Original Article
Granzyme B gene polymorphisms, colorectal cancer risk, and metastasis ABSTRACT Context: The human granzyme B protein (GrB), which is encoded by granzyme B gene (GZMB), plays a major role in eliminating cancer cells. Polymorphisms of GZMB gene such as Q55R, P94A, and Y247H have been shown to affect GrB activity and the subsequent cancer risk. Aims: In this study, we examined possible association between GZMB gene polymorphisms and susceptibility to colorectal cancer (CRC). In addition, the contribution of the examined polymorphisms to colorectal cancer metastasis to lymph node and distant organ was investigated. Materials and Methods: A total of 50 venous blood samples collected from CRC patients were analyzed to identify the Q55R, P94A, and Y247H polymorphisms. As a control group, 20 healthy subjects were enrolled in the study. The Q55R, P94A, and Y247H polymorphisms were genotyped by polymerase chain reaction and sequencing method. Statistical Analysis: Data analysis was carried out using the statistical package SPSS version 17 to compute all descriptive statistics. Chi‑square and Fisher exact tests (if the expected value in any cell is less than 5) were used to evaluate the genotype distribution and allele frequencies of the studied polymorphism. Results: The results revealed that the distribution of Q55R, P94A, and Y247H are not significantly different in CRC patients compared to the controls. In addition, no association between Q55R, P94A, and Y247H polymorphisms and its metastasis to lymph node and distant organ was detected. Conclusions: These results suggest that GZMB Q55R, P94A, and Y247H polymorphisms are not significantly associated with colon cancer incidence, or metastasis to lymph node and distant organ. However, this study was limited by its relatively small sample size; thus, to confirm current findings, a bigger multicenter design study is warranted.
Nizar M. Mhaidat, Sayer I. Al‑azzam, Karem H. Alzoubi, Omar F. Khabour1, Baraa F. Gharaibeh Departments of Clinical Pharmacy and 1 Medical Laboratory Sciences, Jordan University of Science and Technology, Irbid, Jordan For correspondence: Dr. Nizar M. Mhaidat, Department of Clinical Pharmacy, Faculty of Pharmacy, Jordan University of Science and Technology, Irbid‑22110, Jordan. E‑mail: [email protected]
KEY WORDS: Colon cancer, granzyme B gene, P94A, Q55R, Y247H
INTRODUCTION Colorectal cancer (CRC) is the third most common malignancy in the developed countries and represents the third leading cause of death from cancer in the United State.[1] In Jordan, CRC is the most common cancer in males and the second after breast cancer in females.[2] The goal of CRC cancer treatment depends on the stage of the disease at the time of diagnosis. Stages I, II, and III are potentially curable, whereas most stage IV disease is incurable and the aim of treatment is palliative.[2] It is believed that the immune system has the ability to eradicate the infected or transformed cells. This is largely mediated through the action of natural killer (NK) and cytotoxic T lymphocyte (CTLs) cells. The main mechanism of cell death induced by NK or CTLs is the release of granzyme B protein (GrB) and perforin granules into the target cell.[3] GrB is localized as zymogen (inactive precursor) inside
endosomes, and is activated by cathepsins to produce full active GrB.[4] The released perforin disrupts the lipid membrane of the target cell forming pores via which GrB enters target cell.[5] Pores formation in the target cell membrane affects cellular fluidity and content. In addition, GrB activates a cascade of caspases that degrade various cellular proteins and initiate cell apoptosis. GrB is suggested to play a role in metastasis of CRC to other organs. For example, it has been shown that low levels of GrB were associated with early signs of metastasis in CRC.[6] Similarly, Pages et al. (2007) showed using quantitative real‑time PCR that GrB mRNA levels were lower in CRC that showed signs of early metastasis.[7]
Access this article online Website: www.cancerjournal.net DOI: 10.4103/0973-1482.137940 PMID: *** Quick Response Code:
GZMB gene, which encodes GrB protein, contains five exons with several single nucleotide polymorphisms (SNPs) identified according to ensemble global web site. Q55R polymorphism in exon two, P94A polymorphism in exon three, and
Journal of Cancer Research and Therapeutics - July-September 2014 - Volume 10 - Issue 3
587
Mhaidat, et al.: Granzyme B and colorectal cancer
Y247H polymorphism in exon five are the most commonly studied SNPs. For example, in a cohort study in newly diagnosed breast cancer patients, it has been found that the presence of GZMB RAH alleles increase the risk of breast cancer development compared to those with the QPY alleles.[8] In here, we investigated the association between the GZMB Q55R, P94A, and Y247H polymorphism and CRC, and lymph node and distant organ metastasis. MATERIALS AND METHODS This is a comparative cross‑sectional study approved by the institutional review board (IRB). Additionally, the study procedure confirmed with the Helsinki Declaration of 1975, as revised in 2000. We included for the first group, patients positively diagnosed with CRC and treated at a tertiary University Hospital. The second group, we included healthy volunteers with no previous history of any chronic disease and with matching age and gender to the patients. Excluded from the patients group were those with chronic disease other than colorectal cancer or any hereditary disease. Excluded from the control groups were patient with any chronic health condition including CRC, those with previous cancer diagnosis, history drug abuse, or major surgery. After signing the informed consent, 3 ml venous blood samples were withdrawn by registered nurses from each participant and stored in EDTA blood tube at ‑20°C for later molecular genotyping analysis. Patient’s medical profiles were reviewed for further collection and confirmation of patient’s demographics, anthropometric, biochemical, and clinical history. DNA was extracted from venous blood samples using Promega wizard genomic DNA purification kit (Promega, Madison, USA) according to standard protocol provided by the manufacturer. DNA samples were stored at ‑20°C until used. Polymorphisms of Q55R, P94A, and Q247Y in exons two, three, and five, respectively, were analyzed using polymerase chain reaction (PCR) followed by DNA purification. Desired DNA target sequence was amplified using appropriate forward and reverse primers [Table 1]. The reaction mixture of 25 µl contained 3 ng of genomic DNA, 1 µM of each primer, green master mix (Promega), and de‑ionized water. The reaction mixture was initially denatured at 95°C for eight minutes, followed by 40 cycle of denaturation at 95°C for 1.5 min, annealing at appropriate temperature [Table 1] for 1.5 min, extension at 72°C for 1.5 min. Successful amplification was confirmed by detection of desired target DNA target length on two percent agrose gel using 100 pb DNA ladder. PCR amplified fragments were purified using PCR clean up column kit (BIO BASIC INC, Ontario, Canada). Sequencing of purified DNA was performed using ABI Prism 3.1 automated sequencer (Applied Biosystems, Foster City, CA, USA). 588
Sequencing results were analyzed using chromaspro software 1.34. Reference sequence of each fragment of GrB gene was obtained from ensemble genome browser and aligned with sequencing electopherograms. Numbers and codon of amino acid polymorphisms in GrB gene are available at website (http://www.ensembl.org). Data analysis was carried out using the statistical package for social studies SPSS version 17. The Pearson Chi‑square and Fisher exact tests (if the expected value in any cell is less than 5) were used to test the genotype distribution and allele frequencies of the studied polymorphism between patients with CRC and the controls. Variable age between the two groups was compared using independent t‑test. Tests with P value less than 0.05 (2‑tailed) were considered statistically significant. RESULTS A total of 50 CRC patients (40% were males) with median age of 51 years were included in this study. Healthy adult volunteers (n = 20, 55% were males) were included as control group with similar median age of the patients group. The differences in gender and age between patient and control groups were not statistically significant [Table 2]. Table 1: Appropriate forward, reverse primer, annealing temperature, and desired DNA target length for Q55R genotype, P94A genotype, and Y247H genotype Polymorphisms Primers (5’‑3’) Q55R
P94A
Y247H
Forward primer: agtgtttccaggagggtgtg Reverse primer: ttttccttcaggggagatca Forward primer: cctcacctgcagtagcatga Reverse primer: cccatcctcactctgctctc Forward primer: tctcccacatgtaggctgtg Reverse primer: gatgtggtgcctgagaatga
Annealing Desired DNA temperature target length 58°C 199 bp
56°C
169 bp
60°C
400 bp
Table 2: Demographic criteria of the patients Variable Number Age Gender Males Females Lymph node metastasis Yes No Missing data Distant organ metastasis Yes No Missing data
Group N (%) Patient 50 51.62±10.87
Control 20 51.35±11.6
20 (40%) 30 (60%)
11 (55%) 9 (45%)
P value
0.929 0.295
45 (90%) 4 (8%) 1 26 (52%) 23 (46%) 1
Journal of Cancer Research and Therapeutics - July-September 2014 - Volume 10 - Issue 3
Mhaidat, et al.: Granzyme B and colorectal cancer
Results in Table 3 showed that there was no significant difference in Q55R, P94A, Y247H genotypes between the patient and the control group (P = 0.586, P = 0.290, P = 0.593, respectively). Similarly, no significant difference of Q55R, P94A, and Y247H alleles between the patient and the control groups (P = 0.691, P = 0.396, P = 0.445, respectively). Table 4 shows the genotype and allele frequencies of Q55R, P94A, and Y247H polymorphisms among patients with distant organ metastasis and those without distant organ metastasis. No significant difference in Q55R, P94A, and Y247H genotypes was found between the two groups (P = 0.776, P = 0.776, P = 0.621, respectively). Similarly, no significant difference of Q55R, P94A, and Y247H alleles between the two groups (P = 0.444, P = 1.000, P = 1.000, respectively). Similar to distance organ, distribution of genotype and allele frequencies of Q55R, P94A, and Y247H, SNPs was similar between patients with lymph node metastasis and patients without metastasis (Table 5; genotypes P values: P =0.636, P = 1.000, P = 1.000, respectively; alleles P values: P =0.466, P = 1.000, P = 0.855, respectively).
DISCUSSION The Q55R polymorphism in exon two, P94A polymorphism in exon three, and Y247H polymorphism in exon five are the most studied polymorphisms in GZMB gene.[8‑11] These polymorphisms have been previously linked to the occurrence of other cancers or immunological diseases. [8] Current results, however, show lack of association between these polymorphisms and the occurrence of CRC. The Q55R polymorphism of GZMB was previously associated with increased in vitro expression of GrB. [12] One study has identified a mutated GZMB allele responsible for the substitution of three amino acids (R48A88H245) that encodes for a stable protein.[9] However, the impact of Q55R SNP on cytolytic function of GrB is still controversial. One report showed that R48A88H245 allele was incapable of apoptosis in vivo,[9] while others showed that this allele retained the biochemical and cytotoxic function of the wild type variant.[10,11] A previous study has linked mutated RAH haplotype with breast cancer patients.[8] However, current results did not show a correlation between Q55R polymorphism and the occurrence of CRC.
Table 3: Genotype and allele frequencies of Q55R, P94A, Y247H polymorphisms among patient and control groups SNP Genotypes Q55R QQ QR RR Allele Allele Q Allele R
Groups Patient
Control
P value
20 (40) 29 (58) 1 (2)
6 (30) 14 (70) 0 (0)
0.776
69 (69) 31 (31)
26 (65) 14 (35)
0.444
SNP P94A
Groups Patient
Control
P value
PP PA AA
26 (52) 24 (48) 0 (0)
7 (35) 13 (65) 0 (0)
0.776
Allele P Allele A
76 (76) 24 (24)
27 (67.5) 13 (32.5)
1.000
SNP Y247H
Groups Patient
Control
P value
YY YH HH
17 (34) 29 (58) 4 (8)
4 (20) 14 (70) 2 (10)
0.621
Allele Y Allele H
63 (63) 37 (37)
22 (55) 16 (40)
1.000
Values are presented as n (%)
Table 4: Genotype and allele frequencies of Q55R, P94A, Y247H polymorphisms among patient group according to distant organ metastasis SNP Genotypes Q55R QQ QR RR Allele Allele Q Allele R
Distant organ metastasis Yes
No
P value
12 (46.2) 14 (53.8) 0 (0)
8 (34.8) 14 (60.9) 1 (4.3)
0.776
38 (73) 14 (26.9)
30 (65) 16 (34.8)
0.466
SNP P94A
Distant organ metastasis Yes
No
P value
PP PA AA
13 (50) 13 (50) 0 (0)
13 (56.5) 10 (43.4) 0 (0)
0.776
Allele P Allele A
39 (75) 13 (25)
36 (78.2) 10 (21.7)
1.000
SNP Y247H
Distant organ metastasis Yes
No
P value
YY YH HH
9 (34.6) 16 (61.5) 1 (3.8)
8 (34.8) 12 (52.2) 3 (13)
0.621
Allele Y Allele H
34 (65.4) 18 (34.6)
28 (60.8) 18 (39.1)
0.885
Values are presented as n (%)
Table 5: Genotype and allele frequencies of Q55R, P94A, Y247H polymorphisms among patient group according to lymph node metastasis SNP Genotypes Q55R QQ QR RR Allele Allele Q Allele R
Lymph node metastasis Yes
No
P value
19 (42.2) 25 (55.5) 1 (2.2)
1 (25) 3 (75) 0 (0)
0.636
64 (71.1) 28 (31.1)
5 (62.5) 3 (37.5)
0.466
SNP P94A
Lymph node metastasis Yes
No
P value
PP PA AA
24 (53.3) 21 (46.6) 0 (0)
2 (50) 2 (50) 0 (0)
0.100
Allele P Allele A
69 (76.6) 21 (23.3)
6 (75) 2 (25)
1.000
SNP Y247H
Lymph node metastasis Yes
No
P value
YY YH HH
16 (35.5) 25 (55.6) 4 (8.8)
1 (25) 3 (75) 0 (0)
0.100
Allele Y Allele H
41 (45.6) 33 (36.7)
5 (62.5) 3 (37.5)
0.855
Values are presented as n (%)
Journal of Cancer Research and Therapeutics - July-September 2014 - Volume 10 - Issue 3
589
Mhaidat, et al.: Granzyme B and colorectal cancer
The P94A polymorphism in exon three and Y247H polymorphism in exon five of GZMB gene were also linked to breast cancer.[8] Cytotoxic immune effect was more profound in donors with wild QPY/QPY compared with donors with RAH/RAH. Thus, the reduction in GZMB polymorphism is associated with defective immune response, which facilitates the development of timorous cell in breast tissues.[8] However, such sequence seems to be non‑existent in colorectal tissues and among CRC patients. This is evident by the lack of association between the major GZMB gene polymorphisms and CRC occurrence that is observed in the current study. In this study, we only investigated the major polymorphisms in GZMB gene. However, polymorphisms in GZMB gene other than the examined ones might be linked to CRC in the studied population. Alternatively, the small sample size might mask the expected association between examined SNPs and CRC. In addition, the observed lack of association does not indicate the possible role for such SNPs in the risk and the response to treatment in various cancers. This issue requires several future studies to be covered. In conclusion, it was shown that GZMB gene polymorphisms, namely, the Q55R polymorphism in exon two, P94A polymorphism in exon three, and Y247H polymorphism in exon five, were not significantly associated with the occurrence of CRC. However, this study was limited by its relatively small sample size; thus, to confirm current findings, a bigger multicenter design study is warranted.
review of treatment guidelines for metastatic colorectal cancer. Colorectal Dis 2012;14:e31‑47. 3. Wowk ME, Trapani JA. Cytotoxic activity of the lymphocyte toxin granzyme B. Microbes Infect 2004;6:752‑8. 4. Smyth MJ, McGuire MJ, Thia KY. Expression of recombinant human granzyme B. A processing and activation role for dipeptidyl peptidase I. J Immunol 1995;154:6299‑305. 5. Motyka B, Korbutt G, Pinkoski MJ, Heibein JA, Caputo A, Hobman M, et al. Mannose 6‑phosphate/insulin‑like growth factor II receptor is a death receptor for granzyme B during cytotoxic T cell‑induced apoptosis. Cell 2000;103:491‑500. 6. Salama P, Phillips M, Platell C, Iacopetta B. Low expression of granzyme B in colorectal cancer is associated with signs of early metastastic invasion. Histopathology 2011;59:207‑15. 7. Pages F, Berger A, Camus M, Sanchez‑Cabo F, Costes A, Molidor R, et al. Effector memory T cells, early metastasis, and survival in colorectal cancer. N Engl J Med 2005;353:2654‑66. 8. Gaafar A, Aljurf MD, Al‑Sulaiman A, Iqniebi A, Manogaran PS, Mohamed GE, et al. Defective gammadelta T‑cell function and granzyme B gene polymorphism in a cohort of newly diagnosed breast cancer patients. Exp Hematol 2009;37:838‑48. 9. McIlroy D, Cartron PF, Tuffery P, Dudoit Y, Samri A, Autran B, et al. A triple‑mutated allele of granzyme B incapable of inducing apoptosis. Proc Natl Acad Sci U S A 2003;100:2562‑7. 10. Zaitsu M, Yamamoto K, Ishii E, Teramura T, Nakadate N, Sako M, et al. High frequency of QPY allele and linkage disequilibrium of granzyme‑B in Epstein‑Barr‑virus‑associated hemophagocytic lymphohistiocytosis. Tissue Antigens 2004;64:611‑5. 11. Sun J, Bird CH, Thia KY, Matthews AY, Trapani JA, Bird PI. Granzyme B encoded by the commonly occurring human RAH allele retains pro‑apoptotic activity. J Biol Chem 2004;279:16907‑11. 12. Girnita DM, Webber SA, Brooks MM, Ferrell R, Girnita AL, Burckart GJ, et al. Genotypic variation and phenotypic characterization of granzyme B gene polymorphisms. Transplantation 2009;87:1801‑6.
REFERENCES
Cite this article as: Mhaidat NM, Al-azzam SI, Alzoubi KH, Khabour OF, Gharaibeh BF. Granzyme B gene polymorphisms, colorectal cancer risk, and metastasis. J Can Res Ther 2014;10:587-90.
1. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Murray T, et al. Cancer statistics, 2008. CA Cancer J Clin 2008;58:71‑96. 2. Edwards MS, Chadda SD, Zhao Z, Barber BL, Sykes DP. A systematic
Source of Support: This project was supported from Deanship of Research at Jordan University of Science and Technology, Irbid, Jordan, Conflict of Interest: None declared.
590
Journal of Cancer Research and Therapeutics - July-September 2014 - Volume 10 - Issue 3
Copyright of Journal of Cancer Research & Therapeutics is the property of Medknow Publications & Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
Granzyme B gene polymorphisms, colorectal cancer risk, and metastasis ABSTRACT Context: The human granzyme B protein (GrB), which is encoded by granzyme B gene (GZMB), plays a major role in eliminating cancer cells. Polymorphisms of GZMB gene such as Q55R, P94A, and Y247H have been shown to affect GrB activity and the subsequent cancer risk. Aims: In this study, we examined possible association between GZMB gene polymorphisms and susceptibility to colorectal cancer (CRC). In addition, the contribution of the examined polymorphisms to colorectal cancer metastasis to lymph node and distant organ was investigated. Materials and Methods: A total of 50 venous blood samples collected from CRC patients were analyzed to identify the Q55R, P94A, and Y247H polymorphisms. As a control group, 20 healthy subjects were enrolled in the study. The Q55R, P94A, and Y247H polymorphisms were genotyped by polymerase chain reaction and sequencing method. Statistical Analysis: Data analysis was carried out using the statistical package SPSS version 17 to compute all descriptive statistics. Chi‑square and Fisher exact tests (if the expected value in any cell is less than 5) were used to evaluate the genotype distribution and allele frequencies of the studied polymorphism. Results: The results revealed that the distribution of Q55R, P94A, and Y247H are not significantly different in CRC patients compared to the controls. In addition, no association between Q55R, P94A, and Y247H polymorphisms and its metastasis to lymph node and distant organ was detected. Conclusions: These results suggest that GZMB Q55R, P94A, and Y247H polymorphisms are not significantly associated with colon cancer incidence, or metastasis to lymph node and distant organ. However, this study was limited by its relatively small sample size; thus, to confirm current findings, a bigger multicenter design study is warranted.
Nizar M. Mhaidat, Sayer I. Al‑azzam, Karem H. Alzoubi, Omar F. Khabour1, Baraa F. Gharaibeh Departments of Clinical Pharmacy and 1 Medical Laboratory Sciences, Jordan University of Science and Technology, Irbid, Jordan For correspondence: Dr. Nizar M. Mhaidat, Department of Clinical Pharmacy, Faculty of Pharmacy, Jordan University of Science and Technology, Irbid‑22110, Jordan. E‑mail: [email protected]
KEY WORDS: Colon cancer, granzyme B gene, P94A, Q55R, Y247H
INTRODUCTION Colorectal cancer (CRC) is the third most common malignancy in the developed countries and represents the third leading cause of death from cancer in the United State.[1] In Jordan, CRC is the most common cancer in males and the second after breast cancer in females.[2] The goal of CRC cancer treatment depends on the stage of the disease at the time of diagnosis. Stages I, II, and III are potentially curable, whereas most stage IV disease is incurable and the aim of treatment is palliative.[2] It is believed that the immune system has the ability to eradicate the infected or transformed cells. This is largely mediated through the action of natural killer (NK) and cytotoxic T lymphocyte (CTLs) cells. The main mechanism of cell death induced by NK or CTLs is the release of granzyme B protein (GrB) and perforin granules into the target cell.[3] GrB is localized as zymogen (inactive precursor) inside
endosomes, and is activated by cathepsins to produce full active GrB.[4] The released perforin disrupts the lipid membrane of the target cell forming pores via which GrB enters target cell.[5] Pores formation in the target cell membrane affects cellular fluidity and content. In addition, GrB activates a cascade of caspases that degrade various cellular proteins and initiate cell apoptosis. GrB is suggested to play a role in metastasis of CRC to other organs. For example, it has been shown that low levels of GrB were associated with early signs of metastasis in CRC.[6] Similarly, Pages et al. (2007) showed using quantitative real‑time PCR that GrB mRNA levels were lower in CRC that showed signs of early metastasis.[7]
Access this article online Website: www.cancerjournal.net DOI: 10.4103/0973-1482.137940 PMID: *** Quick Response Code:
GZMB gene, which encodes GrB protein, contains five exons with several single nucleotide polymorphisms (SNPs) identified according to ensemble global web site. Q55R polymorphism in exon two, P94A polymorphism in exon three, and
Journal of Cancer Research and Therapeutics - July-September 2014 - Volume 10 - Issue 3
587
Mhaidat, et al.: Granzyme B and colorectal cancer
Y247H polymorphism in exon five are the most commonly studied SNPs. For example, in a cohort study in newly diagnosed breast cancer patients, it has been found that the presence of GZMB RAH alleles increase the risk of breast cancer development compared to those with the QPY alleles.[8] In here, we investigated the association between the GZMB Q55R, P94A, and Y247H polymorphism and CRC, and lymph node and distant organ metastasis. MATERIALS AND METHODS This is a comparative cross‑sectional study approved by the institutional review board (IRB). Additionally, the study procedure confirmed with the Helsinki Declaration of 1975, as revised in 2000. We included for the first group, patients positively diagnosed with CRC and treated at a tertiary University Hospital. The second group, we included healthy volunteers with no previous history of any chronic disease and with matching age and gender to the patients. Excluded from the patients group were those with chronic disease other than colorectal cancer or any hereditary disease. Excluded from the control groups were patient with any chronic health condition including CRC, those with previous cancer diagnosis, history drug abuse, or major surgery. After signing the informed consent, 3 ml venous blood samples were withdrawn by registered nurses from each participant and stored in EDTA blood tube at ‑20°C for later molecular genotyping analysis. Patient’s medical profiles were reviewed for further collection and confirmation of patient’s demographics, anthropometric, biochemical, and clinical history. DNA was extracted from venous blood samples using Promega wizard genomic DNA purification kit (Promega, Madison, USA) according to standard protocol provided by the manufacturer. DNA samples were stored at ‑20°C until used. Polymorphisms of Q55R, P94A, and Q247Y in exons two, three, and five, respectively, were analyzed using polymerase chain reaction (PCR) followed by DNA purification. Desired DNA target sequence was amplified using appropriate forward and reverse primers [Table 1]. The reaction mixture of 25 µl contained 3 ng of genomic DNA, 1 µM of each primer, green master mix (Promega), and de‑ionized water. The reaction mixture was initially denatured at 95°C for eight minutes, followed by 40 cycle of denaturation at 95°C for 1.5 min, annealing at appropriate temperature [Table 1] for 1.5 min, extension at 72°C for 1.5 min. Successful amplification was confirmed by detection of desired target DNA target length on two percent agrose gel using 100 pb DNA ladder. PCR amplified fragments were purified using PCR clean up column kit (BIO BASIC INC, Ontario, Canada). Sequencing of purified DNA was performed using ABI Prism 3.1 automated sequencer (Applied Biosystems, Foster City, CA, USA). 588
Sequencing results were analyzed using chromaspro software 1.34. Reference sequence of each fragment of GrB gene was obtained from ensemble genome browser and aligned with sequencing electopherograms. Numbers and codon of amino acid polymorphisms in GrB gene are available at website (http://www.ensembl.org). Data analysis was carried out using the statistical package for social studies SPSS version 17. The Pearson Chi‑square and Fisher exact tests (if the expected value in any cell is less than 5) were used to test the genotype distribution and allele frequencies of the studied polymorphism between patients with CRC and the controls. Variable age between the two groups was compared using independent t‑test. Tests with P value less than 0.05 (2‑tailed) were considered statistically significant. RESULTS A total of 50 CRC patients (40% were males) with median age of 51 years were included in this study. Healthy adult volunteers (n = 20, 55% were males) were included as control group with similar median age of the patients group. The differences in gender and age between patient and control groups were not statistically significant [Table 2]. Table 1: Appropriate forward, reverse primer, annealing temperature, and desired DNA target length for Q55R genotype, P94A genotype, and Y247H genotype Polymorphisms Primers (5’‑3’) Q55R
P94A
Y247H
Forward primer: agtgtttccaggagggtgtg Reverse primer: ttttccttcaggggagatca Forward primer: cctcacctgcagtagcatga Reverse primer: cccatcctcactctgctctc Forward primer: tctcccacatgtaggctgtg Reverse primer: gatgtggtgcctgagaatga
Annealing Desired DNA temperature target length 58°C 199 bp
56°C
169 bp
60°C
400 bp
Table 2: Demographic criteria of the patients Variable Number Age Gender Males Females Lymph node metastasis Yes No Missing data Distant organ metastasis Yes No Missing data
Group N (%) Patient 50 51.62±10.87
Control 20 51.35±11.6
20 (40%) 30 (60%)
11 (55%) 9 (45%)
P value
0.929 0.295
45 (90%) 4 (8%) 1 26 (52%) 23 (46%) 1
Journal of Cancer Research and Therapeutics - July-September 2014 - Volume 10 - Issue 3
Mhaidat, et al.: Granzyme B and colorectal cancer
Results in Table 3 showed that there was no significant difference in Q55R, P94A, Y247H genotypes between the patient and the control group (P = 0.586, P = 0.290, P = 0.593, respectively). Similarly, no significant difference of Q55R, P94A, and Y247H alleles between the patient and the control groups (P = 0.691, P = 0.396, P = 0.445, respectively). Table 4 shows the genotype and allele frequencies of Q55R, P94A, and Y247H polymorphisms among patients with distant organ metastasis and those without distant organ metastasis. No significant difference in Q55R, P94A, and Y247H genotypes was found between the two groups (P = 0.776, P = 0.776, P = 0.621, respectively). Similarly, no significant difference of Q55R, P94A, and Y247H alleles between the two groups (P = 0.444, P = 1.000, P = 1.000, respectively). Similar to distance organ, distribution of genotype and allele frequencies of Q55R, P94A, and Y247H, SNPs was similar between patients with lymph node metastasis and patients without metastasis (Table 5; genotypes P values: P =0.636, P = 1.000, P = 1.000, respectively; alleles P values: P =0.466, P = 1.000, P = 0.855, respectively).
DISCUSSION The Q55R polymorphism in exon two, P94A polymorphism in exon three, and Y247H polymorphism in exon five are the most studied polymorphisms in GZMB gene.[8‑11] These polymorphisms have been previously linked to the occurrence of other cancers or immunological diseases. [8] Current results, however, show lack of association between these polymorphisms and the occurrence of CRC. The Q55R polymorphism of GZMB was previously associated with increased in vitro expression of GrB. [12] One study has identified a mutated GZMB allele responsible for the substitution of three amino acids (R48A88H245) that encodes for a stable protein.[9] However, the impact of Q55R SNP on cytolytic function of GrB is still controversial. One report showed that R48A88H245 allele was incapable of apoptosis in vivo,[9] while others showed that this allele retained the biochemical and cytotoxic function of the wild type variant.[10,11] A previous study has linked mutated RAH haplotype with breast cancer patients.[8] However, current results did not show a correlation between Q55R polymorphism and the occurrence of CRC.
Table 3: Genotype and allele frequencies of Q55R, P94A, Y247H polymorphisms among patient and control groups SNP Genotypes Q55R QQ QR RR Allele Allele Q Allele R
Groups Patient
Control
P value
20 (40) 29 (58) 1 (2)
6 (30) 14 (70) 0 (0)
0.776
69 (69) 31 (31)
26 (65) 14 (35)
0.444
SNP P94A
Groups Patient
Control
P value
PP PA AA
26 (52) 24 (48) 0 (0)
7 (35) 13 (65) 0 (0)
0.776
Allele P Allele A
76 (76) 24 (24)
27 (67.5) 13 (32.5)
1.000
SNP Y247H
Groups Patient
Control
P value
YY YH HH
17 (34) 29 (58) 4 (8)
4 (20) 14 (70) 2 (10)
0.621
Allele Y Allele H
63 (63) 37 (37)
22 (55) 16 (40)
1.000
Values are presented as n (%)
Table 4: Genotype and allele frequencies of Q55R, P94A, Y247H polymorphisms among patient group according to distant organ metastasis SNP Genotypes Q55R QQ QR RR Allele Allele Q Allele R
Distant organ metastasis Yes
No
P value
12 (46.2) 14 (53.8) 0 (0)
8 (34.8) 14 (60.9) 1 (4.3)
0.776
38 (73) 14 (26.9)
30 (65) 16 (34.8)
0.466
SNP P94A
Distant organ metastasis Yes
No
P value
PP PA AA
13 (50) 13 (50) 0 (0)
13 (56.5) 10 (43.4) 0 (0)
0.776
Allele P Allele A
39 (75) 13 (25)
36 (78.2) 10 (21.7)
1.000
SNP Y247H
Distant organ metastasis Yes
No
P value
YY YH HH
9 (34.6) 16 (61.5) 1 (3.8)
8 (34.8) 12 (52.2) 3 (13)
0.621
Allele Y Allele H
34 (65.4) 18 (34.6)
28 (60.8) 18 (39.1)
0.885
Values are presented as n (%)
Table 5: Genotype and allele frequencies of Q55R, P94A, Y247H polymorphisms among patient group according to lymph node metastasis SNP Genotypes Q55R QQ QR RR Allele Allele Q Allele R
Lymph node metastasis Yes
No
P value
19 (42.2) 25 (55.5) 1 (2.2)
1 (25) 3 (75) 0 (0)
0.636
64 (71.1) 28 (31.1)
5 (62.5) 3 (37.5)
0.466
SNP P94A
Lymph node metastasis Yes
No
P value
PP PA AA
24 (53.3) 21 (46.6) 0 (0)
2 (50) 2 (50) 0 (0)
0.100
Allele P Allele A
69 (76.6) 21 (23.3)
6 (75) 2 (25)
1.000
SNP Y247H
Lymph node metastasis Yes
No
P value
YY YH HH
16 (35.5) 25 (55.6) 4 (8.8)
1 (25) 3 (75) 0 (0)
0.100
Allele Y Allele H
41 (45.6) 33 (36.7)
5 (62.5) 3 (37.5)
0.855
Values are presented as n (%)
Journal of Cancer Research and Therapeutics - July-September 2014 - Volume 10 - Issue 3
589
Mhaidat, et al.: Granzyme B and colorectal cancer
The P94A polymorphism in exon three and Y247H polymorphism in exon five of GZMB gene were also linked to breast cancer.[8] Cytotoxic immune effect was more profound in donors with wild QPY/QPY compared with donors with RAH/RAH. Thus, the reduction in GZMB polymorphism is associated with defective immune response, which facilitates the development of timorous cell in breast tissues.[8] However, such sequence seems to be non‑existent in colorectal tissues and among CRC patients. This is evident by the lack of association between the major GZMB gene polymorphisms and CRC occurrence that is observed in the current study. In this study, we only investigated the major polymorphisms in GZMB gene. However, polymorphisms in GZMB gene other than the examined ones might be linked to CRC in the studied population. Alternatively, the small sample size might mask the expected association between examined SNPs and CRC. In addition, the observed lack of association does not indicate the possible role for such SNPs in the risk and the response to treatment in various cancers. This issue requires several future studies to be covered. In conclusion, it was shown that GZMB gene polymorphisms, namely, the Q55R polymorphism in exon two, P94A polymorphism in exon three, and Y247H polymorphism in exon five, were not significantly associated with the occurrence of CRC. However, this study was limited by its relatively small sample size; thus, to confirm current findings, a bigger multicenter design study is warranted.
review of treatment guidelines for metastatic colorectal cancer. Colorectal Dis 2012;14:e31‑47. 3. Wowk ME, Trapani JA. Cytotoxic activity of the lymphocyte toxin granzyme B. Microbes Infect 2004;6:752‑8. 4. Smyth MJ, McGuire MJ, Thia KY. Expression of recombinant human granzyme B. A processing and activation role for dipeptidyl peptidase I. J Immunol 1995;154:6299‑305. 5. Motyka B, Korbutt G, Pinkoski MJ, Heibein JA, Caputo A, Hobman M, et al. Mannose 6‑phosphate/insulin‑like growth factor II receptor is a death receptor for granzyme B during cytotoxic T cell‑induced apoptosis. Cell 2000;103:491‑500. 6. Salama P, Phillips M, Platell C, Iacopetta B. Low expression of granzyme B in colorectal cancer is associated with signs of early metastastic invasion. Histopathology 2011;59:207‑15. 7. Pages F, Berger A, Camus M, Sanchez‑Cabo F, Costes A, Molidor R, et al. Effector memory T cells, early metastasis, and survival in colorectal cancer. N Engl J Med 2005;353:2654‑66. 8. Gaafar A, Aljurf MD, Al‑Sulaiman A, Iqniebi A, Manogaran PS, Mohamed GE, et al. Defective gammadelta T‑cell function and granzyme B gene polymorphism in a cohort of newly diagnosed breast cancer patients. Exp Hematol 2009;37:838‑48. 9. McIlroy D, Cartron PF, Tuffery P, Dudoit Y, Samri A, Autran B, et al. A triple‑mutated allele of granzyme B incapable of inducing apoptosis. Proc Natl Acad Sci U S A 2003;100:2562‑7. 10. Zaitsu M, Yamamoto K, Ishii E, Teramura T, Nakadate N, Sako M, et al. High frequency of QPY allele and linkage disequilibrium of granzyme‑B in Epstein‑Barr‑virus‑associated hemophagocytic lymphohistiocytosis. Tissue Antigens 2004;64:611‑5. 11. Sun J, Bird CH, Thia KY, Matthews AY, Trapani JA, Bird PI. Granzyme B encoded by the commonly occurring human RAH allele retains pro‑apoptotic activity. J Biol Chem 2004;279:16907‑11. 12. Girnita DM, Webber SA, Brooks MM, Ferrell R, Girnita AL, Burckart GJ, et al. Genotypic variation and phenotypic characterization of granzyme B gene polymorphisms. Transplantation 2009;87:1801‑6.
REFERENCES
Cite this article as: Mhaidat NM, Al-azzam SI, Alzoubi KH, Khabour OF, Gharaibeh BF. Granzyme B gene polymorphisms, colorectal cancer risk, and metastasis. J Can Res Ther 2014;10:587-90.
1. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Murray T, et al. Cancer statistics, 2008. CA Cancer J Clin 2008;58:71‑96. 2. Edwards MS, Chadda SD, Zhao Z, Barber BL, Sykes DP. A systematic
Source of Support: This project was supported from Deanship of Research at Jordan University of Science and Technology, Irbid, Jordan, Conflict of Interest: None declared.
590
Journal of Cancer Research and Therapeutics - July-September 2014 - Volume 10 - Issue 3
Copyright of Journal of Cancer Research & Therapeutics is the property of Medknow Publications & Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
