Mol Gen Genet (1992) 232:12-16 © Springer-Verlag 1992

Fotl, a new family of fungal transposable elements Marie-Jos6e Daboussi, Thierry Langin and Yves Brygoo Institut de G6n6tiqueet Microbiologie,Unit~ associ6eau CNRS 1354, Universit6Paris-Sud, F-91405 Orsay Cedex, France Received September 4, 1991

Summary. We report here the discovery of a family of transposable elements, which we refer to as Fotl elements, in the fungal plant pathogen Fusarium oxysporurn. The first element was identified as an insertion in the gene encoding nitrate reductase. It is 1928 bp long, has 44 bp inverted terminal repeats, contains a large open reading frame and is flanked by a 2 bp (TA) target site duplication. This element shares significant structural similarities with a class of transposons that includes Tc] from Caenorhabditis elegans and therefore represents a new class of transposable elements in fungi. Key words: Transposable element - Fusarium oxysporum - Plant pathogen - Nitrate reductase

Most fungal plant pathogens exhibit considerable genetic variability and lack sexuality. This suggests that mechanisms ensuring high mutation rates have been selected for in these organisms. It has been established that transposon movement constitutes a major source of spontaneous mutations in a wide variety of both prokaryotic and eukaryotic organisms (D6ring and Starlinger 1986; Lillis and Freeling 1986; Green 1988). Evidence now exists for the presence of retrotransposon-like elements in filamentous fungi (Kinsey and Helber 1989; McHale et al. 1989; Valent and Chumley I991). Fusariurn oxysporurn, an important fungal plant pathogen, which infects over 100 botanical species, shows a high degree of variation in cultural characteristics and pathogenicity (Burnett 1984). We speculated that part of this variability might be caused by the movement of transposable elements. We have looked for such elements using a strategy that involves spontaneous inactivation of a cloned gene, already successfully applied for isolating the Tad element in Neurospora crassa (Kinsey and Helber 1989). The nitrate reductase structural gene (nia) Offprint requests to: M.J. Daboussi, Laboratoire de Cryptogamie, Bat 400, Universit6Paris-Sud, 91405 Orsay Cedex, France

was chosen as a target because there is a simple direct procedure for isolating numerous mutants by selection for chlorate resistance (Cove 1976). This gene has already been cloned in filamentous fungi (Malardier et al. 1989; Whitehead et al. 1990). We selected nia mutants among six isolates belonging to different formae speciales and/or physiological races. Since most of the mutations caused by transposable elements are genetically unstable, special attention was paid to nia mutants reverting to wild type with a high frequency. More than 100 nia mutants were selected from each isolate. The frequency of unstable mutants among these was dependent on the strain. Strain F24, yielding up to 10% unstable nia mutants, was chosen for further study. Since the F. oxysporurn nia gene was not yet available as a clone, we decided to analyse mutational events that might occur in the wild-type niaD gene of Aspergillus nidulans introduced by transformation into F. oxysporurn. This gene, which is well characterized at the molecular level (Johnstone et al. 1990), is well expressed in F. oxysporurn and stably maintained through mitosis when introduced in a single copy (Malardier et al. 1989). Such a transformant was selected in the F24 genetic background after transformation of a stable nia mutant by the plasmid carrying the niaD gene. The screening of mutations in this exogenous gene by selection for chlorate resistance made it possible to recover unstable niaD mutants with a similar frequency to that occurring in the Fusariurn nia gene. Four unstable niaD mutants were examined and compared with the wild type by Southern blot analysis. Two of these, niaD37 and niaD62, showed detectable alterations at the niaD locus (Fig. I a) that can be explained by the insertion of a DNA sequence, approximately 1.9 kb in size, into the 2.7 kb EcoRI fragment. These sequences can be excised in an apparently precise fashion as indicated by the presence of the 2.7 kb wild type fragment in two phenotypic revertants isolated from each mutated allele. The restriction map of the niaD locus (Fig. l b) shows that the 1.9 kb insertions are located

13 1

a kb

1

2

3

2

3

kb

kb

9.0-~-9- 5.0 3.2-~2.7-~1.8"~-

b

E 1.8 E 2.7 E I

~\\\\\\\',~

I

3.2

I

E

9.0

'

E

3.2

E

'

V

0.8

.~

b.-

n/a D

Fig. 1 a, b. Structure of the niaD locus in wild-type, mutated and

revertant alleles, a Southern blot analysis of mutants and revertants. Total genomic DNAs were digested with EeoRI, separated electrophoretically through a 0.6% agarose gel, transferred to Hybond-N membrane (Amersham) and probed with a 32P-labelled pAN301 plasmid containing the Aspergillus nidulans niaD gene (Malardier et al. 1989). Lane 1, DNA from the transformed strain with the wild-type niaD allele. Four hybridizing bands appear at 9.0, 3.2, 2.7 and 1.8 kb. Lane 2, DNA from the niaD37 mutant. This mutant displays a mobility shift in one hybridizing band. The 2.7 kb fragment disappears and a new band appears at 5.0 kb which can be explained by a 1.9 kb insertion within the 2.7 kb EcoRI fragment. Lane 3, DNA from a revertant derived from niaD37. The return to a wild-type hybridization pattern shows that this revertant arises from precise or almost precise excision of the 1.9 kb sequence, b Fotl insertion sites in the niaD gene. The A. nidulans niaD gene was introduced into Fusarium oxysporum using pAN301. This gene spans 2.8 kb and contains six introns represented by black boxes. DNA sequences from pAN301 and F. oxysporum are indicate by open and hatched regions, respectively. Sizes are in kb. Triangles represent 1.9 kb insertions. E, EcoRI restriction site. In niaD37, the insertion resides in intron 3 as deduced by sequence analysis (this work). In niaD62, the insertion is located in exon 7 as determined by Southern blot analysis (data not shown)

at two different sites, indicating that the niaD37 and niaD62 m u t a t i o n s arose f r o m independent events. We characterized the 1.9 kb insertion f r o m niaD37 by cloning the 5.0 kb E c o R I f r a g m e n t containing the entire insertion. Total g e n o m i c D N A was digested with E c o R I , size-fractionated on a 0.6% agarose gel and 4 . 5 -

5.5 kb fragments were cloned into plasmid p U C 1 9 . The r e c o m b i n a n t clones containing the niaD37 allele were detected using the 32p-labelled 2.7 kb E c o R I f r a g m e n t as a probe. By using one o f these clones, p i N 3 7 , as a hybridization p r o b e in S o u t h e r n blotting experiments, we f o u n d that this insertion was a m e m b e r o f a family o f interspersed sequences present in high c o p y n u m b e r

Fig. 2. Distribution of Fotl elements in the F24 wild-type strain. Aliquots (5 gg) of total genomic DNA from F24 were digested to completion with the appropriate restriction enzymes, electrophoresed through a 0.6% agarose gel, transferred to a Hybond-N membrane (Amersham), and hybridized at high stringency with 32p_ labelled probe. Sizes are in kb. Lanes 1, 2, DNA digested with BamHI and HindIII which cut Fotl-37 once and twice, respectively. Lane 3, DNA digested with XbaI which does not cut Fotl 37. Hybridization with the 0.8 kb BamHI fragment internal to the element revealed an array of Fot-homologous fragments in the HindIII and XbaI digests, indicating that Fotl-37 belongs to a dispersed repetitive DNA sequence family. In the XbaI digest, each band probably represents a single element. Some of the darker bands may contain more than one copy. In the BamHI digest, the probe hybridized almost exclusively to BamHI fragments of 0.8 kb, indicating that most copies of Fotl in the genome are similar in structure to the cloned copy

(Fig. 2). A n experiment designed to c o u n t these elements, which we called For1 elements, indicated that there are a b o u t 100 copies per haploid genome. M o s t m e m b e r s o f the F o t l family contain a 0.8 kb B a m H I f r a g m e n t (Fig. 2). The presence o f such a fragm e n t (which was f o u n d internally in the niaD37 insertion) demonstrates that the general structural organization o f F o t l elements is conserved. However, the presence o f m i n o r b a n d s suggests that the F o t l family m a y be s o m e w h a t variable. The complete sequence o f the niaD37 insertion was determined (Fig. 3a). A transposable-like element, 1928 bp long, with inverted terminal repeats (ITRs) o f 44 bp was recognized and n a m e d F o t l - 3 7 . The I T R s differ by a single base a n d contain perfect short direct repeats o f 13 bp. A c o m p u t e r search o f the F o t l - 3 7 sequence revealed an open reading frame potentially encoding a polypeptide o f 542 a m i n o acids. The insertion studied appears to be flanked by a dinucleotide (TA); only one c o p y is f o u n d at the c o r r e s p o n d i n g site in the

AGTCAAGCACCC ATGTAACCGACCCCCCCTGGTAACCGACCCCCACCT•AGACACGTCTTCAGACGCGTCCACA•CAGTATTTAAATCCACGATAAATCGAGTTCTTCTTC A A T T T A C T T T T T T C T T T C T T C A T C C T C T T C T T T T A C T T C T A C A ATG CCG GTA TAC TCT GCG GAC GAC CTA GAA AAT GCC ATT GCA Met pro val tyr ser ala asp asp leu glu ash ala ile ala GAC TTC AAG AAT GGG GTC TCT TTG A A G ACC GCC GCG AAA A A A AAC GGT CTA CCA C C C AGC ACC CTA CGA GGT CGC asp phe lys asn gly val set leu lys thr ala a18 lys lys ash gly leu pro pro set thr leu arg gly arg CTC A C T GGT GCG CAA AGT CGT CAG GTC GCT CGC CAA GAA CAA CTA CGC CTT ACC ACC GAT CAA GAA GAT GAC CTT leu thr ~ly ala gln set arg gln val ala arg gln glu gln leu arg leu thr thr asp gln glu asp asp leu GAG CGC TGG ATT CTG CGA CAG GAA A A G CTC GGC CAC GCT CCA ACT CAC GCG CAA GTG CGA ACT ATC GTC CGC AGC glu arg trp ile leu arg gln ~lu lys leu gly his ala pro thr his ala gln val arg thr ile val arg ser GTT CTC GCG CGT CAC GGG GAT CAC GCG CCA TTA GGA AGG AAG TGG ACT ACG CGA TTC GTG GAG CGC CAC CCT GCC val leu ala arg his gly asp his ala pro leu gly arg lys trp thr thr arg phe val glu arg his pro ala TTG AAG A C A AAG TTG GGT CGC CGT A C A GAC TGG GAG CGT GTA AAT GCT GCG A C C CCG GCG AAT ATC AAG CGC TTG leu lys thr lys leu gly arg arg thr asp trp glu arg val ash ala ala thr pro ala ash ile lys arg leu TTC GAC GTG TAT GAG ACC GTG GAT TGG ATC CCC CCC GAA CGA CGG TAT AAC GCC GAC GAG GGC GGC ATT ATG GAA phe asp val tyr glu thr val asp t r p ile pro pro glu arg arg tyr ash ala asp glu gly gly lle met glu GGC CAG GGC GTT AAC GGC CTC GTG A T C GGC TCG TCA CAG GAG AGC CCT AAC GCG GTA CCA GTC AAA ACA GCG ACC gly gln gly val asn gly leu val ile gly set ser gln glu set pro ash ala val pro val lys thr ala thr GTA CGT ACG TGG ACT TCC A T T ATT GAG TGT A T A TCA GCG GTC GGG GTT GTC CTC CAT CCG CTC GTT ATA TTC AAA val arg thr trp thr set lle ile glu cys ile ser ala val gly val val leu his pro leu val ile phe lys GCG A A A ACG ATT CAA GAG C A A TGG TTC CGA CGC GAA TTT T T A CAG A A G CAC CTT GGT TGG CAA GTT ACC TTC TCA ala lys thr ile gln glu gln t r p phe arg arg glu phe leu gln lys his leu gly trp gln val thr phe set A A A A A T GGC TGG ACG AGC A A C TCT A T T GCG TTA GAG TGG CTT GAG A A G GTA TTC CTT CCC CAA A C G GCT CCT GCA lys asn gly trp thr set asn set ile ala leu glu trp leu glu lys val phe leu pro gln thr ala pro ala GAT CCA GCT GAT GCC CGT TTA TTA ATC GTT GAC GGC CAT GGC TCG CAT GCA ACC GAG CAA TTC ATG GCC AAG TGT asp pro ala asp ala arg leu leu ile val asp gly his gly set his ala thr glu gln phe met ala lys cys TAC C T G A A C AAT GTT TAT CTT CTC TTT TTA CCG GCA CAT TGT TCT CAT GTA CTC CAG CCT TTA GAT CTC GGT TGC tyr leg ash asn val tyr leu leu phe leu pro ala his cys ser his val leu gln pro leu asp leu gly cys TTT TCT AGT CTG A A G GCG GCG TAC CGT ACT TTG GTT GGC GAG CAT A C C GCT CTG ACG GAT TCT A C C CGG GTT GGG phe set set leu lys ala ala tyr arg thr leu val gly glu his thr ala leu thr asp set thr arg val gly AAG C A A AGG TTT CTC GAT TTT TAT GCG AGA GCC CGC GAA ATC GGT TTC CGG A A G GTA AAT A T T CGA TCT GGA TGG lys gln arg phe leu asp phe tyr ala arg ala arg glu ile gly phe arg lys val asn lle ar~ ser gly trp CGG GCA GCT GGC TTA TGG CCT GTG A A T ATT AAC AAA CCG CTC GCT TCG CGT TGG GTG ATG GTG CTC ACG AAG TCG arg ala ala gly leu trp pro val ash ile ash lys pro leu ala ser arg trp val met val leu thr lys ser GCA C T A CCT CCC TCA GAA A C T CTC GAT ATC GCA ACG CCA AAG CGT GGC GGC GAC GTT GTA AAG CTT TTC TCT GCC ala leu pro pro ser glu thr leu asp ile ala thr pro lys arg gly gly asp val val lys leu phe ser ala AAA AGC AGC TCT CCT TCT T C A CGG CTC TCA ATT CGA AAA GCG GCT GCG GCG TTA GAC AAG GTT GCA ATC GAG CTC lys set ser ser pro ser ser arg leu ser ile arg lys ala ala ala ala leu asp lys val ala ile glu leu GCG ATG A A A GAC CGC GAA ATT GAG CGG TTA CGC GCT CAG CTT GAA GCG GCG CAA CCG A A G A A A A A A CGG AAA ATC ala met lys asp arg glu ile glu arg leu arg ala gln leu glu ala ala gln pro lys lys lys arg lys ile AGG CAG GAT CCG AAC GAA TGC TTT A T A AGC CTC GCA CAG A T A CTT GCA GAG GCC AAT CGC GAG CCT GAT CAA CGT arg gln asp pro asn glu cys phe ile ser leu ala gln ile leu ala glu ala ash arg glu pro asp gln arg GTT ATT CAG TCA CAG AAA GGC GAT CTT GAT TGT ATT GTG GTG GAT GGG A A A AGT AGC TCT GAG TCG GAG GAA GAT val lle gln ser gln lys g l y asp leu asp cys ile val val asp gly lys ser set set glu ser glu glu a s p CCA GCC CCT GTG CGC CGA T C A A C C CGC GTC AGG CGC GCT A C A AAA A T G TAT ATT A G A CAG GAT TTG AGT AGC GAA pro ala pro val arg arg ser thr arq val arg arg ala thr lys met tyr ile arg gln asp leu set ser glu GAG AGC GAT TGA G A G A C • T T T A A A T A C C A T T T T C T C T G C A T T T T T A G C T A T T T A T T T G A C A A A G T T G T G T T A A A A T A T T G T A A A T A G A T C G A T G G glu ser asp ATTTTCTGAGTCTTGCAGGTGGGTCGGTTACCAGGGGGGGTCGGTTACATGGGTGCTTGACT O

Fig. 3 a

15 b

Wild-type

AAGCCCTGTCTTAGAGGATCAGGG

m37

AAGCCCTGTCTTAagtcaagc

Revertant

AAGCCCTGTCTTAatTAGAGGATCAGGG

........ FOT .......... g c £ t g a c t T A G A G G A T C A G G G

Fig. 3. a Complete sequence of Fotl-37. This was determined by the dideoxy chain termination method using a T7 sequencing kit (Pharmacia). Both strands were sequenced at least once. Bases are numbered from 5' to 3'. The underlined sequences are the 44 bp inverted terminal repeats (ITRs). The single mismatch between the ITRs is identified by (o). The 13 bp perfect direct repeats in the

ITRs are overlined. The amino acid sequence is shown beneath the proposed open reading frame, b Comparison of the wild type, niaD37 and two wild-type revertants of niaD37. The sequence duplicated during the insertion of Fotl-37 is shown in bold-face. Fotl-37 sequences are in italics. Upper case letters represent Aspergillus nidulans DNA

wild-type sequence (Fig. 3b). These T A dinucleotides might represent a duplication of the target site that is formed during insertion. However, since T A itself is an inverted repeat, these nucleotides might be part of F o t l 37. Certain features of F o t l , such as its relatively small size, the presence of perfect short terminal repeats and the T A target site duplication associated with insertion, are reminiscent of the Tcl element of Caenorhabditis elegans (Emmons et al. 1983; Rosenzweig etal. 1983; H e r m a n and Shaw 1987), the Barney element of Caenorhabditis briggsae (Harris et al. 1988), and the mariner (Jacobson et al. 1986), HB1 (Brierly and Potter 1985) and U h u (Brezinsky et al. 1990) elements of Drosophila species. Despite these structural similarities, no significant sequence h o m o l o g y was found between F o t l - 3 7 and such elements (Harris et al. 1988; Brezinsky et al. 1990). D N A sequencing also enabled us to locate Fotl precisely in niaD37; it resides in intron 3 of the niaD gene. The fact that niaD37 exhibits a null phenotype suggests that splicing of the intron m a y be prevented by the presence of F o t l and/or that the insertion of F o t l m a y generate an early transcription termination signal. In order to determine whether F o t l excises precisely or not, D N A sequences of two revertants from niaD37 were determined. Polymerase chain reactions were carried out using primers flanking the F o t l - 3 7 insertion site. Sequence data show that excision of Fot1-37 is imprecise in the two revertants (Fig. 3 b). In both, the presumptive 2 bp T A duplication was preserved plus 2 bp (AT) from the ends of Fot1-37. The two excision products retained a 4 bp insertion relative to the wild-type gene ( T A A T T A versus TA). These preliminary data suggest that F o t l , like some other transposons (Eide and Anderson 1988; Bryan et al. 1990), does not excise precisely. The insertion studied, however, is in an intron and, therefore, the footprint left does not affect the functionality of the niaD gene. When Fotl was inserted in an exon as observed in niaD62, one would expect to detect only precise excisions or excisions leaving multiples of 3 bp which maintain the translational reading frame. To our knowledge, Fotl is the first transposable element in fungi reported to show a structure similar to that of other transposons. It shares structural similarities with other transposable elements, particularly the widely dispersed class of Tcl-like elements. The original situation we created to trap this element, that is the screening of unstable mutations in an exogenous gene, could be extended to other organisms in which cloned genes are

not available. This nia gene used successfully as a transposable element trap in F. oxysporum and Nicotiana tabacum (Grandbastien et al. 1989) would be of general application. The ability of F o t l to induce mutations by insertion and/or imprecise excision could account for the features of mutability and instability associated with the stock analysed. This demonstrates that transposable element activity m a y be a source of genetic variability in this species.

Acknowledgements. We would like to thank Jean Luc Rossignol, Michel Caboche and Mick Chandler for critical evaluation of the manuscript and Catherine Gerlinger for technical assistance. This work was supported by a grant from C.N.R.S.

References Brezinsky L, Wang GVL, Humphreys T, Hunt J (1990) The transposable element Uhu from Hawaiian Drosophila - member of the widely dispersed class of Tcl-like transposons. Nucleic Acids Res 18:2053-2059 Brierley HL, Potter SS (1985) Distinct characterics of loop sequences of two Drosophila foldback transposable elements. Nucleic Acids Res 13 :485-500 Bryan G, Garza D, Hartl D (1990) Insertion and excision of the transposable element mariner in Drosophila. Genetics 125:103114 Burnett JH (1984) Aspects of Fusarium genetics. In: Moss MO, Smith JE (eds) The applied mycology of fusarium. Cambridge University Press, New York, pp 39-69 Cove DJ (1976) Chlorate toxicity in Aspergillus nidulans: the selection and characterisation of chlorate resistant mutants. Heredity 36:191-203 D6ring HP, Starlinger P (1986) Molecular genetics of transposable elements in plants. Annu Rev Genet 20:175-200 Eide D, Anderson P (1988) Insertion and excision of the C. elegans transposable element Tcl. Mol Cell Biol 8:737-746 Emmons SW, Yesner L, Ruan K, Katzenberg D (1983) Evidence for a transposon in Caenorhabditis elegans. Cell 32:55-65 Grandbastien MA, Spielmann A, Caboche M (1989) Tntl, a mobile retroviral-like transposable element of tobacco isolated by plant cell genetics. Nature 376-380 Green MM (1988) Mobile DNA elements and spontaneous gene mutation. In: Lambert ME, McDonald JF, Weinstein IB (eds) Eukaryotic transposable elements as mutagenic agents. (Banbury report 30) Cold Spring Harbor Laboratory Press, New York, pp 41-50 Harris LJ, Baillie L, Rose AM (1988) Sequence identity between an inverted repeat family of transposable elements in Drosophila and Caenorhabditis. Nucleic Acids Res 16:5991-5999 Herman RK, Shaw JE (1987) The transposable genetic element Tcl in the nematode Caenorhabditis elegans. Trends Genet 3 :222-225

16 Jacobson JW, Medhora MM, Hartl DL (1986) Molecular structure of a somatically unstable transposable element in Drosophila. Proc Natl Acad Sci USA 83 : 8684-8688 Johnstone IL, MacCabe PC, Greaves P, Cole GE, Brow MAD, Gurr S, Unkles SE, Clutterbuck A J, Kinghorn JR, Innis MA (1990) Isolation and characterisation of the crunA- n i i A - niaD gene cluster for nitrate assimilation in Aspergillus nidulans. Gene 90 : 181-192 Kinsey JA, Helber J (1989) Isolation of a transposable element from Neurospora crassa. Proc Nail Acad Sci USA 86:19291933 Lillis M, Freeling M (1986) Mu transposition in maize. Trends Genet 183-188 McHale MT, Roberts IA, Talbot NJ, Oliver RP (1989) Expression of reverse transcriptase genes in Fulviafulva. Mol Plant Microb Interact 2:165-168

Malardier L, Daboussi M J, Julien J, Roussel F, Scazzocchio C, Brygoo Y (1989) Cloning of the nitrate reductase gene (niaD) of Aspergillus nidulans and its use for transformation of Fusarium oxysporum. Gene 78 : 147-156 Rosenzweig B, Lioa LW, Hirsh D (1983) Sequence of the C. elegans transposable element Tcl. Nucleic Acids Res 11 : 4201-4209 Valent B, Chumley FG (1991) Molecular genetic analysis of the rice blast fungus, Magnaporthe grisea. Annu Rev Phytopathol, in press Whitehead MP, Gurr J J, Grieve C, Unkles SE, Spence D, Ramsden M, Kinghorn JR (1990) Homologous transformation of Cephalosporium aeremonium with the nitrate reductase-encoding gene (niaD) Gene 90:193-198 C o m m u n i c a t e d by W. G a j e w s k i