A r t i c l e
Hunchback IS REQUIRED FOR ABDOMINAL IDENTITY SUPPRESSION AND GERMBAND GROWTH IN THE PARTHENOGENETIC EMBRYOGENESIS OF THE PEA APHID, Acyrthosiphon pisum Jianjun Mao, Changyan Liu, and Fanrong Zeng Key Laboratory of Integrated Pest Management in Crops, Ministry of Agriculture, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, People’s Republic of China
Aphid, a short germband insect, displays an embryogenesis different from that of long germband insect species. Furthermore, the development of its parthenogenetic and viviparous embryo is different from that of the embryo resulting from sexual reproduction. To better understand the genetic regulation of this type of embryogenesis, the functions of hunchback in asexual Acyrthosiphon pisum were investigated by parental RNAi. Microinjection of Aphb double-stranded RNA yielded several defective phenotypes. Quantitative real-time PCR analysis revealed that these defects resulted from reduction of Aphb mRNA level in injected aphids. All these results suggested that the hb gene in parthenogenetic and viviparous Acyrthosiphon pisum was involved in abdominal identity suppression C 2013 and germband growth as its homologue does in sexual insects. Wiley Periodicals, Inc. Keywords: RNAi; Acyrthosiphon pisum; Double-stranded RNA; hunchback; embryogenesis
Grant sponsor: National Basic Research Program of China (973 Program); Grant number: 2013CB127602; Grant sponsor: NSFC; Grant number: 31201570. Correspondence to: Fanrong Zeng, Key Laboratory of Integrated Pest Management in Crops, Ministry of Agriculture, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Yuanmingyuan West Road 2, Beijing 100193, People’s Republic of China. Email: [email protected] ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 84, No. 4, 209–221 (2013) Published online in Wiley Online Library (wileyonlinelibrary.com). C 2013 Wiley Periodicals, Inc. DOI: 10.1002/arch.21137
210
r
Archives of Insect Biochemistry and Physiology, December 2013
INTRODUCTION One of the most notable achievements in Drosophila melanogaster embryogenesis is the specification of the anterior–posterior (A–P) axis by the asymmetric location of bicoid (bcd) and oskar (osk) mRNAs to the opposite end of the developing oocyte (St Johnston ¨ and Nusslein-Volhard, 1992; Riechmann and Ephrussi, 2001). In long germband insects such as Drosophila, all of the body segments are specified early and simultaneously during the blastoderm stage (St Johnston and N¨usslein-Volhard, 1992). But in short or intermediate germband segmentation, only the anteriormost segments are specified during the blastoderm stage, and the rest of the body plan is specified later (French, 2001; Davis and Patel, 2002). The embryological differences between short and long germ segmentation imply molecular differences in patterning. The roles of a few early developmental genes involved in anteroposterior axis specification have become the focus for understanding these differences. In the dipteran Drosophila, the anterior axial patterning is largely established by bcd, a rapidly evolving maternal-effect gene (Riechmann and Ephrussi, 2001). The gap genes hunchback (hb) and orthodenticle (otd) are downstream targets of bcd (Driever ¨ and Nusslein-Volhard, 1989; Gao and Finkelstein, 1998). Synergy between the bcd and hb is responsible for activation of otd, ems, and btd (Simpson-Brose et al., 1994). But the bcd gene seems to be an innovation of the higher dipterans because its homologues have not been isolated in other insects such as Acyrthosiphon pisum. In insects lacking bcd, anterior specification instead relied on a synergistic interaction between maternal hb and orthodenticle (Saffman and Lasko, 1999; Stauber et al., 2002; McGregor, 2005). In Drosophila, the gap genes play a central role in the early subdivision of the blastoderm into broad regions, each of which will eventually encompass several adjacent body ¨ segments (Hulskamp and Tautz, 1991; Rivera-Pomar and J¨ackle, 1996). The gap gene hb, which codes for a zinc-finger containing transcription factor, is a key regulatory gene in ¨ the anteroposterior patterning in a number of insects (Jurgens et al., 1984; Lehmann and ¨ Nusslein-Volhard, 1987; Tautz et al., 1987; Patel et al., 2001; Liu and Kaufman, 2004). hb expression can be provided maternally and zygotically. The maternal RNA is distributed homogeneously in the embryo and is under the control of the posterior maternal factor nanos (nos). The zygotic expression of hb is regulated by the anterior maternal gene bcd (Wolff et al., 1995). In Drosophila, loss-of-function alleles for hb cause defects in the anterior region, including deletions of gnathal and thoracic segments (Tautz et al., 1987; Finkelstein and Perrimon, 1990). The single depletion of maternal and zygotic hb by parental RNAi leads to deletion in the head and thorax in Tribolium, transformation of anterior segments, and loss of posterior region in Nasonia (Lynch et al., 2006; Marques-Souza et al., 2008). Knockdown of both hb and otd, another gap gene, results in failure to develop the head, thorax and anterior abdomen (Lynch et al., 2006). In the milkweed bug Oncopeltus, the hb (Of’hb) RNAi depletion results in transformations of gnathal and thoracic regions into an abdominal identity, as well as impaired posterior elongation and segmentation (Liu and Kaufman, 2004). Although different functional roles have been ascribed to hb in different insects, the core elements, including the role in specifying anterior borders of Hox gene expression and interactions with other gap genes, seem to be conserved in all insects (Marques-Souza et al., 2008). Aphid, a short germ-band insect, shows divergent adult phenotypes and divergent modes of embryonic development at different times in their complex life cycle. The parthenogenetic mode, which is reinforced by viviparity and the telescoping of generations, allows aphid to reproduce so as to colonize new host plants as soon as possible. Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
211
In contrast, the development of the embryo within the sexual egg is slow and similar to the classical hemipteran mode of development (Miura et al., 2003). A comparison of parthenogenetic and sexual embryogenesis of the pea aphid A. pisum revealed that the primary difference between them is the scale on which development occurs. Early development of the parthenogenetic egg occurs in a volume approximately three orders of magnitude smaller than the sexual egg because yolk is absent in the parthenogenetic egg. In addition, both the developmental rate and the function of the serosa diverged between the two types of embryos (Miura et al., 2003). All these suggested that the two embryos utilize different or variant patterning systems, especially in the early stages of development. To gain insight into the genetic basis in the embryogenesis of parthenogenetic and viviparous pea aphid, we investigated the functions of the Aphb using maternal RNAi mediated by dsRNA microinjection. The knockdown of Aphb mRNA resulted in several classes of nymphs with different severity of body defect. By analyzing these defective phenotypes, we inferred that the Aphb gene is involved in suppression of abdominal identity in the gnathal and thoracic regions, and in growth of germband.
MATERIALS AND METHODS Insects The pea aphids (A. pisum) kindly provided by Zhang fan of Beijing Academy of Agriculture and Forestry Sciences (BAAFS) were reared on broad bean plants at 26–27◦ C under a light : dark regimen of 16 : 8 h in the greenhouse. New broad bean seedlings were provided once a week.
Aphb dsRNA synthesis R The dsRNAs were synthesized in vitro using MEGAscript RNAi Kit (Ambion, Austin, TX). Total RNA was extracted from single adult using Tranzol reagents (Transgene, Beijing, China). DNA contaminations were removed by digesting RNA solution with DNase (Ambion). cDNA was synthesized using TransScript First-Strand cDNA Synthesis SuperMix (Transgene) with anchored Oligo(dT)18 primer. T7 primers (T7 promoter plus exon specific sequence) were designed according to the Instruction Manual of R RNAi Kit to get a partial coding fragment of 524 bp (251–774 bp) the MEGAscript containing the conserved motifs MF1–4 and C-box sequence. PCR products were purified using TIANgel Midi Purification Kit (Tiangen, Beijing, China) and then sequenced. The obtained Aphb target-sequence shows a 95% identity with GQ144356.2 (883 bp-1406 bp) in GenBank. After synthesis by using the purified PCR product as template, the dsRNA was treated with DNase/RNase to digest template DNA and any ssRNA that did not anneal. Then, the purified dsRNA was quantified spectrophotometrically at 260 nm, subjected to agarose gel electrophoresis to determine purity and integrity and stored at −80◦ C before use. EGFP (GenBank Accession Number: CVU55761) dsRNA was also synthesized as above procedures with EGFP specific primers (T7 promoter plus EGFP specific sequence) and served as a control in microinjection (Liu et al., 2010). Primers used in the dsRNA synthesis for amplification of the target gene are shown in Table 1.
Archives of Insect Biochemistry and Physiology
212
r
Archives of Insect Biochemistry and Physiology, December 2013
Table 1. Primers Used in the Experiments Gene
PCR type
Aphb
RT-PCRa
EGFP
Real-time PCRb RT-PCRa
RpL7 Real-time PCRb a b
Forward
Reverse
TAATACGACTCACTATAGGG CTGGCACTGGTGGAAATA GCACATTCGCACTCACATCAAA TAATACGACTCACTATAGGG CCACAAGTTCAGCGTGTCCG GCGCGCCGAGGCTTAT
TAATACGACTCACTATAGGG TTGCTGATACGGGTTGTG TGGTTCAGCAGGTGGTATTCGT TAATACGACTCACTATAGGG AAGTTCACCTTGATGCCGTTC CCGGATTTCTTTGCATTTCTTG
Fragment size (bp) 564 102 463 81
Primers used in dsRNA synthesis for amplification of the target fragments. Primers used in qRT-PCR for mRNA level detection of different genes.
Aphb dsRNA injection Nymph-laying adults were used for injection in the experiments and the injection volume was 120 nl. Before injection, 1% agarose gel plate was prepared and narrow channels were made on the gel. Aphids were immobilized in the channels using a writing brush with abdomen airward. The concentration of dsRNA solution was 1.6 mg/ml. Injection was performed at two sites: the conjunctive between the first and second abdominal segments; the conjunctive between the fourth and fifth abdominal segments. A second microinjection was also performed for adults 24 h following the first injection to obtain a higher RNAi efficiency. At lease 50 aphids were injected at adult stage for each gene. R NI 2 and FemtoJet express Microinjectors system (Eppendorf, Eppendorf InjectMan Hamburg, Germany) with glass needles was adopted to conduct injection in 0.3 sec under a pressure of 500 mP. Injection was performed cautiously and the needle point was sure to be away from inside embryos. Injected insects were reared separately on new seedlings grown at 26◦ C, 75% relative humidity, and 16/8 h light/dark cycle. Quantitative real-time PCR To investigate the expression profile of Aphb at different developmental stages, total RNAs were isolated from pooled nymphs or single adult using Tranzol reagents (Transgene). To monitor Aphb mRNA level post dsRNA injection, three individuals which laid the most number of defective nymphs were collected at each time point from 1 to 8 days post injection and total RNAs were extracted form single injected adult. DNA contaminations were removed by treating RNA solution with DNase (Ambion). cDNA was synthesized using TransScript First-Strand cDNA Synthesis SuperMix (Transgene) with anchored Oligo(dT)18 primer. qRT-PCR was performed using a 25 μl total volume conR Green Real-time PCR taining cDNA produced from 2 μg total RNA, 11.25 μl of SYBR Master Mix (TOYOBO, Japan) and 200 nM each of forward and reverse Aphb specific primers. Primers used in the qRT-PCR for mRNA level detection are shown in Table 1. The PCR was processed on an IQ-5 Real-Time System (Bio-Rad) under the following program: one cycle of 95◦ C for 60 s; then 40 cycles of 95◦ C for 15 s, 60◦ C for 15 s and 72◦ C for 45 s. The melting curve was established from 55 to 95◦ C. Standard curves were constructed using serial dilutions of the cDNAs of single uninjected adult. Three technical replicates of each reaction were performed and Ribosomal protein L7 (RpL7) (GenBank Accession Number: NM 001135898.1), a continuously expressed gene, was used as internal control for normalization (Jaubert-Possamai et al., 2007). Threshold Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
213
Figure 1. Identification of dsRNA synthesized in vitro T7 primers was designed according to the Instruction R Manual of the MEGAscript RNAi Kit and Aphb mRNA (GenBank Accession Number: GQ144356.2) to get a partial coding fragment 524 bp of the Aphb and an EGFP fragment of 423 bp. About 1 μg of the purified Aphb or EGFP dsRNA was loaded onto a 1% agarose gel stained with ethidium bromide and photographed. M, 250 bp ladder molecular weight marker; hb, Aphb dsRNA; EGFP, EGFP dsRNA.
cycle values were used for the further analysis. Means and standard errors for each time point were obtained from the average of three independent sample sets. Quantification of the relative changes in gene transcript level was performed according to the 2−Ct method (Livak and Schmittgen, 2001). Compared to samples injected with EGFP dsRNA, the reduction (%) of Aphb expression levels was calculated in the samples injected with Aphb dsRNA and was used to evaluate RNAi efficiency.
RESULTS Verification of dsRNA synthesized in vitro The synthesized dsRNA was quantified spectrophotometrically at 260 nm, and then subjected to agarose gel electrophoresis to determine purity and integrity (Fig. 1). Parental RNAi of Aphb Because aphids used for injection have reached the adult stage, they began to lay nymphs in several hours after injection. But, progeny born at the first day post injection did Archives of Insect Biochemistry and Physiology
214
r
Archives of Insect Biochemistry and Physiology, December 2013
Figure 2. Ratio of defective nymphs laid by Aphb dsRNA injected adults. Nymph-laying adults (7-day old) were injected with Aphb dsRNA once or twice. The second injection was conducted after 24 h following the first injection. Newborn nymphs were scored for defects and ratio of defective nymphs born in each day was calculated. Values are means of three independent experiments.
not show any defects. When Aphb dsRNA injection was conducted only once, newborn nymphs with light defects were observed 2 days post injection. The typical phenotype was disruption of thoracic appendages. The RNAi effect endured only 4 days without a vivid increase or peak (Fig. 2) and few nymphs showed severe defects during this period. In order to achieve higher RNAi efficiency, adult aphids were microinjected twice at an interval of 1 day. We got good penetration efficiency and similar range of phenotypes using this method when compared with parental RNAi performed in other sexual insects. 2 days after injection, part of the injected adults began to produce nymphs with slight segmentation defects. The number of defective progeny and the severity of defects increased gradually in the following several days, reached a peak 6 days post the first injection and then decreased rapidly after that (Fig. 2). Double injection conducted at two abdominal sites at adult stage was proved efficient for studying the hb function in A. pisum aphids. Phenotypes obtained after injection Parental RNAi of Aphb resulted in phenotypes that ranged in severity from wild to severe types. Wild-type neonate (Fig. 3A1 and A2) was served as a reference to determine the class of nymphs laid by the injected mothers. Based on the range of defects severity, the newborn nymphs were categorized into four phenotypic classes (Table 2). The most severe class I nymphs comprised 1.7% of total newborn nymphs. In this phenotype, T1, T2, T3 legs were completely depleted and the head was followed by reduced segments without appendages. Eyes were identifiable. But antennas and labium were obscure and could not be identified. Because the body segments were reduced, this class of nymphs looked apparently shorter and smaller than wild-type ones (Fig. 3D1 and D2). Class II nymphs made up 3.3% of the total newborn nymphs. Gnathal and thoracic segments were less disturbed in class II than in class I, but still strongly transformed toward abdomen. Labium and all thoracic appendages were seriously suppressed in class II nymphs, except for vestigial legs in the T3 segment. In this class of nymphs, a Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
215
Figure 3. Aphb RNAi phenotypes. (A1, B1, C1, D1): Ventral view. (A2, B2, C2, D2): Dorsal view. (A1-A2): Nymphs laid by uninjected adults. Anterior toward the left. Thoracic and abdominal regions are delineated. AN: antenna; LB: labium; T1: first thoracic leg; T2: second thoracic leg; T3: third thoracic leg. (B1-B2): Class III nymphs. The distal region of the T1 leg seemed fused to the abdominal segments and was difficult to distinguish. T2 and T3 legs were less strongly affected, but also developed minor defects such as abnormal folding of the distal articles and fusion of the far ends of the two antennas. In addition, thoracic segmentation was somewhat obscure. (C1–C2): Class II nymph. Cephalic and thoracic appendages were seriously suppressed. T1 and T2 legs were missing. But T3 leg was dramatically reduced and often located near the posterior segments. Abdomen was twisted. (D1–D2): Class I nymphs. T1, T2, and T3 legs were all missing. Eyes (EY) developed. But antennas and labium could not be identified. This class of nymphs showed less body segments and looked apparently shorter than wild-type ones.
short posterior leg was often located near the posterior segments and seemed a partially suppressed remnant of the third thoracic leg (Fig. 3C1 and C2). Class III nymphs comprised 4.0% of total nymphs. These nymphs always showed mildly suppressed thoracic segmentation with light defects in appendages. Among the thoracic legs, the T1 legs were most frequently affected and especially the distal region seemed Archives of Insect Biochemistry and Physiology
216
r
Archives of Insect Biochemistry and Physiology, December 2013
Table 2. Results of Parental Aphb RNAi Days post injection (dpi) 1 2 3 4 5 6 7 8 Total
Total nymphs (n)
Class 1
Class II
Class III
Class IV
Wild-type
309 302 281 292 317 310 330 313 2,454
0(0) 0(0) 4(1.4) 9(3.1) 13(4.1) 12(3.9) 3(1.0) 0(0) 41(1.7)
0(0) 3(1.0) 9(3.2) 15(5.1) 21(6.6) 21(6.8) 12(3.6) 0(0) 81(3.3)
0(0) 5(1.7) 10(3.6) 22(7.5) 25(7.9) 27(8.7) 8(2.4) 0(0) 97(4.0)
0(0) 4(1.3) 8(2.8) 13(4.5) 16(5.0) 17(5.5) 7(2.1) 0(0) 65(2.6)
309(100) 290(96.0) 250(89.0) 233(80.0) 242(76.3) 233(75.2) 300(90.9) 313(100) 2170(88.4)
Fifty-two initial adults were injected. Results show number of nymphs of given phenotypic class with percentages in parentheses.
fused to the abdominal segments and could not be distinguished from the abdomen. Abnormal folding of the thoracic legs was also observed in this phenotype. In addition, the far ends of the two antennas were always fused together and could not be separated (Fig. 3B1 and B2). Class IV nymphs made up 2.6% of the total progenies. In this phenotype, the segments and appendages showed no identifiable defects. These nymphs were still alive after birth, but died soon in a few hours (data not shown). This phenotype was also observed in offspring of the EGFP dsRNA injected group and the ratio was about 2.3%. Based on above defective phenotypes, we built a model to demonstrate the function of Aphb (Fig. 4). With the reinforcement of Aphb depletion, antennae, labium and thoracic legs were increasingly reduced and the anterior region gradually transformed toward abdominal identity. At the same time, the abdominal segments were increasingly compacted and the most defective animals looked significantly shorter than wild-type ones. Silencing of Aphb The RNAi efficiency on Aphb expression in injected adults was analyzed by qRT-PCR from the first day to the eighth day after the injection. The common ribosomal RpL7 was chosen as the reference gene to calculate relative expression levels of target gene in the qRT-PCR analysis. The reduction (%) of Aphb expression levels was used to evaluate RNAi efficiency. When microinjection was performed only once, the Aphb transcripts were reduced slightly (6.5% ± 1.0) 2 day post injection. The maximum reduction of 15.2±2.0% in Aphb transcripts level occurred at the third day after injection. When a second injection was conducted after 24 h following the first injection, the Aphb transcripts was reduced by 10.1 ± 1.3% 2 days after the first injection. The maximum efficiency of 38.3 ± 6.9% was observed 6 days post injection (Fig. 5). These results indicated that the dsRNA injection reduced Aphb expression in adult pea aphids.
DISCUSSION So far, the functions of insect hb gene in sexual reproduction have been studied in several insect species, including dipteran Drosophila, coleopteran Tribolium, hemipteran Oncopeltus, Orthoptera Gryllus etc. (Lehmann and N¨usslein, 1987; Schr¨oder, 2003; Liu Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
217
Figure 4. Diagram of the parental effect of Aphb RNAi on asexual embryogenesis. Aphb transcripts depletion resulted in two effects on embryogenesis of the pea aphid. The first effect was gradual transformation of the anterior segments to abdominal identity. Body defects, including the suppression of the formation of antennae (Ant) and thoracic legs (T1–T3), became more and more severe with the increase of Aphb depletion. The second effect of the Aphb depletion was the compaction of abdominal region. In the most defective phenotypes, the abdominal segments were obviously reduced and nymphs looked apparently shorter and smaller than wild-type ones.
and Kaufman, 2004; Mito et al., 2005). Here, we first reported the knockdown of hb gene in parthenogenetic and viviparous insect by parental RNAi. Microinjection of doublestranded RNA targeted to the conserved motifs MF1–4 and C-box sequence of the Aphb yielded several classes of defective phenotypes. In a previously RNAi experiment, a downstream Aphb fragment (1,180–1,676 bp) was also selected as RNAi target sequence. Similar range of defects was obtained and slightly lower depletion efficiency was observed after downstream dsRNA injection (data not shown). Though the RNAi efficiency was not high and Aphb knockdown was not confirmed by in situ hybridization, these two RNAi tests made us confident that the obtained phenotypes were resulted from depletion of the Aphb transcripts. Among the sexual insects, in which the functions of hb have been elucidated, the Hemiptera O. fasciatus is phylogenetically closest to the pea aphid. In the most severe class of embryos after Of’hb knockdown, eyes developed and the anterior segmentation was apparent. But the posterior segmentation was defective and the postmaxillary body Archives of Insect Biochemistry and Physiology
218
r
Archives of Insect Biochemistry and Physiology, December 2013
Figure 5. Knockdown of the Aphb Adult pea aphids were injected with Aphb dsRNA once or twice. The second injection was performed 1 day post the first injection. Aphb mRNA reduction (%) in injected adults was analyzed by qRT-PCR to evaluate RNAi efficiency. The ribosomal RpL7 was used as internal control for normalization. Each kinetic point was performed in triplicate on three adults and values were expressed as mean ± SE of three replicates.
was composed of fewer and smaller segments and adopted an abdominal identity (Liu and Kaufman, 2004). This class of embryos is similar with the combination phenotype resulted from transformation of anterior segments and loss of posterior region in Tribolium castalium hb depletion (Marques-Souza et al., 2008). Because similar defects were also observed in the class I phenotype of Aphb depletion, we inferred that this class might also conform to the thoracic transformation phenotype. At every stage of the A. pisum embryogenesis, the developmental progress of body segments and appendages has been specified by Miura et al. (2003), and the accumulation region and abundance of the Aphb mRNA in the embryo has also been identified by Huang et al. (2010). We inferred that germband of the class I embryos failed to elongate and cephalic region was not specified properly because of the depletion of the Aphb transcripts at the anterior region of the embryo and in the gnathos (Huang et al., 2010). The consequence was severe suppression of the cephalic appendages, thoracic limb bud, and body segments. The medium phenotypes with moderate RNAi defects obtained after the hb depletion in A. pisum and O. fasciatus were similar. Both of them showed suppressed and deformed labium and appendages, gradual transformation of the thoracic region toward abdominal identity. Furthermore, either in depletion of Aphb or knockdown of Of’hb, the third thoracic legs were most resistant to the hb disruption. We inferred that defects in the cephalic and thoracic appendages in the present medium phenotypes were resulted from disruption of the Aphb transcripts in head region. The class III nymphs showed no strong defects except the mildly defective first thoracic legs and slightly obscure segmentation in the thoracic region. This class of phenotype is similar to the class I embryos (the weakest phenotype) in Of’hb depletion. Aside from defects in the first thoracic legs, this class of phenotype showed strong suppression of the labium. We are not certain if this kind of defect existed in the class III phenotype of Aphb RANi, because the labium was buried by the antenna and thoracic legs after birth. The class IV nymphs showed no identifiable defects in segments and appendages, just like the undeveloped or nonspecific classification reported in O. fasciatus (Liu and Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
219
Kaufman, 2004). These nymphs were still alive, but not energetic after birth. They could just contract abdominal segments and stretch out appendages occasionally and slowly, and died in a few hours. This class of nymphs probably developed uninterpretable defects, or injured in the microinjection experiment, as it was also observed in offspring of the EGFP dsRNA injected group. Another explanation is that Aphb plays crucial functions in central nerves system (CNS) development. Aside from the roles in segment patterning, hb is also an important player in sequential cell fate specification within the Drosophila CNS. It is expressed in the early sublineage of NB7–3 and is needed for the specification and/or maintenance of the early-born neurons (Novotny et al., 2002). It is likely that depletion of Aphb disrupted the development of nerves system of the embryos. So far, different functional roles have been ascribed to hb in different insect species. The core components are conserved among insects and represent the ancestral type of embryogenesis, while additional features are late evolutionary acquisitions and only emerged in higher Diptera (Marques-Souza et al., 2008). Based on analysis of the obtained phenotypes, we inferred that hb in parthenogenetic and viviparous Acyrthosiphon pisum possesses at least following conserved functions. (1) Aphb is required for suppression of abdominal identity in the gnathal and thoracic regions. From the weakest phenotypic class IV to the most severe phenotypic I, we can see a gradually suppression of the gnathal and thoracic appendages and a vivid transformation of the anterior regions to abdominal identity. (2) Aphb is involved in germband elongation. This was also implied by the class I phenotype, in which the abdominal segments were seriously suppressed. As phenotypic effects are always a combination of depletion of the gene itself and changes in downstream genes, further work is needed to elucidate interactions of the Aphb with other gap genes. RNA interference (RNAi) is a powerful weapon to inhibit gene expression in a sequence specific manner. RNAi mediated by microinjection of dsRNA was usually adopted to elucidate the hb function in Drosophila, Nasonia, and Tribolium (Schr¨oder, 2003; Lynch et al., 2006). RNAi efficiency seems to be highly variable according to insect species, targeted gene, injection stage, and dsRNA concentration etc. When double injection was performed in present study and each adult was injected a total volume of 240 nl at a concentration of 1.6 mg/ml, only about 12% of total nymphs born in 8 days developed body defects. Higher depletion efficiency is maybe expected if the concentration of dsRNA is elevated. It has been reported that both parental RNAi by dsRNA injection into female pupas and embryonic RNAi by dsRNA injection into eggs were feasible to knockdown the hb expression. In the present study, injection of Aphb dsRNA performed at nymph stage failed to induce defects in progeny. Similar phenomenon has been reported in other insect species and one of the well-known is D. melanogaster, for which dsRNA triggered RNAi in adults, but in larvae it failed to penetrate most tissues with the exception of hemocytes (Dzitoyeva et al., 2001; Goto et al., 2003; Miller et al., 2008). Based on these reports, we found the following: (1) penetration efficiency of the injected Aphb dsRNA is low in pea aphids; (2) A. pisum nymphs are not as sensitive as adults to the injected hb dsRNA. It is no wonder that no nymphs born at the first day after injection showed defects. One explanation is that these embryos are mature and have laid down their chorions. Thus the embryos are impenetrable to the injected dsRNA. Another reason is that the penetrance of injected dsRNA is low in A. pisum nymphs.
Archives of Insect Biochemistry and Physiology
220
r
Archives of Insect Biochemistry and Physiology, December 2013
ACKNOWLEDGMENTS We thank Zhang Fan of Beijing Academy of Agriculture and Forestry Sciences for presentation of pea aphid clones.
LITERATURE CITED Davis GK, Patel NH. 2002. Short, long, and beyond: molecular and embryological approaches to insect segmentation. Annu Rev Entomol 47:669–699. Driever W, N¨usslein-Volhard C. 1989. The bicoid protein is a positive regulator of hunchback transcription in the early Drosophila embryo. Nature 337:138–143. Dzitoyeva S, Dimitrijevic N, Manev H. 2001. Intra-abdominal injection of double-stranded RNA into anesthetized adult Drosophila triggers RNA interference in the central nervous system. Mol Psychiatry 6:665–670 Finkelstein R, Perrimon N. 1990. The orthodenticle gene is regulated by bicoid and torso and specifies Drosophila head development. Nature 346:485–488. French V. 2001. Insect segmentation: genes, stripes and segments in ‘Hoppers’. Curr Biol 11:910– 913. Gao Q, Finkelstein R. 1998. Targeting gene expression to the head: the Drosophila orthodenticle gene is a direct target of the bicoid morphogen. Development 125:4185–4193. Goto A, Blandin S, Royet J, Reichhart JM, Levashina EA. 2003. Silencing of toll pathway components by direct injection of double-stranded RNA into Drosophila adult flies. Nucleic Acids Res 31:6619–6623. Huang T, Cook CE, Davis GK, Shigenobu S, Chen RPY, Chang C. 2010. Anterior development in the parthenogenetic and viviparous form of the pea aphid, Acyrthosiphon pisum: hunchback and orthodenticle expression. Insect Mol Biol 19:75–85. ¨ Hulskamp M, Tautz D. 1991. Gap genes and gradients-the logic behind the gaps. BioEssays 13:261– 268. Jaubert-Possamai S, Trionnaire GL, Bonhomme J, Christophides GK, Rispe C, Tagu D. 2007. Gene knockdown by RNAi in the pea aphid Acyrthosiphon pisum. BMC Biotechnol 7:63. ¨ Jurgens G, Wieschaus E, N¨usslein-Volhard C, Kluding H. 1984. Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. Roux’s Arch Dev Biol 193:283–295. ¨ Lehmann R, Nusslein-Volhard C. 1987. hunchback, a gene required for segmentation of an anterior and posterior region of the Drosophila embryo. Dev Biol 119:402–417. Liu P, Kaufman TC. 2004. Hunchback is required for suppression of abdominal identity, and for proper germband growth and segmentation in the intermediate germband insect Oncopeltus fasciatus. Development 131:1515–1527. Liu S, Ding Z, Zhang C, Yang B, Liu, Z. 2010. Gene knockdown by intro-thoracic injection of double-stranded RNA in the brown planthopper, Nilaparvata lugens. Insect Biochem Mol Biol 40:666–671. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−Ct method. Methods 25:402–408. Lynch JA, Brent AE, Leaf DS, Pultz MA, Desplan C. 2006. Localized maternal orthodenticle patterns anterior and posterior in the long germ wasp Nasonia. Nature 439:728–732. Marques-Souza H, Aranda M, Tautz D. 2008. Delimiting the conserved features of hunchback function for the trunk organization of insects. Development 135:881–888. McGregor AP. 2005. How to get ahead: the origin, evolution and function of bicoid. Bioessays 27:904–913. Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
221
Miller SC, Brown SJ, Tomoyasu Y. 2008. Larval RNAi in Drosophila? Dev Genes Evol 218:505–510. Mito T, Sarashina I, Zhang H, Iwahashi A, Okamoto H, Miyawaki K, Shinmyo Y, Ohuchi H, Noji S. 2005. Non-canonical functions of hunchback in segment patterning of the intermediate germ cricket Gryllus bimaculatus. Development 132:2069–2079. Miura T, Braendle C, Shingleton A, Sisk G, Kambhampati S, Stern DL. 2003. A comparison of parthenogenetic and sexual embryogenesis of the pea aphid Acyrthosiphon pisum (Hemiptera: Aphidoidea). J Exp Zool 295B:59–81. Novotny T, Eiselt R, Urban J. 2002. Hunchback is required for the specification of the early sublineage of neuroblast 7–3 in the Drosophila central nervous system. Development 129, 1027–1036. Patel NH, Hayward DC, Lall S, Pirkl NR, DiPietro D, Ball EE. 2001. Grasshopper hunchback expression reveals conserved and novel aspects of axis formation and segmentation. Development 128, 3459–3472. Riechmann V, Ephrussi A. 2001. Axis formation during Drosophila oogenesis. Curr Opin Genet. Dev 11:374–383. Rivera-Pomar R, J¨ackle H. 1996. From gradients to stripes in Drosophila embryogenesis: filling in the gaps. Trends Genet. 12:478–483. Saffman EE, Lasko P. 1999. Germline development in vertebrates and invertebrates. Cell Mol Life Sci. 55:1141–1163. Schr¨oder R. 2003. The genes orthodenticle and hunchback substitute for bicoid in the beetle Tribolium. Nature 422:621–625. Simpson-Brose M, Treisman J, Desplan C. 1994. Synergy between the hunchback and bicoid morphogens is required for anterior patterning in Drosophila. Cell 78:855–865. St Johnston D, N¨usslein-Volhard C. 1992. The origin of pattern and polarity in the Drosophila embryo. Cell 68:201–219. Stauber M, Prell A, Schmidt-Ott U. 2002. A single Hox3 gene with composite bicoid and zerkn¨ullt expression characteristics in non-Cyclorrhaphan flies. Proc Natl Acad Sci 99:274–279. ¨ Tautz D, Lehmann R, Schurch H, Shuh R, Seifert E, Kienlin A, Jones K, J¨ackle H. 1987. Finger protein of novel structure encoded by hunchback, a second member of the gap class of Drosophila segmentation genes. Nature 327:383–389. Wolff C, Sommer R, Schr¨oder R, Glaser G, Tautz D. 1995. Conserved and divergent expression aspects of the Drosophila segmentation gene hunchback in the short germband embryo of the flour beetle Tribolium. Development 121:4227–4236.
Archives of Insect Biochemistry and Physiology
Hunchback IS REQUIRED FOR ABDOMINAL IDENTITY SUPPRESSION AND GERMBAND GROWTH IN THE PARTHENOGENETIC EMBRYOGENESIS OF THE PEA APHID, Acyrthosiphon pisum Jianjun Mao, Changyan Liu, and Fanrong Zeng Key Laboratory of Integrated Pest Management in Crops, Ministry of Agriculture, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, People’s Republic of China
Aphid, a short germband insect, displays an embryogenesis different from that of long germband insect species. Furthermore, the development of its parthenogenetic and viviparous embryo is different from that of the embryo resulting from sexual reproduction. To better understand the genetic regulation of this type of embryogenesis, the functions of hunchback in asexual Acyrthosiphon pisum were investigated by parental RNAi. Microinjection of Aphb double-stranded RNA yielded several defective phenotypes. Quantitative real-time PCR analysis revealed that these defects resulted from reduction of Aphb mRNA level in injected aphids. All these results suggested that the hb gene in parthenogenetic and viviparous Acyrthosiphon pisum was involved in abdominal identity suppression C 2013 and germband growth as its homologue does in sexual insects. Wiley Periodicals, Inc. Keywords: RNAi; Acyrthosiphon pisum; Double-stranded RNA; hunchback; embryogenesis
Grant sponsor: National Basic Research Program of China (973 Program); Grant number: 2013CB127602; Grant sponsor: NSFC; Grant number: 31201570. Correspondence to: Fanrong Zeng, Key Laboratory of Integrated Pest Management in Crops, Ministry of Agriculture, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Yuanmingyuan West Road 2, Beijing 100193, People’s Republic of China. Email: [email protected] ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 84, No. 4, 209–221 (2013) Published online in Wiley Online Library (wileyonlinelibrary.com). C 2013 Wiley Periodicals, Inc. DOI: 10.1002/arch.21137
210
r
Archives of Insect Biochemistry and Physiology, December 2013
INTRODUCTION One of the most notable achievements in Drosophila melanogaster embryogenesis is the specification of the anterior–posterior (A–P) axis by the asymmetric location of bicoid (bcd) and oskar (osk) mRNAs to the opposite end of the developing oocyte (St Johnston ¨ and Nusslein-Volhard, 1992; Riechmann and Ephrussi, 2001). In long germband insects such as Drosophila, all of the body segments are specified early and simultaneously during the blastoderm stage (St Johnston and N¨usslein-Volhard, 1992). But in short or intermediate germband segmentation, only the anteriormost segments are specified during the blastoderm stage, and the rest of the body plan is specified later (French, 2001; Davis and Patel, 2002). The embryological differences between short and long germ segmentation imply molecular differences in patterning. The roles of a few early developmental genes involved in anteroposterior axis specification have become the focus for understanding these differences. In the dipteran Drosophila, the anterior axial patterning is largely established by bcd, a rapidly evolving maternal-effect gene (Riechmann and Ephrussi, 2001). The gap genes hunchback (hb) and orthodenticle (otd) are downstream targets of bcd (Driever ¨ and Nusslein-Volhard, 1989; Gao and Finkelstein, 1998). Synergy between the bcd and hb is responsible for activation of otd, ems, and btd (Simpson-Brose et al., 1994). But the bcd gene seems to be an innovation of the higher dipterans because its homologues have not been isolated in other insects such as Acyrthosiphon pisum. In insects lacking bcd, anterior specification instead relied on a synergistic interaction between maternal hb and orthodenticle (Saffman and Lasko, 1999; Stauber et al., 2002; McGregor, 2005). In Drosophila, the gap genes play a central role in the early subdivision of the blastoderm into broad regions, each of which will eventually encompass several adjacent body ¨ segments (Hulskamp and Tautz, 1991; Rivera-Pomar and J¨ackle, 1996). The gap gene hb, which codes for a zinc-finger containing transcription factor, is a key regulatory gene in ¨ the anteroposterior patterning in a number of insects (Jurgens et al., 1984; Lehmann and ¨ Nusslein-Volhard, 1987; Tautz et al., 1987; Patel et al., 2001; Liu and Kaufman, 2004). hb expression can be provided maternally and zygotically. The maternal RNA is distributed homogeneously in the embryo and is under the control of the posterior maternal factor nanos (nos). The zygotic expression of hb is regulated by the anterior maternal gene bcd (Wolff et al., 1995). In Drosophila, loss-of-function alleles for hb cause defects in the anterior region, including deletions of gnathal and thoracic segments (Tautz et al., 1987; Finkelstein and Perrimon, 1990). The single depletion of maternal and zygotic hb by parental RNAi leads to deletion in the head and thorax in Tribolium, transformation of anterior segments, and loss of posterior region in Nasonia (Lynch et al., 2006; Marques-Souza et al., 2008). Knockdown of both hb and otd, another gap gene, results in failure to develop the head, thorax and anterior abdomen (Lynch et al., 2006). In the milkweed bug Oncopeltus, the hb (Of’hb) RNAi depletion results in transformations of gnathal and thoracic regions into an abdominal identity, as well as impaired posterior elongation and segmentation (Liu and Kaufman, 2004). Although different functional roles have been ascribed to hb in different insects, the core elements, including the role in specifying anterior borders of Hox gene expression and interactions with other gap genes, seem to be conserved in all insects (Marques-Souza et al., 2008). Aphid, a short germ-band insect, shows divergent adult phenotypes and divergent modes of embryonic development at different times in their complex life cycle. The parthenogenetic mode, which is reinforced by viviparity and the telescoping of generations, allows aphid to reproduce so as to colonize new host plants as soon as possible. Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
211
In contrast, the development of the embryo within the sexual egg is slow and similar to the classical hemipteran mode of development (Miura et al., 2003). A comparison of parthenogenetic and sexual embryogenesis of the pea aphid A. pisum revealed that the primary difference between them is the scale on which development occurs. Early development of the parthenogenetic egg occurs in a volume approximately three orders of magnitude smaller than the sexual egg because yolk is absent in the parthenogenetic egg. In addition, both the developmental rate and the function of the serosa diverged between the two types of embryos (Miura et al., 2003). All these suggested that the two embryos utilize different or variant patterning systems, especially in the early stages of development. To gain insight into the genetic basis in the embryogenesis of parthenogenetic and viviparous pea aphid, we investigated the functions of the Aphb using maternal RNAi mediated by dsRNA microinjection. The knockdown of Aphb mRNA resulted in several classes of nymphs with different severity of body defect. By analyzing these defective phenotypes, we inferred that the Aphb gene is involved in suppression of abdominal identity in the gnathal and thoracic regions, and in growth of germband.
MATERIALS AND METHODS Insects The pea aphids (A. pisum) kindly provided by Zhang fan of Beijing Academy of Agriculture and Forestry Sciences (BAAFS) were reared on broad bean plants at 26–27◦ C under a light : dark regimen of 16 : 8 h in the greenhouse. New broad bean seedlings were provided once a week.
Aphb dsRNA synthesis R The dsRNAs were synthesized in vitro using MEGAscript RNAi Kit (Ambion, Austin, TX). Total RNA was extracted from single adult using Tranzol reagents (Transgene, Beijing, China). DNA contaminations were removed by digesting RNA solution with DNase (Ambion). cDNA was synthesized using TransScript First-Strand cDNA Synthesis SuperMix (Transgene) with anchored Oligo(dT)18 primer. T7 primers (T7 promoter plus exon specific sequence) were designed according to the Instruction Manual of R RNAi Kit to get a partial coding fragment of 524 bp (251–774 bp) the MEGAscript containing the conserved motifs MF1–4 and C-box sequence. PCR products were purified using TIANgel Midi Purification Kit (Tiangen, Beijing, China) and then sequenced. The obtained Aphb target-sequence shows a 95% identity with GQ144356.2 (883 bp-1406 bp) in GenBank. After synthesis by using the purified PCR product as template, the dsRNA was treated with DNase/RNase to digest template DNA and any ssRNA that did not anneal. Then, the purified dsRNA was quantified spectrophotometrically at 260 nm, subjected to agarose gel electrophoresis to determine purity and integrity and stored at −80◦ C before use. EGFP (GenBank Accession Number: CVU55761) dsRNA was also synthesized as above procedures with EGFP specific primers (T7 promoter plus EGFP specific sequence) and served as a control in microinjection (Liu et al., 2010). Primers used in the dsRNA synthesis for amplification of the target gene are shown in Table 1.
Archives of Insect Biochemistry and Physiology
212
r
Archives of Insect Biochemistry and Physiology, December 2013
Table 1. Primers Used in the Experiments Gene
PCR type
Aphb
RT-PCRa
EGFP
Real-time PCRb RT-PCRa
RpL7 Real-time PCRb a b
Forward
Reverse
TAATACGACTCACTATAGGG CTGGCACTGGTGGAAATA GCACATTCGCACTCACATCAAA TAATACGACTCACTATAGGG CCACAAGTTCAGCGTGTCCG GCGCGCCGAGGCTTAT
TAATACGACTCACTATAGGG TTGCTGATACGGGTTGTG TGGTTCAGCAGGTGGTATTCGT TAATACGACTCACTATAGGG AAGTTCACCTTGATGCCGTTC CCGGATTTCTTTGCATTTCTTG
Fragment size (bp) 564 102 463 81
Primers used in dsRNA synthesis for amplification of the target fragments. Primers used in qRT-PCR for mRNA level detection of different genes.
Aphb dsRNA injection Nymph-laying adults were used for injection in the experiments and the injection volume was 120 nl. Before injection, 1% agarose gel plate was prepared and narrow channels were made on the gel. Aphids were immobilized in the channels using a writing brush with abdomen airward. The concentration of dsRNA solution was 1.6 mg/ml. Injection was performed at two sites: the conjunctive between the first and second abdominal segments; the conjunctive between the fourth and fifth abdominal segments. A second microinjection was also performed for adults 24 h following the first injection to obtain a higher RNAi efficiency. At lease 50 aphids were injected at adult stage for each gene. R NI 2 and FemtoJet express Microinjectors system (Eppendorf, Eppendorf InjectMan Hamburg, Germany) with glass needles was adopted to conduct injection in 0.3 sec under a pressure of 500 mP. Injection was performed cautiously and the needle point was sure to be away from inside embryos. Injected insects were reared separately on new seedlings grown at 26◦ C, 75% relative humidity, and 16/8 h light/dark cycle. Quantitative real-time PCR To investigate the expression profile of Aphb at different developmental stages, total RNAs were isolated from pooled nymphs or single adult using Tranzol reagents (Transgene). To monitor Aphb mRNA level post dsRNA injection, three individuals which laid the most number of defective nymphs were collected at each time point from 1 to 8 days post injection and total RNAs were extracted form single injected adult. DNA contaminations were removed by treating RNA solution with DNase (Ambion). cDNA was synthesized using TransScript First-Strand cDNA Synthesis SuperMix (Transgene) with anchored Oligo(dT)18 primer. qRT-PCR was performed using a 25 μl total volume conR Green Real-time PCR taining cDNA produced from 2 μg total RNA, 11.25 μl of SYBR Master Mix (TOYOBO, Japan) and 200 nM each of forward and reverse Aphb specific primers. Primers used in the qRT-PCR for mRNA level detection are shown in Table 1. The PCR was processed on an IQ-5 Real-Time System (Bio-Rad) under the following program: one cycle of 95◦ C for 60 s; then 40 cycles of 95◦ C for 15 s, 60◦ C for 15 s and 72◦ C for 45 s. The melting curve was established from 55 to 95◦ C. Standard curves were constructed using serial dilutions of the cDNAs of single uninjected adult. Three technical replicates of each reaction were performed and Ribosomal protein L7 (RpL7) (GenBank Accession Number: NM 001135898.1), a continuously expressed gene, was used as internal control for normalization (Jaubert-Possamai et al., 2007). Threshold Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
213
Figure 1. Identification of dsRNA synthesized in vitro T7 primers was designed according to the Instruction R Manual of the MEGAscript RNAi Kit and Aphb mRNA (GenBank Accession Number: GQ144356.2) to get a partial coding fragment 524 bp of the Aphb and an EGFP fragment of 423 bp. About 1 μg of the purified Aphb or EGFP dsRNA was loaded onto a 1% agarose gel stained with ethidium bromide and photographed. M, 250 bp ladder molecular weight marker; hb, Aphb dsRNA; EGFP, EGFP dsRNA.
cycle values were used for the further analysis. Means and standard errors for each time point were obtained from the average of three independent sample sets. Quantification of the relative changes in gene transcript level was performed according to the 2−Ct method (Livak and Schmittgen, 2001). Compared to samples injected with EGFP dsRNA, the reduction (%) of Aphb expression levels was calculated in the samples injected with Aphb dsRNA and was used to evaluate RNAi efficiency.
RESULTS Verification of dsRNA synthesized in vitro The synthesized dsRNA was quantified spectrophotometrically at 260 nm, and then subjected to agarose gel electrophoresis to determine purity and integrity (Fig. 1). Parental RNAi of Aphb Because aphids used for injection have reached the adult stage, they began to lay nymphs in several hours after injection. But, progeny born at the first day post injection did Archives of Insect Biochemistry and Physiology
214
r
Archives of Insect Biochemistry and Physiology, December 2013
Figure 2. Ratio of defective nymphs laid by Aphb dsRNA injected adults. Nymph-laying adults (7-day old) were injected with Aphb dsRNA once or twice. The second injection was conducted after 24 h following the first injection. Newborn nymphs were scored for defects and ratio of defective nymphs born in each day was calculated. Values are means of three independent experiments.
not show any defects. When Aphb dsRNA injection was conducted only once, newborn nymphs with light defects were observed 2 days post injection. The typical phenotype was disruption of thoracic appendages. The RNAi effect endured only 4 days without a vivid increase or peak (Fig. 2) and few nymphs showed severe defects during this period. In order to achieve higher RNAi efficiency, adult aphids were microinjected twice at an interval of 1 day. We got good penetration efficiency and similar range of phenotypes using this method when compared with parental RNAi performed in other sexual insects. 2 days after injection, part of the injected adults began to produce nymphs with slight segmentation defects. The number of defective progeny and the severity of defects increased gradually in the following several days, reached a peak 6 days post the first injection and then decreased rapidly after that (Fig. 2). Double injection conducted at two abdominal sites at adult stage was proved efficient for studying the hb function in A. pisum aphids. Phenotypes obtained after injection Parental RNAi of Aphb resulted in phenotypes that ranged in severity from wild to severe types. Wild-type neonate (Fig. 3A1 and A2) was served as a reference to determine the class of nymphs laid by the injected mothers. Based on the range of defects severity, the newborn nymphs were categorized into four phenotypic classes (Table 2). The most severe class I nymphs comprised 1.7% of total newborn nymphs. In this phenotype, T1, T2, T3 legs were completely depleted and the head was followed by reduced segments without appendages. Eyes were identifiable. But antennas and labium were obscure and could not be identified. Because the body segments were reduced, this class of nymphs looked apparently shorter and smaller than wild-type ones (Fig. 3D1 and D2). Class II nymphs made up 3.3% of the total newborn nymphs. Gnathal and thoracic segments were less disturbed in class II than in class I, but still strongly transformed toward abdomen. Labium and all thoracic appendages were seriously suppressed in class II nymphs, except for vestigial legs in the T3 segment. In this class of nymphs, a Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
215
Figure 3. Aphb RNAi phenotypes. (A1, B1, C1, D1): Ventral view. (A2, B2, C2, D2): Dorsal view. (A1-A2): Nymphs laid by uninjected adults. Anterior toward the left. Thoracic and abdominal regions are delineated. AN: antenna; LB: labium; T1: first thoracic leg; T2: second thoracic leg; T3: third thoracic leg. (B1-B2): Class III nymphs. The distal region of the T1 leg seemed fused to the abdominal segments and was difficult to distinguish. T2 and T3 legs were less strongly affected, but also developed minor defects such as abnormal folding of the distal articles and fusion of the far ends of the two antennas. In addition, thoracic segmentation was somewhat obscure. (C1–C2): Class II nymph. Cephalic and thoracic appendages were seriously suppressed. T1 and T2 legs were missing. But T3 leg was dramatically reduced and often located near the posterior segments. Abdomen was twisted. (D1–D2): Class I nymphs. T1, T2, and T3 legs were all missing. Eyes (EY) developed. But antennas and labium could not be identified. This class of nymphs showed less body segments and looked apparently shorter than wild-type ones.
short posterior leg was often located near the posterior segments and seemed a partially suppressed remnant of the third thoracic leg (Fig. 3C1 and C2). Class III nymphs comprised 4.0% of total nymphs. These nymphs always showed mildly suppressed thoracic segmentation with light defects in appendages. Among the thoracic legs, the T1 legs were most frequently affected and especially the distal region seemed Archives of Insect Biochemistry and Physiology
216
r
Archives of Insect Biochemistry and Physiology, December 2013
Table 2. Results of Parental Aphb RNAi Days post injection (dpi) 1 2 3 4 5 6 7 8 Total
Total nymphs (n)
Class 1
Class II
Class III
Class IV
Wild-type
309 302 281 292 317 310 330 313 2,454
0(0) 0(0) 4(1.4) 9(3.1) 13(4.1) 12(3.9) 3(1.0) 0(0) 41(1.7)
0(0) 3(1.0) 9(3.2) 15(5.1) 21(6.6) 21(6.8) 12(3.6) 0(0) 81(3.3)
0(0) 5(1.7) 10(3.6) 22(7.5) 25(7.9) 27(8.7) 8(2.4) 0(0) 97(4.0)
0(0) 4(1.3) 8(2.8) 13(4.5) 16(5.0) 17(5.5) 7(2.1) 0(0) 65(2.6)
309(100) 290(96.0) 250(89.0) 233(80.0) 242(76.3) 233(75.2) 300(90.9) 313(100) 2170(88.4)
Fifty-two initial adults were injected. Results show number of nymphs of given phenotypic class with percentages in parentheses.
fused to the abdominal segments and could not be distinguished from the abdomen. Abnormal folding of the thoracic legs was also observed in this phenotype. In addition, the far ends of the two antennas were always fused together and could not be separated (Fig. 3B1 and B2). Class IV nymphs made up 2.6% of the total progenies. In this phenotype, the segments and appendages showed no identifiable defects. These nymphs were still alive after birth, but died soon in a few hours (data not shown). This phenotype was also observed in offspring of the EGFP dsRNA injected group and the ratio was about 2.3%. Based on above defective phenotypes, we built a model to demonstrate the function of Aphb (Fig. 4). With the reinforcement of Aphb depletion, antennae, labium and thoracic legs were increasingly reduced and the anterior region gradually transformed toward abdominal identity. At the same time, the abdominal segments were increasingly compacted and the most defective animals looked significantly shorter than wild-type ones. Silencing of Aphb The RNAi efficiency on Aphb expression in injected adults was analyzed by qRT-PCR from the first day to the eighth day after the injection. The common ribosomal RpL7 was chosen as the reference gene to calculate relative expression levels of target gene in the qRT-PCR analysis. The reduction (%) of Aphb expression levels was used to evaluate RNAi efficiency. When microinjection was performed only once, the Aphb transcripts were reduced slightly (6.5% ± 1.0) 2 day post injection. The maximum reduction of 15.2±2.0% in Aphb transcripts level occurred at the third day after injection. When a second injection was conducted after 24 h following the first injection, the Aphb transcripts was reduced by 10.1 ± 1.3% 2 days after the first injection. The maximum efficiency of 38.3 ± 6.9% was observed 6 days post injection (Fig. 5). These results indicated that the dsRNA injection reduced Aphb expression in adult pea aphids.
DISCUSSION So far, the functions of insect hb gene in sexual reproduction have been studied in several insect species, including dipteran Drosophila, coleopteran Tribolium, hemipteran Oncopeltus, Orthoptera Gryllus etc. (Lehmann and N¨usslein, 1987; Schr¨oder, 2003; Liu Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
217
Figure 4. Diagram of the parental effect of Aphb RNAi on asexual embryogenesis. Aphb transcripts depletion resulted in two effects on embryogenesis of the pea aphid. The first effect was gradual transformation of the anterior segments to abdominal identity. Body defects, including the suppression of the formation of antennae (Ant) and thoracic legs (T1–T3), became more and more severe with the increase of Aphb depletion. The second effect of the Aphb depletion was the compaction of abdominal region. In the most defective phenotypes, the abdominal segments were obviously reduced and nymphs looked apparently shorter and smaller than wild-type ones.
and Kaufman, 2004; Mito et al., 2005). Here, we first reported the knockdown of hb gene in parthenogenetic and viviparous insect by parental RNAi. Microinjection of doublestranded RNA targeted to the conserved motifs MF1–4 and C-box sequence of the Aphb yielded several classes of defective phenotypes. In a previously RNAi experiment, a downstream Aphb fragment (1,180–1,676 bp) was also selected as RNAi target sequence. Similar range of defects was obtained and slightly lower depletion efficiency was observed after downstream dsRNA injection (data not shown). Though the RNAi efficiency was not high and Aphb knockdown was not confirmed by in situ hybridization, these two RNAi tests made us confident that the obtained phenotypes were resulted from depletion of the Aphb transcripts. Among the sexual insects, in which the functions of hb have been elucidated, the Hemiptera O. fasciatus is phylogenetically closest to the pea aphid. In the most severe class of embryos after Of’hb knockdown, eyes developed and the anterior segmentation was apparent. But the posterior segmentation was defective and the postmaxillary body Archives of Insect Biochemistry and Physiology
218
r
Archives of Insect Biochemistry and Physiology, December 2013
Figure 5. Knockdown of the Aphb Adult pea aphids were injected with Aphb dsRNA once or twice. The second injection was performed 1 day post the first injection. Aphb mRNA reduction (%) in injected adults was analyzed by qRT-PCR to evaluate RNAi efficiency. The ribosomal RpL7 was used as internal control for normalization. Each kinetic point was performed in triplicate on three adults and values were expressed as mean ± SE of three replicates.
was composed of fewer and smaller segments and adopted an abdominal identity (Liu and Kaufman, 2004). This class of embryos is similar with the combination phenotype resulted from transformation of anterior segments and loss of posterior region in Tribolium castalium hb depletion (Marques-Souza et al., 2008). Because similar defects were also observed in the class I phenotype of Aphb depletion, we inferred that this class might also conform to the thoracic transformation phenotype. At every stage of the A. pisum embryogenesis, the developmental progress of body segments and appendages has been specified by Miura et al. (2003), and the accumulation region and abundance of the Aphb mRNA in the embryo has also been identified by Huang et al. (2010). We inferred that germband of the class I embryos failed to elongate and cephalic region was not specified properly because of the depletion of the Aphb transcripts at the anterior region of the embryo and in the gnathos (Huang et al., 2010). The consequence was severe suppression of the cephalic appendages, thoracic limb bud, and body segments. The medium phenotypes with moderate RNAi defects obtained after the hb depletion in A. pisum and O. fasciatus were similar. Both of them showed suppressed and deformed labium and appendages, gradual transformation of the thoracic region toward abdominal identity. Furthermore, either in depletion of Aphb or knockdown of Of’hb, the third thoracic legs were most resistant to the hb disruption. We inferred that defects in the cephalic and thoracic appendages in the present medium phenotypes were resulted from disruption of the Aphb transcripts in head region. The class III nymphs showed no strong defects except the mildly defective first thoracic legs and slightly obscure segmentation in the thoracic region. This class of phenotype is similar to the class I embryos (the weakest phenotype) in Of’hb depletion. Aside from defects in the first thoracic legs, this class of phenotype showed strong suppression of the labium. We are not certain if this kind of defect existed in the class III phenotype of Aphb RANi, because the labium was buried by the antenna and thoracic legs after birth. The class IV nymphs showed no identifiable defects in segments and appendages, just like the undeveloped or nonspecific classification reported in O. fasciatus (Liu and Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
219
Kaufman, 2004). These nymphs were still alive, but not energetic after birth. They could just contract abdominal segments and stretch out appendages occasionally and slowly, and died in a few hours. This class of nymphs probably developed uninterpretable defects, or injured in the microinjection experiment, as it was also observed in offspring of the EGFP dsRNA injected group. Another explanation is that Aphb plays crucial functions in central nerves system (CNS) development. Aside from the roles in segment patterning, hb is also an important player in sequential cell fate specification within the Drosophila CNS. It is expressed in the early sublineage of NB7–3 and is needed for the specification and/or maintenance of the early-born neurons (Novotny et al., 2002). It is likely that depletion of Aphb disrupted the development of nerves system of the embryos. So far, different functional roles have been ascribed to hb in different insect species. The core components are conserved among insects and represent the ancestral type of embryogenesis, while additional features are late evolutionary acquisitions and only emerged in higher Diptera (Marques-Souza et al., 2008). Based on analysis of the obtained phenotypes, we inferred that hb in parthenogenetic and viviparous Acyrthosiphon pisum possesses at least following conserved functions. (1) Aphb is required for suppression of abdominal identity in the gnathal and thoracic regions. From the weakest phenotypic class IV to the most severe phenotypic I, we can see a gradually suppression of the gnathal and thoracic appendages and a vivid transformation of the anterior regions to abdominal identity. (2) Aphb is involved in germband elongation. This was also implied by the class I phenotype, in which the abdominal segments were seriously suppressed. As phenotypic effects are always a combination of depletion of the gene itself and changes in downstream genes, further work is needed to elucidate interactions of the Aphb with other gap genes. RNA interference (RNAi) is a powerful weapon to inhibit gene expression in a sequence specific manner. RNAi mediated by microinjection of dsRNA was usually adopted to elucidate the hb function in Drosophila, Nasonia, and Tribolium (Schr¨oder, 2003; Lynch et al., 2006). RNAi efficiency seems to be highly variable according to insect species, targeted gene, injection stage, and dsRNA concentration etc. When double injection was performed in present study and each adult was injected a total volume of 240 nl at a concentration of 1.6 mg/ml, only about 12% of total nymphs born in 8 days developed body defects. Higher depletion efficiency is maybe expected if the concentration of dsRNA is elevated. It has been reported that both parental RNAi by dsRNA injection into female pupas and embryonic RNAi by dsRNA injection into eggs were feasible to knockdown the hb expression. In the present study, injection of Aphb dsRNA performed at nymph stage failed to induce defects in progeny. Similar phenomenon has been reported in other insect species and one of the well-known is D. melanogaster, for which dsRNA triggered RNAi in adults, but in larvae it failed to penetrate most tissues with the exception of hemocytes (Dzitoyeva et al., 2001; Goto et al., 2003; Miller et al., 2008). Based on these reports, we found the following: (1) penetration efficiency of the injected Aphb dsRNA is low in pea aphids; (2) A. pisum nymphs are not as sensitive as adults to the injected hb dsRNA. It is no wonder that no nymphs born at the first day after injection showed defects. One explanation is that these embryos are mature and have laid down their chorions. Thus the embryos are impenetrable to the injected dsRNA. Another reason is that the penetrance of injected dsRNA is low in A. pisum nymphs.
Archives of Insect Biochemistry and Physiology
220
r
Archives of Insect Biochemistry and Physiology, December 2013
ACKNOWLEDGMENTS We thank Zhang Fan of Beijing Academy of Agriculture and Forestry Sciences for presentation of pea aphid clones.
LITERATURE CITED Davis GK, Patel NH. 2002. Short, long, and beyond: molecular and embryological approaches to insect segmentation. Annu Rev Entomol 47:669–699. Driever W, N¨usslein-Volhard C. 1989. The bicoid protein is a positive regulator of hunchback transcription in the early Drosophila embryo. Nature 337:138–143. Dzitoyeva S, Dimitrijevic N, Manev H. 2001. Intra-abdominal injection of double-stranded RNA into anesthetized adult Drosophila triggers RNA interference in the central nervous system. Mol Psychiatry 6:665–670 Finkelstein R, Perrimon N. 1990. The orthodenticle gene is regulated by bicoid and torso and specifies Drosophila head development. Nature 346:485–488. French V. 2001. Insect segmentation: genes, stripes and segments in ‘Hoppers’. Curr Biol 11:910– 913. Gao Q, Finkelstein R. 1998. Targeting gene expression to the head: the Drosophila orthodenticle gene is a direct target of the bicoid morphogen. Development 125:4185–4193. Goto A, Blandin S, Royet J, Reichhart JM, Levashina EA. 2003. Silencing of toll pathway components by direct injection of double-stranded RNA into Drosophila adult flies. Nucleic Acids Res 31:6619–6623. Huang T, Cook CE, Davis GK, Shigenobu S, Chen RPY, Chang C. 2010. Anterior development in the parthenogenetic and viviparous form of the pea aphid, Acyrthosiphon pisum: hunchback and orthodenticle expression. Insect Mol Biol 19:75–85. ¨ Hulskamp M, Tautz D. 1991. Gap genes and gradients-the logic behind the gaps. BioEssays 13:261– 268. Jaubert-Possamai S, Trionnaire GL, Bonhomme J, Christophides GK, Rispe C, Tagu D. 2007. Gene knockdown by RNAi in the pea aphid Acyrthosiphon pisum. BMC Biotechnol 7:63. ¨ Jurgens G, Wieschaus E, N¨usslein-Volhard C, Kluding H. 1984. Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. Roux’s Arch Dev Biol 193:283–295. ¨ Lehmann R, Nusslein-Volhard C. 1987. hunchback, a gene required for segmentation of an anterior and posterior region of the Drosophila embryo. Dev Biol 119:402–417. Liu P, Kaufman TC. 2004. Hunchback is required for suppression of abdominal identity, and for proper germband growth and segmentation in the intermediate germband insect Oncopeltus fasciatus. Development 131:1515–1527. Liu S, Ding Z, Zhang C, Yang B, Liu, Z. 2010. Gene knockdown by intro-thoracic injection of double-stranded RNA in the brown planthopper, Nilaparvata lugens. Insect Biochem Mol Biol 40:666–671. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−Ct method. Methods 25:402–408. Lynch JA, Brent AE, Leaf DS, Pultz MA, Desplan C. 2006. Localized maternal orthodenticle patterns anterior and posterior in the long germ wasp Nasonia. Nature 439:728–732. Marques-Souza H, Aranda M, Tautz D. 2008. Delimiting the conserved features of hunchback function for the trunk organization of insects. Development 135:881–888. McGregor AP. 2005. How to get ahead: the origin, evolution and function of bicoid. Bioessays 27:904–913. Archives of Insect Biochemistry and Physiology
Functions of Hunchback in Parthenogenetic Pea Aphid
r
221
Miller SC, Brown SJ, Tomoyasu Y. 2008. Larval RNAi in Drosophila? Dev Genes Evol 218:505–510. Mito T, Sarashina I, Zhang H, Iwahashi A, Okamoto H, Miyawaki K, Shinmyo Y, Ohuchi H, Noji S. 2005. Non-canonical functions of hunchback in segment patterning of the intermediate germ cricket Gryllus bimaculatus. Development 132:2069–2079. Miura T, Braendle C, Shingleton A, Sisk G, Kambhampati S, Stern DL. 2003. A comparison of parthenogenetic and sexual embryogenesis of the pea aphid Acyrthosiphon pisum (Hemiptera: Aphidoidea). J Exp Zool 295B:59–81. Novotny T, Eiselt R, Urban J. 2002. Hunchback is required for the specification of the early sublineage of neuroblast 7–3 in the Drosophila central nervous system. Development 129, 1027–1036. Patel NH, Hayward DC, Lall S, Pirkl NR, DiPietro D, Ball EE. 2001. Grasshopper hunchback expression reveals conserved and novel aspects of axis formation and segmentation. Development 128, 3459–3472. Riechmann V, Ephrussi A. 2001. Axis formation during Drosophila oogenesis. Curr Opin Genet. Dev 11:374–383. Rivera-Pomar R, J¨ackle H. 1996. From gradients to stripes in Drosophila embryogenesis: filling in the gaps. Trends Genet. 12:478–483. Saffman EE, Lasko P. 1999. Germline development in vertebrates and invertebrates. Cell Mol Life Sci. 55:1141–1163. Schr¨oder R. 2003. The genes orthodenticle and hunchback substitute for bicoid in the beetle Tribolium. Nature 422:621–625. Simpson-Brose M, Treisman J, Desplan C. 1994. Synergy between the hunchback and bicoid morphogens is required for anterior patterning in Drosophila. Cell 78:855–865. St Johnston D, N¨usslein-Volhard C. 1992. The origin of pattern and polarity in the Drosophila embryo. Cell 68:201–219. Stauber M, Prell A, Schmidt-Ott U. 2002. A single Hox3 gene with composite bicoid and zerkn¨ullt expression characteristics in non-Cyclorrhaphan flies. Proc Natl Acad Sci 99:274–279. ¨ Tautz D, Lehmann R, Schurch H, Shuh R, Seifert E, Kienlin A, Jones K, J¨ackle H. 1987. Finger protein of novel structure encoded by hunchback, a second member of the gap class of Drosophila segmentation genes. Nature 327:383–389. Wolff C, Sommer R, Schr¨oder R, Glaser G, Tautz D. 1995. Conserved and divergent expression aspects of the Drosophila segmentation gene hunchback in the short germband embryo of the flour beetle Tribolium. Development 121:4227–4236.
Archives of Insect Biochemistry and Physiology
