Original Paper Received: April 3, 2013 Accepted after revision: October 18, 2013 Published online: March 1, 2014
Neuroimmunomodulation 2014;21:221–225 DOI: 10.1159/000356522
FADD Is Upregulated in Relapsing Remitting Multiple Sclerosis Reinhard Reuss a, c Marta Mistarz c Andreas Mirau c Jörg Kraus e Rolf-Hasso Bödeker d Patrick Oschmann b
a
Department of Neurology, Bezirkskrankenhaus Bayreuth, and b Department of Neurology, Hospital Hohe Warte, Bayreuth, and Departments of c Neurology and d Medical Informatics, Justus Liebig University Giessen, Giessen, Germany; e Paracelsus Medical University and Salzburger Landeskliniken, Christian-Doppler-Klinik, University Hospital of Neurology, Salzburg, Austria
Abstract Objective: To elucidate the role of tumor necrosis factor (TNF) receptor signal transduction in multiple sclerosis (MS). Methods: We performed a cross-sectional analysis of the gene expression of TNF receptor-associated death domain protein (TRADD) and Fas-associated death domain protein (FADD) in peripheral blood leukocytes of 23 relapsing remitting (RR), 19 secondary progressive (SP) and 12 primary progressive (PP) MS patients, as well as of 29 healthy controls by quantitative RT-PCR. Additionally, we monitored a subgroup of 15 RR MS patients longitudinally every 3 months over the time period of 9 months. Results: FADD expression was significantly elevated in RR MS patients compared to the other disease courses (p < 0.048). The median of FADD expression was elevated in the RR MS patient groups compared to the healthy group, but this was not significant (p < 0.053). The median of TRADD expression was elevated in the patient groups compared to the healthy group, but this was not significant (p < 0.14). Neither variable changed significantly over the time course of 9 months. Conclusion: FADD eleva-
© 2014 S. Karger AG, Basel 1021–7401/14/0215–0221$39.50/0 E-Mail [email protected] www.karger.com/nim
tion in leukocytes might be interpreted as the molecular equivalent of an elevated general inflammatory activity in RR MS patients compared to other disease courses. FADD elevation in RR MS reinforces the concept that different pathophysiological and immunological processes sustain RR MS and SP or PP MS. © 2014 S. Karger AG, Basel
Introduction
During the acute phase of experimental autoimmune encephalomyelitis (EAE) in mice, an increase in the number of tumor necrosis factor (TNF)-α-positive cells is detected in the central nervous system (CNS) [1]. The TNF receptors 1 and 2 (TNF-R1, TNFRSF1A; TNF-R2, TNFRSF1B) expressed specifically in the tissue can mediate both apoptosis and inflammation [2]. The TNF-R1
Reinhard Reuss received consultancy fees from Janssen-Cilag. Jörg Kraus received personal compensation from Bayer, Biogen-Idec, Merck, Novartis, Sanofi-Aventis for consulting services, and financial support for research activities from Bayer, Biogen-Idec, Genzyme, Merck-Serono, Novartis and Sanofi-Aventis. Patrick Oschmann received grants and consultancy fees from Novartis, Bayer, Teva, Sanofi-Aventis, Merck Serono and ZLB.
Dr. Reinhard Reuss, MD Department of Neurology, BKH Bayreuth, Nordring 2 DE–95445 Bayreuth (Germany) E-Mail reinhard.reuss @ neuro.med.uni-giessen.de
Downloaded by: NYU Medical Center Library 128.122.253.212 - 2/19/2015 4:26:25 PM
Key Words Multiple sclerosis · FADD protein · Tumor necrosis factor receptor · TRADD protein
Materials and Methods
sented a relapsing disease course with subsequent progressive clinical deterioration, including reduced walking capability. PP patients had exhibited a progressive clinical deterioration from the very beginning and for at least 1 year. Consent was obtained in accordance with the Declaration of Helsinki after approval from the Ethics Commission at the Medical Faculty, Justus Liebig University of Giessen. Additionally, the 23 patients with clinically verified RR MS [16], who presented at least 1 relapse within the last year, were tested within an open, prospective and nonrandomized design. The healthy control group consisted of 29 individuals. Peripheral blood was obtained from the study objects at baseline and, in the case of the RR MS patients, additionally every 3 months for 9 months, and clinical examination was performed to determine EDSS scores according to Kurtzke [17]. Patients or controls who presented with a relapse inside 2 weeks before or 4 weeks after baseline or the respective visit, and those who had received glucocorticoids within the last 4 weeks or suffered from an infection or elevation of C-reactive protein value or leukocytes in peripheral blood at the respective visit, did not undergo blood sampling. Additionally, no immunomodulatory (such as interferons or glatiramer acetate) or immunosuppressive therapy had been administered within the last 6 months. The control and patient data are specified in table 1. Reverse Transcription Polymerase Chain Reaction Using the QIAmp® RNA Blood Mini Kit (Qiagen, Hilden, Germany), the Thermo-Cycler (Hybaid, Heidelberg, Germany), oligo-dT primers and SuperScript® II (M-MLV) RNase H– reverse transcriptase (200 U/μl; Invitrogen, Karlsruhe, Germany), total RNA was isolated from leukocytes and reverse transcribed into cDNA following the supplier’s standard protocols. As previously described [18], a quantitative real-time RT-PCR (LightCycler; Roche Diagnostics GmbH, Mannheim, Germany) using hybridization probes (Tib Molbiol, Berlin, Germany) and imported standard curves – plasmid standards dissolved in MS2-RNA (10 ng/μl) were obtained from Invitrogen Life Technologies GmbH (Karlsruhe, Germany) – was setup and applied to measure the respective amount of TRADD and FADD mRNA relative to the internal standard porphobilinogen deaminase (NCBI GenBank® accession No. X04808). Forward primers (5′–3′) were GGGTCAGCCTGTAGTGAATCG for TRADD and GAAGAAGACCTGTGTGCAGCATT for FADD. Reverse primers (5′–3′, Tib Molbiol) were GTCCTCTGCCAGGCTGGTG for TRADD and GTTGCGTTCTCCTTCTCTGTGTT for FADD. Donor probes (5′–3′) were GAGACCCACAGAGCGCGCGA-FL for TRADD and TCTGTCCTCGATGCTGTCGATCTTGG-FL for FADD. Acceptor probes (5′–3′) were Red640-CGTCTGTTGGTCCTTCAGGCTCAGC-ph for TRADD and Red640-GTCTGAGACTTTGAGCTGACGAGCCA-ph for FADD, in which FL stands for 5.6-carboxyfluorescein, Red640 for LightCycler Red 640 and ph for the phosphate group. Besides hybridization probes, 20-μl aqueous solutions contained 1.2 or 1.6 μl of MgCl2 (2.5 mM for TRADD and 3 mM for RIP1), 1 μl of forward or reverse primer (0.5 μM), LightCycler FastStart DNA Master HybProbe reaction mix/FastStart Taq polymerase (1×; Roche Diagnostics) and, in the case of TRADD, 1 μl of DMSO (5%). The PCR conditions were: 10 min at 95 ° C, then (initially 8 cycles touchdown from 68 to 60 ° C in steps of 1 ° C) 39 cycles for 10 s at 95 ° C, 10 s at 60 ° C and 20 s at 72 ° C. LightCycler® software 3.5 was used for analysis (Second Derivate Maximum Method; proportional baseline adjustment).
Patients Following written informed consent, 54 patients with RR MS, secondary progressive (SP) and primary progressive (PP) MS were included in a cross-sectional study. SP patients had initially pre-
222
Neuroimmunomodulation 2014;21:221–225 DOI: 10.1159/000356522
Reuss/Mistarz/Mirau/Kraus/Bödeker/ Oschmann
Downloaded by: NYU Medical Center Library 128.122.253.212 - 2/19/2015 4:26:25 PM
death domain joins the TNFR-associated death domain (TRADD) protein [3, 4], an adaptor protein that serves the bifurcation of both these pathways by binding the FAS-associated death domain (FADD) protein and caspases on the one hand, or TNFR-associated factor 2 (TRAF2) and receptor-interacting protein (RIP) and then IκB kinase complex on the other hand [2, 5–7]. Recruiting TRAF2 and RIP to TRADD finally leads to activation of NFκB, triggering an inflammatory response. Additionally, TNFRSF1A binding can activate c-Jun kinase and mitogen-activated protein kinase, MAPK, leading to proliferation. Recruiting FADD to TRADD finally results in apoptosis. New studies have revealed additional roles for FADD in death receptor avidity and cell cycle regulation [8], especially as regards nonapoptotic activities [9]. Various interactions exist between these pathways and pathways involving other members of the TNFRSF. TNF-α binding to TNFRSF1B in the absence of a death domain leads directly to TRAF2 and RIP binding to the receptor, hence resulting in NFκB and MAPK activation. TNFRSF1B appeared merely to be capable of transducing inflammation and for a long time was thought to be only a ligand provider for RSF1A [10]. New studies show that RSF1B appears able to magnify the RSF1A-induced cascade of apoptosis. There might be competition between both receptors for TRAF2, possibly resulting in apoptosis following selective RSF1B stimulation [11]. TNF-R1 signaling is crucial for T cell apoptosis in EAE and plays an exclusive role in oligodendrocyte apoptosis, while TNF-R2 has an independent proinflammatory role in the CNS [12, 13]. In multiple sclerosis (MS), a reduction in leukocyte apoptosis might contribute to enhanced migration of autoreactive T cells into the CNS and perpetuation of inflammation [14], resulting in clinical and subclinical exacerbations. Recently, we have succeeded in demonstrating that in natural history in relapse remitting (RR) MS there is a correlation between the expanded disability status scale (EDSS) score and the TNF-R1 mRNA level in leukocytes [15]. Here, we performed quantitative reverse transcription polymerase chain reaction (RT-PCR) to investigate leukocyte TRADD and FADD expression in MS patients for the first time.
Table 1. Demographic and expression data in healthy controls, and patients with PP, RR and SP MS
Sex Male Female Median age, years EDSS median Disease duration, years Progression index TRADD Median Mean SEM 1st quartile 3rd quartile FADD Median Mean SEM 1st quartile 3rd quartile
Healthy (n = 29)
PP MS (n = 12)
RR MS (n = 23)
SP MS (n = 19)
Homogeneity (p value)
12 (41.38) 17 (58.62) 45 n.a. n.a. n.a.
9 (75) 3 (25) 54 5 7 0.583
6 (26.09) 17 (73.91) 46 1 7 0.143
16 (84.21) 3 (15.79) 50 5 9 0.667
0.0063 (FE test)
1,347 1,744 289 829 2,201
1,561 3,192 1,354 781 2,428
1,996 2,900 543 1,234 2,916
2,058 2,993 684 1,126 4,743
0.14 (median test)
650 1,066 196 561 1,060
628 1,218 396 483 1,207
991 1,039 89 639 1,374
483 983 222 226 1,884
0.053 (median test)
0.0041 (median test) 0.0001 (median test) 0.654 (median test) 0.0001 (median test)
Values in parentheses are percentages. FE test = Fisher’s exact test; n.a. = not applicable; SEM = standard error of the mean.
Results 6,000
Clinical Characteristics Ages differed in the four groups (pglobal < 0.0041; table 1), as did sex (pglobal < 0.0063; table 1). Clinical characteristics were as expected, for example EDSS was considerably lower in the RR MS group than in the SP or PP MS groups (pglobal < 0.0001; table 1; pRR-PP < 0.001; pRR-SP < 0.001; pPP-SP > 0.9).
FADD
4,000 3,000 2,000 1,000 0
G
PP
RR
SP
Fig. 1. Relative FADD mRNA levels in peripheral blood leukocytes at baseline in healthy (G; n = 29), PP (n = 12), RR (n = 23) and SP (n = 19) MS patients. The figure presents box plots showing minimum, maximum, quartiles and medians. Median test: pglobal < 0.053; comparison between MS groups: p < 0.048.
Statistics Fisher’s exact test and median test were applied for the statistical analysis of patient characteristics. Protein expressions were examined using the median test. Spearman’s correlation was used to analyze any influence of disease variables on protein expression and Friedman’s analysis of variance by ranks was performed for longitudinal analysis. Statistical significance was factored in as p < 0.05.
FADD in MS
Cross-Sectional Analysis The median TRADD expression in healthy controls (median 1,347) was lower than in patient groups (medians: RR MS 1,996, SP MS 2,058, PP MS 1,561), yet an elevation in TRADD expression was not significant (p < 0.14). The median FADD expression (fig. 1) in healthy controls (median 650) again was lower than in the RR MS group (medians: RR MS 991, SP MS 483, PP MS 628), yet an elevation in FADD expression was marginally not significant (p < 0.053). By analyzing only the MS groups, the difference was significant (p < 0.048). Longitudinal Analysis As some patients missed at least one visit, it was only possible to perform examination of protein expression over 9 months on 15 RR MS patients, who revealed a mild Neuroimmunomodulation 2014;21:221–225 DOI: 10.1159/000356522
223
Downloaded by: NYU Medical Center Library 128.122.253.212 - 2/19/2015 4:26:25 PM
5,000
Discussion
As previous results had revealed conflicting data on the therapeutic efficacy of TNF inhibition in MS [19], we analyzed for the first time the signal transduction pathway of TNF receptors on the FADD and TRADD mRNA level in order to elucidate the role of TNF receptor signal transduction in MS patients with varied disease courses. The main result of this study is the finding that FADD expression in peripheral blood leukocytes is significantly elevated in RR MS patients in comparison to other disease courses. Additionally, it might be elevated in RR MS patients in comparison to healthy individuals as well, but this was marginally not significant, most likely due to the relatively small sample size. Despite an observed elevation of medians, TRADD expression is not significantly elevated in MS patients. TRAF2 expression in peripheral blood leukocytes was significantly elevated in RR MS patients compared to the other disease courses and healthy persons, and RIP expression was significantly elevated in the patient groups compared to healthy controls, which might be interpreted as the molecular equivalent of an elevated general inflammatory activity in MS patients compared to healthy individuals [20]. Together with this latter result, this study reveals that all downstream TNFR signal transduction components, TRADD, TRAF2, FADD and RIP seem to be elevated in RR MS. Most likely due to relatively small sample sizes, significance was not reached for each of these components. Previously, an overall increased expression of cFLIP, CD95, CD95 ligand and caspase 8, important players in the CD95 signal transduction pathway, was observed in RR MS patients’ peripheral blood mononuclear cells, suggesting their involvement in the inflammatory process [14]. At first sight these results seem to be difficult to understand as in general TRAF2 was considered to signal inflammation and FADD to signal apoptosis. However, more recent studies show that FADD, caspase 8 and c-FLIP involved in death receptor apoptosis are all involved in promoting T cell proliferation in response to 224
Neuroimmunomodulation 2014;21:221–225 DOI: 10.1159/000356522
T cell receptor ligands, as well as opposed to the situation in B cells, where B cell receptor crosslinking was unaffected by FADD [8]. Taking these results into account, elevation of FADD in RR MS patients’ peripheral blood leukocytes compared to other disease courses might be interpreted as the molecular equivalent of an elevated general inflammatory activity in RR MS patients compared to other courses of disease such as SP and PP MS, even in the absence of acute inflammatory activity measured by the onset of new neurological symptoms, which was excluded in our study. Yet, this does not mean that there was no acute inflammatory activity at all, as we did not perform brain MRIs to determine subclinical disease activity. Compared to RR MS, SP and PP MS are characterized by neurodegeneration with little inflammation. Brain T and B cell infiltrates correlate with the activity of demyelinating lesions, while plasma cell infiltrates are most pronounced in patients with SP and PP MS, and even persist when T and B cell infiltrates decline to levels seen in age-matched controls [21]. Therefore, analyzing expression in peripheral blood leukocytes reinforces the concept that different pathophysiological and immunological processes sustain RR MS and SP or PP MS. TNFR1 is important for the initiation of the disease, as TNFR1 knockout mice were entirely resistant to EAE [22]. Conversely, TNFR1 is crucial for T cell apoptosis in EAE and thus for the removal of T lymphocytes from inflammatory demyelinating lesions [12]. TNFR2 has a proinflammatory role at the level of vascular endothelium correlating with the TNFR2 expression pattern in the CNS [13]. These complex interactions may have been the reason that, in the anti-TNF lenercept (TNFR-IgG p55) trial [19], the number of lenercept-treated patients experiencing exacerbations was significantly increased compared with patients receiving the placebo. In one of its results, our study demonstrates that FADD is elevated in RR MS compared to SP and PP MS. Taking into account several roles of FADD [8] collated with our previous results [15], this may suggest the following notion: FADD elevation in RR MS might reflect enhanced proinflammatory signaling in peripheral blood leukocytes, but at later stages of the disease or in SP MS TNFR1 signaling that is then predominant rather signals apoptosis. In our study, the RR MS and control group showed a similar structure with regard to age. In this, age should not have significantly influenced expression results comparing the RR MS and control group. There might have been an influence in the expression rate as the patient groups revealed different structures in terms of age. As the difference in age between the SP or the PP and the RR Reuss/Mistarz/Mirau/Kraus/Bödeker/ Oschmann
Downloaded by: NYU Medical Center Library 128.122.253.212 - 2/19/2015 4:26:25 PM
increase (p = 0.041) in EDSS after that time period. There was one relapse within 1 year before baseline and no relapse during the study, the disease duration was 8 years and the progression index at baseline was 0.1. There was no significant change in TRAF2 and RIP1 expression (TRADD: p < 0.93; FADD: p < 0.72).
MS groups did not translate into an equivalent expression difference, the difference in age between the RR MS and the other patient groups most likely does not represent the decisive causal factor in the difference in FADD expression between the RR MS and the two other patient groups. In summary, this study focused on TRADD and FADD mRNA expression in MS patients’ leukocytes. Elevation of FADD in peripheral blood leukocytes might mediate proinflammatory CNS mechanisms. The results rein-
force the concept that different pathophysiological and immunological processes sustain RR MS and SP or PP MS. Based on these results it would be interesting to examine the protein expression in different cell types and different tissues.
Acknowledgments The authors thank all the patients who took part in the study.
References
FADD in MS
9 Park SM, Schickel R, Peter ME: Nonapoptotic functions of FADD-binding death receptors and their signaling molecules. Curr Opin Cell Biol 2005;17:610–616. 10 Tartaglia LA, Ayres TM, Wong GH, Goeddel DV: A novel domain within the 55 kd TNF receptor signals cell death. Cell 1993;74:845– 853. 11 Fotin-Mleczek M, Henkler F, Samel D, Reichwein M, Hausser A, Pamryd I, Scheurich P, Schmid JA, Wajant H: Apoptotic crosstalk of TNF receptors: TNF-R2 induces depletion of TRAF2 and IAP proteins and accelerates TNF-R1-dependent activation of caspase-8. J Cell Sci 2002;115:2757–2770. 12 Bachmann R, Eugster HP, Frei K, Fontana A, Lassmann H: Impairment of TNF-receptor-1 signaling but not Fas signaling diminishes T cell apoptosis in myelin oligodendrocyte glycoprotein peptide-induced chronic demyelinating autoimmune encephalomyelitis in mice. Am J Pathol 1999;154:1417–1422. 13 Akassoglou K, Douni E, Bauer J, Lassmann H, Kollias G, Probert L: Exclusive tumor necrosis factor (TNF) signaling by the p75TNF receptor triggers inflammatory ischemia in the CNS of transgenic mice. Proc Natl Acad Sci USA 2003;100:709–714. 14 Gomes AC, Jonsson G, Mjornheim S, Olsson T, Hillert J, Grandien A: Upregulation of the apoptosis regulators cFLIP, CD95 and CD95 ligand in peripheral blood mononuclear cells in relapsing-remitting multiple sclerosis. J Neuroimmunol 2003;135:126–134. 15 Reuss R, Pohle S, Retzlaff K, Hemberger J, Oschmann P: Interferon β-1a induces tumor necrosis factor receptor 1 but decreases tumor necrosis factor receptor 2 leukocyte mRNA levels in relapsing-remitting multiple sclerosis. Neuroimmunomodulation 2009;16:171–176.
16 Poser CM, Paty DW, Scheinberg L, McDonald WI, Davis FA, Ebers GC, Johnson KP, Sibley WA, Silberberg DH, Tourtellotte WW: New diagnostic criteria for multiple sclerosis: guidelines for research protocols. Ann Neurol 1983;13:227–231. 17 Kurtzke JF: Rating neurologic impairment in multiple sclerosis: an expanded disability status scale (EDSS). Neurology 1983; 33: 1444– 1452. 18 Kühne BS, Oschmann P: Quantitative realtime RT-PCR using hybridization probes and imported standard curves for cytokine gene expression analysis. Biotechniques 2000; 33: 1078, 1080–1082, 1084. 19 Lenercept Multiple Sclerosis Study Group, University of British Columbia MS/MRI Analysis Group: TNF neutralization in MS: results of a randomized, placebo-controlled multicenter study. Neurology 1999; 53: 457– 465. 20 Reuss R, Mirau A, Mistarz M, Kraus J, Bödeker RH, Oschmann P: TRAF2 is upregulated in relapsing remitting multiple sclerosis. Neuroimmunomodulation 2013;20:177–183. 21 Frischer JM, Bramow S, Dal-Bianco A, Lucchinetti C, Rauschka H, Schmidbauer M, Laursen H, Sorensen PS, Lassmann H: The relation between inflammation and neurodegeneration in multiple sclerosis brains. Brain 2009;132:1175–1189. 22 Suvannavejh GC, Lee HO, Padilla J, Dal Canto MC, Barrett TA, Miller SD: Divergent roles for p55 and p75 tumor necrosis factor receptors in the pathogenesis of MOG(35–55)-induced experimental autoimmune encephalomyelitis. Cell Immunol 2000;205:24–33.
Neuroimmunomodulation 2014;21:221–225 DOI: 10.1159/000356522
225
Downloaded by: NYU Medical Center Library 128.122.253.212 - 2/19/2015 4:26:25 PM
1 Farias AS, de la Hoz C, Castro FR, Oliveira EC, Ribeiro dos Reis JR, Silva JS, Langone F, Santos LMB: Nitric oxide and TNF-α effects in experimental autoimmune encephalomyelitis demyelination. Neuroimmunomodulation 2007;14:32–38. 2 Hsu H, Shu HB, Pan MG, Goeddel DV: TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell 1996; 84: 299–308. 3 Hsu H, Xiong J, Goeddel DV: The TNF receptor 1-associated protein TRADD signals cell death and NF-κB activation. Cell 1995; 81: 495–504. 4 Jiang Y, Woronicz JD, Liu W, Goeddel DV: Prevention of constitutive TNF receptor 1 signaling by silencer of death domain. Science 1999;288:543–546. 5 Hsu H, Huang J, Shu HB, Baichwal V, Goeddel DV: TNF dependent recruitment of the protein kinase RIP to the TNF receptor-1 signaling complex. Immunity 1996;4:387–396. 6 Micheau O, Tschopp J: Induction of TNF receptor I-mediated apoptosis via two sequential signalling complexes. Cell 2003;114:181–190. 7 Schneider-Brachert W, Tchikov V, Neumeyer I, Jakob M, Winoto-Morbach S, Held-Feindt J, Heinrich M, Merkel O, Ehrenschwender M, Adam D, Mentlein R, Kabelitz D, Schütze S: Compartmentalization of TNF receptor 1 signaling: internalized TNF receptosomes as death signaling vesicles. Immunity 2004;21:15–428. 8 Werner MH, Wu C, Walsh CM: Emerging roles for the death adaptor FADD in death receptor avidity and cell cycle regulation. Cell Cycle 2006;5:2332–2338.
Neuroimmunomodulation 2014;21:221–225 DOI: 10.1159/000356522
FADD Is Upregulated in Relapsing Remitting Multiple Sclerosis Reinhard Reuss a, c Marta Mistarz c Andreas Mirau c Jörg Kraus e Rolf-Hasso Bödeker d Patrick Oschmann b
a
Department of Neurology, Bezirkskrankenhaus Bayreuth, and b Department of Neurology, Hospital Hohe Warte, Bayreuth, and Departments of c Neurology and d Medical Informatics, Justus Liebig University Giessen, Giessen, Germany; e Paracelsus Medical University and Salzburger Landeskliniken, Christian-Doppler-Klinik, University Hospital of Neurology, Salzburg, Austria
Abstract Objective: To elucidate the role of tumor necrosis factor (TNF) receptor signal transduction in multiple sclerosis (MS). Methods: We performed a cross-sectional analysis of the gene expression of TNF receptor-associated death domain protein (TRADD) and Fas-associated death domain protein (FADD) in peripheral blood leukocytes of 23 relapsing remitting (RR), 19 secondary progressive (SP) and 12 primary progressive (PP) MS patients, as well as of 29 healthy controls by quantitative RT-PCR. Additionally, we monitored a subgroup of 15 RR MS patients longitudinally every 3 months over the time period of 9 months. Results: FADD expression was significantly elevated in RR MS patients compared to the other disease courses (p < 0.048). The median of FADD expression was elevated in the RR MS patient groups compared to the healthy group, but this was not significant (p < 0.053). The median of TRADD expression was elevated in the patient groups compared to the healthy group, but this was not significant (p < 0.14). Neither variable changed significantly over the time course of 9 months. Conclusion: FADD eleva-
© 2014 S. Karger AG, Basel 1021–7401/14/0215–0221$39.50/0 E-Mail [email protected] www.karger.com/nim
tion in leukocytes might be interpreted as the molecular equivalent of an elevated general inflammatory activity in RR MS patients compared to other disease courses. FADD elevation in RR MS reinforces the concept that different pathophysiological and immunological processes sustain RR MS and SP or PP MS. © 2014 S. Karger AG, Basel
Introduction
During the acute phase of experimental autoimmune encephalomyelitis (EAE) in mice, an increase in the number of tumor necrosis factor (TNF)-α-positive cells is detected in the central nervous system (CNS) [1]. The TNF receptors 1 and 2 (TNF-R1, TNFRSF1A; TNF-R2, TNFRSF1B) expressed specifically in the tissue can mediate both apoptosis and inflammation [2]. The TNF-R1
Reinhard Reuss received consultancy fees from Janssen-Cilag. Jörg Kraus received personal compensation from Bayer, Biogen-Idec, Merck, Novartis, Sanofi-Aventis for consulting services, and financial support for research activities from Bayer, Biogen-Idec, Genzyme, Merck-Serono, Novartis and Sanofi-Aventis. Patrick Oschmann received grants and consultancy fees from Novartis, Bayer, Teva, Sanofi-Aventis, Merck Serono and ZLB.
Dr. Reinhard Reuss, MD Department of Neurology, BKH Bayreuth, Nordring 2 DE–95445 Bayreuth (Germany) E-Mail reinhard.reuss @ neuro.med.uni-giessen.de
Downloaded by: NYU Medical Center Library 128.122.253.212 - 2/19/2015 4:26:25 PM
Key Words Multiple sclerosis · FADD protein · Tumor necrosis factor receptor · TRADD protein
Materials and Methods
sented a relapsing disease course with subsequent progressive clinical deterioration, including reduced walking capability. PP patients had exhibited a progressive clinical deterioration from the very beginning and for at least 1 year. Consent was obtained in accordance with the Declaration of Helsinki after approval from the Ethics Commission at the Medical Faculty, Justus Liebig University of Giessen. Additionally, the 23 patients with clinically verified RR MS [16], who presented at least 1 relapse within the last year, were tested within an open, prospective and nonrandomized design. The healthy control group consisted of 29 individuals. Peripheral blood was obtained from the study objects at baseline and, in the case of the RR MS patients, additionally every 3 months for 9 months, and clinical examination was performed to determine EDSS scores according to Kurtzke [17]. Patients or controls who presented with a relapse inside 2 weeks before or 4 weeks after baseline or the respective visit, and those who had received glucocorticoids within the last 4 weeks or suffered from an infection or elevation of C-reactive protein value or leukocytes in peripheral blood at the respective visit, did not undergo blood sampling. Additionally, no immunomodulatory (such as interferons or glatiramer acetate) or immunosuppressive therapy had been administered within the last 6 months. The control and patient data are specified in table 1. Reverse Transcription Polymerase Chain Reaction Using the QIAmp® RNA Blood Mini Kit (Qiagen, Hilden, Germany), the Thermo-Cycler (Hybaid, Heidelberg, Germany), oligo-dT primers and SuperScript® II (M-MLV) RNase H– reverse transcriptase (200 U/μl; Invitrogen, Karlsruhe, Germany), total RNA was isolated from leukocytes and reverse transcribed into cDNA following the supplier’s standard protocols. As previously described [18], a quantitative real-time RT-PCR (LightCycler; Roche Diagnostics GmbH, Mannheim, Germany) using hybridization probes (Tib Molbiol, Berlin, Germany) and imported standard curves – plasmid standards dissolved in MS2-RNA (10 ng/μl) were obtained from Invitrogen Life Technologies GmbH (Karlsruhe, Germany) – was setup and applied to measure the respective amount of TRADD and FADD mRNA relative to the internal standard porphobilinogen deaminase (NCBI GenBank® accession No. X04808). Forward primers (5′–3′) were GGGTCAGCCTGTAGTGAATCG for TRADD and GAAGAAGACCTGTGTGCAGCATT for FADD. Reverse primers (5′–3′, Tib Molbiol) were GTCCTCTGCCAGGCTGGTG for TRADD and GTTGCGTTCTCCTTCTCTGTGTT for FADD. Donor probes (5′–3′) were GAGACCCACAGAGCGCGCGA-FL for TRADD and TCTGTCCTCGATGCTGTCGATCTTGG-FL for FADD. Acceptor probes (5′–3′) were Red640-CGTCTGTTGGTCCTTCAGGCTCAGC-ph for TRADD and Red640-GTCTGAGACTTTGAGCTGACGAGCCA-ph for FADD, in which FL stands for 5.6-carboxyfluorescein, Red640 for LightCycler Red 640 and ph for the phosphate group. Besides hybridization probes, 20-μl aqueous solutions contained 1.2 or 1.6 μl of MgCl2 (2.5 mM for TRADD and 3 mM for RIP1), 1 μl of forward or reverse primer (0.5 μM), LightCycler FastStart DNA Master HybProbe reaction mix/FastStart Taq polymerase (1×; Roche Diagnostics) and, in the case of TRADD, 1 μl of DMSO (5%). The PCR conditions were: 10 min at 95 ° C, then (initially 8 cycles touchdown from 68 to 60 ° C in steps of 1 ° C) 39 cycles for 10 s at 95 ° C, 10 s at 60 ° C and 20 s at 72 ° C. LightCycler® software 3.5 was used for analysis (Second Derivate Maximum Method; proportional baseline adjustment).
Patients Following written informed consent, 54 patients with RR MS, secondary progressive (SP) and primary progressive (PP) MS were included in a cross-sectional study. SP patients had initially pre-
222
Neuroimmunomodulation 2014;21:221–225 DOI: 10.1159/000356522
Reuss/Mistarz/Mirau/Kraus/Bödeker/ Oschmann
Downloaded by: NYU Medical Center Library 128.122.253.212 - 2/19/2015 4:26:25 PM
death domain joins the TNFR-associated death domain (TRADD) protein [3, 4], an adaptor protein that serves the bifurcation of both these pathways by binding the FAS-associated death domain (FADD) protein and caspases on the one hand, or TNFR-associated factor 2 (TRAF2) and receptor-interacting protein (RIP) and then IκB kinase complex on the other hand [2, 5–7]. Recruiting TRAF2 and RIP to TRADD finally leads to activation of NFκB, triggering an inflammatory response. Additionally, TNFRSF1A binding can activate c-Jun kinase and mitogen-activated protein kinase, MAPK, leading to proliferation. Recruiting FADD to TRADD finally results in apoptosis. New studies have revealed additional roles for FADD in death receptor avidity and cell cycle regulation [8], especially as regards nonapoptotic activities [9]. Various interactions exist between these pathways and pathways involving other members of the TNFRSF. TNF-α binding to TNFRSF1B in the absence of a death domain leads directly to TRAF2 and RIP binding to the receptor, hence resulting in NFκB and MAPK activation. TNFRSF1B appeared merely to be capable of transducing inflammation and for a long time was thought to be only a ligand provider for RSF1A [10]. New studies show that RSF1B appears able to magnify the RSF1A-induced cascade of apoptosis. There might be competition between both receptors for TRAF2, possibly resulting in apoptosis following selective RSF1B stimulation [11]. TNF-R1 signaling is crucial for T cell apoptosis in EAE and plays an exclusive role in oligodendrocyte apoptosis, while TNF-R2 has an independent proinflammatory role in the CNS [12, 13]. In multiple sclerosis (MS), a reduction in leukocyte apoptosis might contribute to enhanced migration of autoreactive T cells into the CNS and perpetuation of inflammation [14], resulting in clinical and subclinical exacerbations. Recently, we have succeeded in demonstrating that in natural history in relapse remitting (RR) MS there is a correlation between the expanded disability status scale (EDSS) score and the TNF-R1 mRNA level in leukocytes [15]. Here, we performed quantitative reverse transcription polymerase chain reaction (RT-PCR) to investigate leukocyte TRADD and FADD expression in MS patients for the first time.
Table 1. Demographic and expression data in healthy controls, and patients with PP, RR and SP MS
Sex Male Female Median age, years EDSS median Disease duration, years Progression index TRADD Median Mean SEM 1st quartile 3rd quartile FADD Median Mean SEM 1st quartile 3rd quartile
Healthy (n = 29)
PP MS (n = 12)
RR MS (n = 23)
SP MS (n = 19)
Homogeneity (p value)
12 (41.38) 17 (58.62) 45 n.a. n.a. n.a.
9 (75) 3 (25) 54 5 7 0.583
6 (26.09) 17 (73.91) 46 1 7 0.143
16 (84.21) 3 (15.79) 50 5 9 0.667
0.0063 (FE test)
1,347 1,744 289 829 2,201
1,561 3,192 1,354 781 2,428
1,996 2,900 543 1,234 2,916
2,058 2,993 684 1,126 4,743
0.14 (median test)
650 1,066 196 561 1,060
628 1,218 396 483 1,207
991 1,039 89 639 1,374
483 983 222 226 1,884
0.053 (median test)
0.0041 (median test) 0.0001 (median test) 0.654 (median test) 0.0001 (median test)
Values in parentheses are percentages. FE test = Fisher’s exact test; n.a. = not applicable; SEM = standard error of the mean.
Results 6,000
Clinical Characteristics Ages differed in the four groups (pglobal < 0.0041; table 1), as did sex (pglobal < 0.0063; table 1). Clinical characteristics were as expected, for example EDSS was considerably lower in the RR MS group than in the SP or PP MS groups (pglobal < 0.0001; table 1; pRR-PP < 0.001; pRR-SP < 0.001; pPP-SP > 0.9).
FADD
4,000 3,000 2,000 1,000 0
G
PP
RR
SP
Fig. 1. Relative FADD mRNA levels in peripheral blood leukocytes at baseline in healthy (G; n = 29), PP (n = 12), RR (n = 23) and SP (n = 19) MS patients. The figure presents box plots showing minimum, maximum, quartiles and medians. Median test: pglobal < 0.053; comparison between MS groups: p < 0.048.
Statistics Fisher’s exact test and median test were applied for the statistical analysis of patient characteristics. Protein expressions were examined using the median test. Spearman’s correlation was used to analyze any influence of disease variables on protein expression and Friedman’s analysis of variance by ranks was performed for longitudinal analysis. Statistical significance was factored in as p < 0.05.
FADD in MS
Cross-Sectional Analysis The median TRADD expression in healthy controls (median 1,347) was lower than in patient groups (medians: RR MS 1,996, SP MS 2,058, PP MS 1,561), yet an elevation in TRADD expression was not significant (p < 0.14). The median FADD expression (fig. 1) in healthy controls (median 650) again was lower than in the RR MS group (medians: RR MS 991, SP MS 483, PP MS 628), yet an elevation in FADD expression was marginally not significant (p < 0.053). By analyzing only the MS groups, the difference was significant (p < 0.048). Longitudinal Analysis As some patients missed at least one visit, it was only possible to perform examination of protein expression over 9 months on 15 RR MS patients, who revealed a mild Neuroimmunomodulation 2014;21:221–225 DOI: 10.1159/000356522
223
Downloaded by: NYU Medical Center Library 128.122.253.212 - 2/19/2015 4:26:25 PM
5,000
Discussion
As previous results had revealed conflicting data on the therapeutic efficacy of TNF inhibition in MS [19], we analyzed for the first time the signal transduction pathway of TNF receptors on the FADD and TRADD mRNA level in order to elucidate the role of TNF receptor signal transduction in MS patients with varied disease courses. The main result of this study is the finding that FADD expression in peripheral blood leukocytes is significantly elevated in RR MS patients in comparison to other disease courses. Additionally, it might be elevated in RR MS patients in comparison to healthy individuals as well, but this was marginally not significant, most likely due to the relatively small sample size. Despite an observed elevation of medians, TRADD expression is not significantly elevated in MS patients. TRAF2 expression in peripheral blood leukocytes was significantly elevated in RR MS patients compared to the other disease courses and healthy persons, and RIP expression was significantly elevated in the patient groups compared to healthy controls, which might be interpreted as the molecular equivalent of an elevated general inflammatory activity in MS patients compared to healthy individuals [20]. Together with this latter result, this study reveals that all downstream TNFR signal transduction components, TRADD, TRAF2, FADD and RIP seem to be elevated in RR MS. Most likely due to relatively small sample sizes, significance was not reached for each of these components. Previously, an overall increased expression of cFLIP, CD95, CD95 ligand and caspase 8, important players in the CD95 signal transduction pathway, was observed in RR MS patients’ peripheral blood mononuclear cells, suggesting their involvement in the inflammatory process [14]. At first sight these results seem to be difficult to understand as in general TRAF2 was considered to signal inflammation and FADD to signal apoptosis. However, more recent studies show that FADD, caspase 8 and c-FLIP involved in death receptor apoptosis are all involved in promoting T cell proliferation in response to 224
Neuroimmunomodulation 2014;21:221–225 DOI: 10.1159/000356522
T cell receptor ligands, as well as opposed to the situation in B cells, where B cell receptor crosslinking was unaffected by FADD [8]. Taking these results into account, elevation of FADD in RR MS patients’ peripheral blood leukocytes compared to other disease courses might be interpreted as the molecular equivalent of an elevated general inflammatory activity in RR MS patients compared to other courses of disease such as SP and PP MS, even in the absence of acute inflammatory activity measured by the onset of new neurological symptoms, which was excluded in our study. Yet, this does not mean that there was no acute inflammatory activity at all, as we did not perform brain MRIs to determine subclinical disease activity. Compared to RR MS, SP and PP MS are characterized by neurodegeneration with little inflammation. Brain T and B cell infiltrates correlate with the activity of demyelinating lesions, while plasma cell infiltrates are most pronounced in patients with SP and PP MS, and even persist when T and B cell infiltrates decline to levels seen in age-matched controls [21]. Therefore, analyzing expression in peripheral blood leukocytes reinforces the concept that different pathophysiological and immunological processes sustain RR MS and SP or PP MS. TNFR1 is important for the initiation of the disease, as TNFR1 knockout mice were entirely resistant to EAE [22]. Conversely, TNFR1 is crucial for T cell apoptosis in EAE and thus for the removal of T lymphocytes from inflammatory demyelinating lesions [12]. TNFR2 has a proinflammatory role at the level of vascular endothelium correlating with the TNFR2 expression pattern in the CNS [13]. These complex interactions may have been the reason that, in the anti-TNF lenercept (TNFR-IgG p55) trial [19], the number of lenercept-treated patients experiencing exacerbations was significantly increased compared with patients receiving the placebo. In one of its results, our study demonstrates that FADD is elevated in RR MS compared to SP and PP MS. Taking into account several roles of FADD [8] collated with our previous results [15], this may suggest the following notion: FADD elevation in RR MS might reflect enhanced proinflammatory signaling in peripheral blood leukocytes, but at later stages of the disease or in SP MS TNFR1 signaling that is then predominant rather signals apoptosis. In our study, the RR MS and control group showed a similar structure with regard to age. In this, age should not have significantly influenced expression results comparing the RR MS and control group. There might have been an influence in the expression rate as the patient groups revealed different structures in terms of age. As the difference in age between the SP or the PP and the RR Reuss/Mistarz/Mirau/Kraus/Bödeker/ Oschmann
Downloaded by: NYU Medical Center Library 128.122.253.212 - 2/19/2015 4:26:25 PM
increase (p = 0.041) in EDSS after that time period. There was one relapse within 1 year before baseline and no relapse during the study, the disease duration was 8 years and the progression index at baseline was 0.1. There was no significant change in TRAF2 and RIP1 expression (TRADD: p < 0.93; FADD: p < 0.72).
MS groups did not translate into an equivalent expression difference, the difference in age between the RR MS and the other patient groups most likely does not represent the decisive causal factor in the difference in FADD expression between the RR MS and the two other patient groups. In summary, this study focused on TRADD and FADD mRNA expression in MS patients’ leukocytes. Elevation of FADD in peripheral blood leukocytes might mediate proinflammatory CNS mechanisms. The results rein-
force the concept that different pathophysiological and immunological processes sustain RR MS and SP or PP MS. Based on these results it would be interesting to examine the protein expression in different cell types and different tissues.
Acknowledgments The authors thank all the patients who took part in the study.
References
FADD in MS
9 Park SM, Schickel R, Peter ME: Nonapoptotic functions of FADD-binding death receptors and their signaling molecules. Curr Opin Cell Biol 2005;17:610–616. 10 Tartaglia LA, Ayres TM, Wong GH, Goeddel DV: A novel domain within the 55 kd TNF receptor signals cell death. Cell 1993;74:845– 853. 11 Fotin-Mleczek M, Henkler F, Samel D, Reichwein M, Hausser A, Pamryd I, Scheurich P, Schmid JA, Wajant H: Apoptotic crosstalk of TNF receptors: TNF-R2 induces depletion of TRAF2 and IAP proteins and accelerates TNF-R1-dependent activation of caspase-8. J Cell Sci 2002;115:2757–2770. 12 Bachmann R, Eugster HP, Frei K, Fontana A, Lassmann H: Impairment of TNF-receptor-1 signaling but not Fas signaling diminishes T cell apoptosis in myelin oligodendrocyte glycoprotein peptide-induced chronic demyelinating autoimmune encephalomyelitis in mice. Am J Pathol 1999;154:1417–1422. 13 Akassoglou K, Douni E, Bauer J, Lassmann H, Kollias G, Probert L: Exclusive tumor necrosis factor (TNF) signaling by the p75TNF receptor triggers inflammatory ischemia in the CNS of transgenic mice. Proc Natl Acad Sci USA 2003;100:709–714. 14 Gomes AC, Jonsson G, Mjornheim S, Olsson T, Hillert J, Grandien A: Upregulation of the apoptosis regulators cFLIP, CD95 and CD95 ligand in peripheral blood mononuclear cells in relapsing-remitting multiple sclerosis. J Neuroimmunol 2003;135:126–134. 15 Reuss R, Pohle S, Retzlaff K, Hemberger J, Oschmann P: Interferon β-1a induces tumor necrosis factor receptor 1 but decreases tumor necrosis factor receptor 2 leukocyte mRNA levels in relapsing-remitting multiple sclerosis. Neuroimmunomodulation 2009;16:171–176.
16 Poser CM, Paty DW, Scheinberg L, McDonald WI, Davis FA, Ebers GC, Johnson KP, Sibley WA, Silberberg DH, Tourtellotte WW: New diagnostic criteria for multiple sclerosis: guidelines for research protocols. Ann Neurol 1983;13:227–231. 17 Kurtzke JF: Rating neurologic impairment in multiple sclerosis: an expanded disability status scale (EDSS). Neurology 1983; 33: 1444– 1452. 18 Kühne BS, Oschmann P: Quantitative realtime RT-PCR using hybridization probes and imported standard curves for cytokine gene expression analysis. Biotechniques 2000; 33: 1078, 1080–1082, 1084. 19 Lenercept Multiple Sclerosis Study Group, University of British Columbia MS/MRI Analysis Group: TNF neutralization in MS: results of a randomized, placebo-controlled multicenter study. Neurology 1999; 53: 457– 465. 20 Reuss R, Mirau A, Mistarz M, Kraus J, Bödeker RH, Oschmann P: TRAF2 is upregulated in relapsing remitting multiple sclerosis. Neuroimmunomodulation 2013;20:177–183. 21 Frischer JM, Bramow S, Dal-Bianco A, Lucchinetti C, Rauschka H, Schmidbauer M, Laursen H, Sorensen PS, Lassmann H: The relation between inflammation and neurodegeneration in multiple sclerosis brains. Brain 2009;132:1175–1189. 22 Suvannavejh GC, Lee HO, Padilla J, Dal Canto MC, Barrett TA, Miller SD: Divergent roles for p55 and p75 tumor necrosis factor receptors in the pathogenesis of MOG(35–55)-induced experimental autoimmune encephalomyelitis. Cell Immunol 2000;205:24–33.
Neuroimmunomodulation 2014;21:221–225 DOI: 10.1159/000356522
225
Downloaded by: NYU Medical Center Library 128.122.253.212 - 2/19/2015 4:26:25 PM
1 Farias AS, de la Hoz C, Castro FR, Oliveira EC, Ribeiro dos Reis JR, Silva JS, Langone F, Santos LMB: Nitric oxide and TNF-α effects in experimental autoimmune encephalomyelitis demyelination. Neuroimmunomodulation 2007;14:32–38. 2 Hsu H, Shu HB, Pan MG, Goeddel DV: TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell 1996; 84: 299–308. 3 Hsu H, Xiong J, Goeddel DV: The TNF receptor 1-associated protein TRADD signals cell death and NF-κB activation. Cell 1995; 81: 495–504. 4 Jiang Y, Woronicz JD, Liu W, Goeddel DV: Prevention of constitutive TNF receptor 1 signaling by silencer of death domain. Science 1999;288:543–546. 5 Hsu H, Huang J, Shu HB, Baichwal V, Goeddel DV: TNF dependent recruitment of the protein kinase RIP to the TNF receptor-1 signaling complex. Immunity 1996;4:387–396. 6 Micheau O, Tschopp J: Induction of TNF receptor I-mediated apoptosis via two sequential signalling complexes. Cell 2003;114:181–190. 7 Schneider-Brachert W, Tchikov V, Neumeyer I, Jakob M, Winoto-Morbach S, Held-Feindt J, Heinrich M, Merkel O, Ehrenschwender M, Adam D, Mentlein R, Kabelitz D, Schütze S: Compartmentalization of TNF receptor 1 signaling: internalized TNF receptosomes as death signaling vesicles. Immunity 2004;21:15–428. 8 Werner MH, Wu C, Walsh CM: Emerging roles for the death adaptor FADD in death receptor avidity and cell cycle regulation. Cell Cycle 2006;5:2332–2338.
