. Entomol. 30, 155–174. Dixon, A.F.G., 1998. Aphid Ecology: An Optimization Approach, second ed. Chapman and Hall, London. Dubois, M., Gilles, A., Hamilton, J.K., Rebers, P.A., Smith, F., 1956. Colorimetric method for determination of sugars and related substances. Anal. Chem. 28, 350–355. Foray, V., Pelisson, P.F., Bel-Venner, M.C., Desouhant, E., Venner, S., Menu, F., Giron, D., Rey, B., 2012. A handbook for uncovering the complete energetic budget in insects: the van Handel's method (1985) revisited. Physiol. Entomol. 37, 295–302. Francis, F., Vanhaelen, N., Haubruge, E., 2005. Glutathione S-transferases in the adaptation to plant secondary metabolites in the Myzus persicae aphid. Arch. Insect Biochem. Physiol. 58 (3), 166–174. Gäde, G., 2009. Peptides of the adipokinetic hormone/red pigment-concentrating hormone family: a new take on biodiversity. Ann. N. Y. Acad. Sci. 1163, 125–136. Giordanengo, P., Brunissen, L., Rusterucci, C., Vincent, C., van Bel, A., Dinant, S., Girousse, C., Faucher, M., Bonnemain, J.L., 2010. Compatible plant-aphid interactions: how aphids manipulate plant responses. C. R. Biol. 333 (6-7), 516–523. Hemingway, J., Hawkes, N.J., McCarroll, L., Ranson, H., 2004. The molecular basis of insecticide resistance in mosquitoes. Insect Biochem. Mol. Biol. 34 (7), 653–665. Huang, J.H., Bellés, X., Lee, H.J., 2012. Functional characterization of hypertrehalosemic hormone receptor in relation to hemolymph trehalose and to oxidative stress in the cockroach Blattella germanica. Front. Endocrinol. (Lausanne) 2, 114. Jedlička, P., Steinbauerová, V., Šimek, P., Zahradníčková, H., 2012. Functional characterization of the adipokinetic hormone in the pea aphid, Acyrthosiphon pisum. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 162 (1), 51–58. Karley, A.J., Ashford, D.A., Minto, L.M., Pritchard, J., Douglas, A.E., 2005. The significance of gut sucrase activity for osmoregulation in the pea aphid, Acyrthosiphon pisum. J. Insect Physiol. 51 (12), 1313–1319. Klarskov, K., Højrup, P., Andersen, S.O., Roepstorff, P., 1989. Plasma-desorption mass spectrometry as an aid in protein sequence determination. Application of the method on a cuticular protein from the migratory locust (Locusta migratoria). Biochem. J. 262 (3), 923–930. Kobayashi, M., Ishikawa, H., 1993. Breakdown of indirect flight muscles of alate aphids (Acyrthosiphon pisum) in relation to their flight, feeding and reproductive behavior. J. Insect Physiol. 39 (7), 549–554.
37
Kobayashi, M., Ishikawa, H., 1994. Involvement of juvenile hormone and ubiquitindependent proteolysis in flight muscle breakdown of alate aphid (Acyrthosiphon pisum). J. Insect Physiol. 40 (2), 107–111. Kodrík, D., 2008. Adipokinetic hormone functions that are not associated with insect flight. Physiol. Entomol. 33, 171–180. Kodrík, D., Socha, R., Zemek, R., 2002. Topical application of Pya-AKH stimulates lipid mobilization and locomotion in the flightless bug, Pyrrhocoris apterus (L.) (Heteroptera). Physiol. Entomol. 27, 15–20. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(− Delta Delta C(T)) Method. Methods 25 (4), 402–408. Miller, G.L., 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31, 426–428. Nakagawa, J., Ishikura, S., Asami, J., Isaji, T., Usami, N., Hara, A., Sakurai, T., Tsuritani, K., Oda, K., Takahashi, M., Yoshimoto, M., Otsuka, N., Kitamura, K.J., 2002. Molecular characterization of mammalian dicarbonyl/L-xylulose reductase and its localization in kidney. Biol. Chem. 277 (20), 17883–17891. Nguyen, T.T., Michaud, D., Cloutier, C., 2009. A proteomic analysis of the aphid Macrosiphum euphorbiae under heat and radiation stress. Insect Biochem. Mol. Biol. 39 (1), 20–30. Patel, R.T., Soulages, J.L., Hariharasundaram, B., Arrese, E.L., 2005. Activation of the lipid droplet controls the rate of lipolysis of triglycerides in the insect fat body. J. Biol. Chem. 280 (24), 22624–22631. Puinean, A.M., Foster, S.P., Oliphant, L., Denholm, I., Field, L.M., Millar, N.S., Williamson, M.S., Bass, C., 2010. Amplification of a cytochrome P450 gene is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae. PLoS Genet. 6 (6), e1000999. Rahbé, Y., Sauvion, N., Febvay, G., Peumans, W.J., Gatehouse, A.M.R., 1995. Toxicity of lectins and processing of ingested proteins in the pea aphid Acyrthosiphon pisum. Entomol. Exp. Appl. 76 (2), 143–155. Silva, A.X., Jander, G., Samaniego, H., Ramsey, J.S., Figueroa, C.C., 2012. Insecticide resistance mechanisms in the green peach aphid Myzus persicae (Hemiptera: Aphididae) I: A transcriptomic survey. PLoS One 7 (6), e36366. Sláma, K., Jedlička, P., 2012. Respiratory metabolism of the pea aphid, Acyrthosiphon pisum (Hemipetra: Aphididae). Eur. J. Entomol. 109, 491–502. Zhou, W.W., Li, X.W., Quan, Y.H., Cheng, J., Zhang, C.X., Gurr, G., Zhu, Z.R., 2012. Identification and expression profiles of nine glutathione S-transferase genes from the important rice phloem sap-sucker and virus vector Laodelphax striatellus (Fallén) (Hemiptera: Delphacidae). Pest Manag. Sci. 68 (9), 1296–1305.
