Hemorrhagic Nephritis and Enteritis in a Goose Flock in Poland—Disease Course Analysis and Characterization of Etiologic Agent Author(s): Andrzej Gaweł, Grzegorz Woźniakowski, Elżbieta Samorek-Salamonowicz, Wojciech Kozdruń, Kamila Bobrek, Katarzyna Bobusia, and Marcin Nowak Source: Avian Diseases, 58(4):518-522. Published By: American Association of Avian Pathologists DOI: http://dx.doi.org/10.1637/10845-041014-Reg.1 URL: http://www.bioone.org/doi/full/10.1637/10845-041014-Reg.1
BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.
BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research.
AVIAN DISEASES 58:518–522, 2014
Hemorrhagic Nephritis and Enteritis in a Goose Flock in Poland—Disease Course Analysis and Characterization of Etiologic Agent Andrzej Gaweł,A Grzegorz Woz´niakowski,B Elz_bieta Samorek-Salamonowicz,B Wojciech Kozdrun´,B Kamila Bobrek,AD Katarzyna Bobusia,A and Marcin NowakC A
Department of Epizootiology and Clinic of Bird and Exotic Animals, Faculty of Veterinary Medicine, Wrocław University of Environmental and Life Sciences, pl. Grunwaldzki 45, 50-355 Wrocław, Poland B Department of Poultry Viral Diseases, National Veterinary Research Institute, Partyzantow 57 Avenue, 24-100 Pulawy, Poland C Department of Pathology, Faculty of Veterinary Medicine, Wrocław University of Environmental and Life Sciences, ul. C.K. Norwida 31, 50-375 Wrocław, Poland Received 24 April 2014; Accepted 8 July 2014; Published ahead of print 15 July 2014 SUMMARY. Hemorrhagic nephritis enteritis of geese (HNEG) is an epizootic viral disease caused by infection with goose hemorrhagic polyomavirus (GHPV) that affects domestic geese. This study describes the epizootic analysis, laboratory diagnosis, and molecular characterization of GHPV isolates associated with HNEG cases in Poland. HNEG symptoms persisted in infected flocks for 2 wk with a 32% mortality rate. Primary gross lesions included hemorrhaging of the kidneys, intestines, and lungs. Histopathologic examination confirmed HNEG and identified that the causative agent was similar to other GHPV isolates and identical to the Toulouse 2008 isolate. RESUMEN. Nefritis y enteritis hemorra´gica en una parvada de gansos en Polonia – Ana´lisis del curso de la enfermedad y caracterizacio´n del agente etiolo´gico. La nefritis y enteritis de los gansos (con las siglas en ingle´s HNEG) es una enfermedad viral epizoo´tica causada por la infeccio´n con poliomavirus hemorra´gico del ganso (GHPV) que afecta a los gansos dome´sticos. Este estudio describe el ana´lisis epizoo´tico, el diagno´stico de laboratorio y la caracterizacio´n molecular de los aislamientos del virus de la nefritis y enteritis de los gansos asociados a casos de la enfermedad en Polonia. Los signos de la nefritis y enteritis de los gansos persistieron en las parvadas infectadas por dos semanas con una tasa de mortalidad del 32%. Lesiones macrosco´picas primarias incluyeron hemorragia de los rin˜ones, los intestinos y los pulmones. El examen histopatolo´gico confirmo´ la enfermedad y se identifico´ que el agente causante era similar a otros aislamientos del virus de la nefritis y enteritis de los gansos e ide´ntico al aislamiento de Toulouse del an˜o 2008. Key words: HNEG, GHPV, geese, pathology, genomic analysis Abbreviations: GHPV 5 goose hemorrhagic polyomavirus; HNEG 5 hemorrhagic nephritis enteritis of geese
Polyomaviruses together with papillomaviruses belong to Papovaviridae family. The name originates from Greek, meaning ‘‘viruses causing numerous tumors.’’ Polyomaviruses are icosahedral-shaped DNA viruses 40–50 nm in diameter. Their genome is divided into two regions encoding five main proteins: two regulatory multifunctional T proteins (large and small) and three structural proteins (VP1, VP2, VP3) (5). Polyomavirus infections have been identified in many vertebrates, including mammals and birds. In contrast to mammals, which present subclinical polyomavirus infections, birds present acute and persistent infections accompanied with high mortality rates. Currently, four bird polyomaviruses have been described: avian polyomavirus (APV), isolated from budgerigars (parakeets); goose hemorrhagic polyomavirus (GHPV); and two polyomaviruses identified in wild birds by PCR and genome sequencing: the common crow and finch polyomaviruses (7). The first polyomavirus in birds called APV was described in 1981. APV is an etiologic agent of budgerigar fledgling disease that is devastating in young birds. This disease is characterized by hepatitis, ascites, and hydropericardium with mortality rates approaching 100%. Young budgerigars surviving the infection develop a chronic form of disease with characteristic feather development disorder. APV infections have also been described in other species of parrots presenting similar clinical symptoms; however, the severity of some symptoms differs between species (7). D
Corresponding author; E-mail: [email protected]
Hemorrhagic nephritis enteritis of geese (HNEG) was diagnosed and described for the first time in 1969 in Hungary; however, the etiologic agent (GHPV) was not identified until 2000 (6). The GHPV genome is circular, with double-stranded DNA approximately 5,256 bp long, and it encodes both regulatory T and structural VP proteins characteristic of polyomaviruses. Confirmation that GHPV was the causative agent of HNEG was extraction of viral DNA from the organs of geese infected under laboratory conditions. So far, cases of HNEG have been confirmed in flocks of geese in Hungary, France, and Germany (2,5). The characteristic VP1 fragment has been observed over the last 2–3 yr in flocks of 3–3.5wk-old geese in Poland (8); however, no clinical cases of HNEG had been previously reported. The present study aims at characterizing clinical symptoms of HNEG in a flock of geese. Moreover, the study establishs a mortality curve and anatomopathologic and histopathologic lesions as well as genetic features of the virus in the course of the first clinical case of HNEG in Poland. MATERIALS AND METHODS Case history. Following the interview with the flock owner and conducting a visual inspection at the farm it was determined that the infected geese were kept in poultry houses previously used for Muscovy ducklings rearing. No disinfection was carried out before the 1-day-old goslings were introduced into the farm, which indicates unsatisfactory
518
519
HNEG in Polish geese
Table 1. PCR primer sequences used for the amplification of the whole GHPV genome. Complementary regions along with the expected product size are given. Primer name
GHPVgenome GHPVgenome GHPVgenome GHPVgenome GHPVgenome GHPVgenome GHPVgenome GHPVgenome
1 2 3 4 5 6 7 8
Primer sequence (59–39)
Complementary genome fragment
Amplicon length (bp)
GATGATTGAGGTTAATT AGCCTCTCCTGGCCCTTCTA TGGACTGTTGTAGAAGGG TGGATATTCTAAAAATTG GAACATGTAGTTTAATAT GAGATGCCCTGGAACCTG TTGTCAGGGTCAATATCA ATGAGCTTTAGAGAAATTG
1–17 1640–1690 1661–1679 3260–3278 3211–3229 4800–4818 4781–4799 5237–5256
1690
sanitary conditions. During the first week 130 birds died, primarily due to omphalitis and yolk sack inflammation, then 70 birds died between days 8 and14. On the 14th day, goslings were vaccinated against Derzsy’s disease and from day 15 an increase in rates of mortality was observed. Clinical and postmortem examination. In April 2013, 10 dead 4wk-old geese belonging to the flock of 6,500 birds were delivered to the Department of Epizootiology and Clinic of Bird and Exotic Animals of the Faculty of Veterinary Medicine at the Wrocław University of Environmental and Life Sciences. During the postmortem examination organs were collected and examined histopathologically and microbiologically. Microbiologic testing. Samples used for microbiologic testing were immediately delivered to the laboratory at the Department of Epizootiology and cultured using commercial growth media for isolation of aerobic or anaerobic bacteria and fungi. Histopathologic examination. The material taken for histopathologic testing was fixed for 24 hr in 7% buffered formalin. Sections of respective samples were stained with hematoxylin and eosin then microscopically examined for histopathology. Microphotographs of all examined organs were subjected to computer-assisted image analysis using a computer coupled to an Olympus BX53 optical microscope (Olympus, Shinjuku, Tokyo, Japan) using cell^A software (Olympus Soft Imaging Solution GmbH, Mu¨nster, Germany). RT-PCR and whole-genome sequencing. Diagnostic tests were performed at the National Veterinary Research Institute in Pulawy. Briefly, real-time PCR (RT-PCR) was used to detect the inverted-
1599 1607 475
terminal repeated region of Derzy’s disease virus using the ABI 9500 system (Applied Biosystems, Foster City, CA) as previously described (12). The same method was applied in the identification of potential goose adeno-, circo- (11), or reovirus infections. GHPV was identified using a modified RT-PCR method with primers complementary to the VP1 sequence described by Guerin et al. (6). The presence of GHPV genetic material was detected by the presence of fluorescent curves recorded using the ABI 9500 system. In order to confirm and characterize the complete GHPV genome, four sets of primers were designed (Table 1). The PCR conditions for all four reactions were as follows: 2.5 ml of 103 PCR buffer (1.5 mM MgCl2), 1 ml of dNTP mix (0.8 mM), 0.5 ml Taq polymerase, 2.5 U HotStar (Qiagen, Hilden, Germany), 5 ml of a 1 M betaine (0.2 mM) (Sigma-Aldrich, St Louis, MO), 1 ml each primer (0.4 mM), 1 ml template DNA, and 13 ml of deionized water. The temperature conditions were as follows: 95 C for 5 min followed by 35 cycles at 94 C for 1 min, 62 C for 1 min, and 72 C for 1 min, followed by a final extension step at 72 C for 5 min. Reaction products were analyzed by electrophoresis using 1.5% agarose gels (120 V for 50 min). Agarose gels were stained with ethidium bromide (0.5 mg/ml) for 15 min and visualized under a ultraviolet light transiluminator (Vilber-Lourmat). The size of the respective PCR products was determined using GeneRulerTM Ladder Plus 100 bp molecular mass marker (Thermo Scientific-Fermentas, Vilnus, Lithuania). PCR products were sequenced using PCR primers designed by Genomed (Warsaw, Poland). Raw readings of respective sequences were edited, analyzed, and assembled into a single nucleotide contig using CLC Main Workbench 6 software (CLC Bio, Aarhus, Denmark). The
Fig. 1. Mortality curve in the course of HNEG (total mortality was 32% of the flock).
520
A. Gaweł et al.
Fig. 2.
Leaking bloody nose.
GHPV sequence was then compared to other GenBank sequences that originated from France, Germany, and China. Based on alignments conducted using the neighbor-joining algorithm the phylogenetic tree and nucleotide sequence similarity matrix of the identified GHPV strains was generated.
RESULTS
Clinical and postmortem examination. High mortality rates (.50 birds/day) were observed during the course of the disease. The dynamics of mortality rates was as follows: day 15, 30 birds; day 16, 50 birds; day 17, 150 birds; day 18, 200 birds; day 19, 300 birds; day 20, 300 birds; day 21, 250 birds; day 22, 280 birds; day 23, 240 birds; day 24, 150 birds; day 25, 80 birds; day 26, 30 birds; day 27, 15 birds; and day 28, 10 birds. The mortality rates normalized when surviving birds were 29 days old. Thirty-two percent of the flock (n 5 1085) died between the ages of 15 and 28 days (Fig. 1). Sick birds presented with various symptoms and signs of disease, including diarrhea, loss of locomotor activity, apathy, or nervous system manifestations. During the necropsy examination, in three birds serous and bloody exudate from the nose was observed (Fig. 2)
Fig. 3. Gross lesions in a 4-wk-old goose infected with GHPV. Hemorrhagic petichiae in lungs.
Fig. 4. Gross lesions in a 4-wk-old goose infected with GHPV. Note ascites and swelling of kidneys with hemorrhages.
and pulmonary edema with hemorrhages (Fig. 3), gelatinous effusion (from subcutaneous breast muscles), and subcutis of the skin overlying the breast muscle was observed in all the birds. Similarly, congestion and enlargement of liver and kidneys was observed in addition to the presence of a light-colored yellow effusion in the abdominal cavity (2–20 ml; Fig. 4). Finally, hydropericardium was observed in five birds. All examined birds had hemorrhagic enteritis and three birds suffered also from hemorrhagic inflammation of the cecal mucosa with the mesentery showing clear signs of gelatinous edema in the region of the inflamed intestines (Fig. 5). Microbiologic testing. Microbiologic testing did not identify bacterial or fungal pathogens and allowed for the exclusion of bacteria and fungi as the causative agents of the observed hemorrhagic lesions present in the intestines. Histopathologic examination. The organs most significantly affected were the kidneys and intestines. Histopathologic examination of kidney samples identified edema of the renal tubular epithelium and tissue parenchyma, fatty degeneration of cells, destruction of cell nuclei, and desquamation of tubular lumen cells. The renal parenchyma was heavily congested and contained hemorrhagic foci of variable sizes. In addition, irregular regions of
Fig. 5. Numerous foci of hemorrhages and edema of the intestines.
521
HNEG in Polish geese
Fig. 6. Massive blood congestion in the kidneys combined with parenchymatous degeneration of renal tubular epithelial and their swelling (edema).
necrosis were observed presenting (primarily in the renal cortex) with lymphohistiocytic and heterophilic inflammatory infiltrates (Fig. 6). The small intestines of infected birds presented with pronounced edema of the villi, changes of enterocytes (including karyorrhexis and cell swelling) with numerous hemorrhagic foci (Fig. 7), widespread necrotic lesions, and venous congestion. The pronounced presence of hemosiderin pigment was suggestive of a prolonged period of hemorrhagic inflammation. We also observed that the lamina propria of the villi contained inflammatory cell infiltrates comprised primarily of heterophils. Overall, the inflammatory pattern observed in the intestines was indicative of hemorrhagic enteritis. The bursa of Fabricius and the spleen presented with reduction of lymphocytes; furthermore, splenic congestion was observed. Analysis of liver tissues revealed dilatation of the peri-sinusoidal spaces containing small amounts of edematous fluid. The liver parenchyma contained foci of lymphohistiocytic infiltrates and congestion, and hepatocytes showed signs of parenchymatous degeneration (dimmed, granular cytoplasm of hepatocytes and veiled hepatocyte cell nuclei).
Fig. 8. Strong blood congestion in the lungs combined with extensive hemorrhage and disruption of alveolar wall continuity.
Histologic analysis of lung tissues revealed a pattern of pronounced edema linked to blood congestion and hemorrhagic foci associated with disruption of the pulmonary air capillaries that contained blood-stained edematous fluid and regions containing inflammatory infiltrates. Pronounced blood congestion and edematous lesions in the trachea were also observed (Fig. 8). RT-PCR and whole-genome sequencing. Analysis of samples using RT-PCR excluded infections of geese with parvo-, adeno-, circo-, or reoviruses. The use of RT-PCR for detection of the GHPV VP1 region identified the presence of fluorescent curves corresponding to product bands of the anticipated sizes (1690, 1599, 1607, and 475 bp; Fig. 9). The similarity of the GHPV genomic sequences isolated in Poland in 2013 to the strains originating from Germany, France, and China were high (99.58%–100% similarity). Based on the phylogenetic tree analysis it was concluded that the probable phylogenetic ancestor of the Polish strain was the Toulouse 2000 strain (Fig. 10; Table 2) and the genome sequence of the Polish strain was identical to that of strains isolated in France in 2008 collected from both geese and Muscovy ducks. DISCUSSION
This report describes an outbreak of HNEG in a flock of geese living at a farm previously inhabited by Muscovy ducks. After several duck breeding cycles, the newly acquired goslings were housed in the same poultry houses inhabited by the ducks without first conducting proper disinfection of the living areas. That the farm was previously inhabited by ducks is significant since it has previously been demonstrated that ducks may be asymptomatic carriers of GHPV, thereby serving as a source of infection for susceptible geese (1); this suggests that the ducks that inhabited the farm previously were the
Fig. 7. Gross lesions in a 4-wk-old goose infected with GHPV. Edema of intestines, enteritis with blood-stained content.
Fig. 9.
Sequencing of the whole GHPV genome.
522
A. Gaweł et al.
Table 2. Nucleotide similarity matrix constructed on the basis of GHPV whole genome comparison. The percentage of total nucleotide homology is given.
Poland 2013 (geese) Toulouse 2000 (geese) Toulouse 2008 (geese) Germany 2001 (geese) 106 China (Pekin duck) Toulouse 2008 (Mule duck) Toulouse 2008 (Muscovy duck)
1 2 3 4 5 6 7
1
2
3
4
5
6
7
— 99.62 100.00 99.81 99.77 99.81 100.00
99.62 — 99.62 99.64 99.58 99.58 99.62
100.00 99.62 — 99.81 99.77 99.81 100.00
99.81 99.64 99.81 — 99.77 99.77 99.81
99.77 9.58 99.77 99.77 — 99.73 99.77
99.81 99.58 99.81 99.77 99.73 — 99.81
100.00 99.62 100.00 99.81 99.77 99.81 —
source of infection. This hypothesis was further supported by the epizootic investigation that confirmed that no other goslings obtained from the same reproduction flock presented with GHPV infections, thereby suggesting horizontal transmission rather than vertical viral transmission as a cause of the infections (3). The clinical symptoms associated with GHPV infection including apathy, diarrhea, and nervous system manifestations paralleled symptoms described in cases of the disease in Hungary and France (2,9). Mortality rates in this study were 32%, similar to the mortality range described in the literature associated with HNEG (4%–64%). Similarly, the histologic changes observed in the intestines and kidneys were similar to those previously described (2), although goslings in the present study also presented with significant pulmonary edema with numerous hemorrhagic lesions in the pulmonary alveoli and with some hemorrhagic effusion presenting in the nasal apertures of some cases due to a damaged respiratory system. Genetic analysis of the GHPV isolates obtained during the course of this study indicated that they were highly similar to previously isolated strains from France and Germany based on the .99% similarity of the genome to European GHPV strains. Comparison of the completed GHPV genome sequence also suggested that French GHPV strains were the source of the isolates identified during the course of this study. Interestingly, the genetic variability of GHPV strains was relatively low and independent of the species of waterfowl from which they were isolated. This small degree of variability in the genome of this virus suggests that immune prophylaxis would be highly effective in controlling infections. Currently, research focused on developing a vaccine to prevent hemorrhagic nephritis enteritis of the geese is being conducted worldwide and data suggest that vaccination protects young birds via maternally derived antibodies. Furthermore, a double vaccination
Fig. 10. Phylogenetic tree showing genetic relationships between Polish GHPV isolate and other isolates of European origin.
regimen with a subunit vaccine after birth on days 1 and 18 elicited 100% protection against disease (4,10). REFERENCES 1. Corrand, L., J. Gelfi, O. Albaric, M. Etievant, J. L. Pingret, and J.-L. Guerin. Pathological and epidemiological significance of goose haemorrhagic polyomavirus infection in ducks. Avian Pathol. 40:355–360. 2011. 2. Dobos-Kova´cs, M., E. Horva´th, A. Farsang, E. Nagy, A. Kova´cs, F. Szalai, and S. Berna´th. Haemorrhagic nephritis and enteritis of geese: pathomorphological investigations and proposed pathogenesis. Acta Vet Hung. 53:213–223. 2005. 3. Farsang, A., S. Bernath, and M. Dobos-Kovacs. Case report of goose haemorrhagic polyomavirus in 4-day old goslings indicating vertical transmissibility. Acta Vet. Brno 80:255–257. 2011. 4. Gelfi, J., M. Pappalardo, C. Claverys, B. Peralta, and J. L. Guerin. Safety and efficacy of an inactivated Carbopol-adjuvanted goose haemorrhagic polyomavirus vaccine for domestic geese. Avian Pathol. 39:111–116. 2010. 5. Guerin, J.-L. Hemorrhagic nephritis enteritis of geese (HNEG). In: Y. M. Saif, ed.; A. M. Fadley, J. R. Glisson, L. R. McDougald, L. K. Nolan, and D. E. Swayne, assoc. eds. Diseases of poultry, 12th ed. Blackwell Publishing, Ames, IA. pp. 393–396. 2008. 6. Guerin, J. L., J. Gelfi, L. Dubois, A. Vuillaume, C. BoucrautBaralon, and J. L. Pingret. A novel polyomavirus (goose hemorrhagic polyomavirus) is the agent of hemorrhagic nephritis enteritis of geese. J. Virol. 74:4523–4529. 2000. 7. Johne, R., and H. Mu¨ller. Polyomaviruses of birds: etiologic agents of inflammatory diseases in a tumor virus family. J. Virol. 81:11554–11559. 2007. 8. Kozdrun´, W., G. Woz´niakowski, E. Samorek-Salamonowicz, and H. Czekaj. Viral infections in goose flocks in Poland. Pol. J. Vet. Sci. 15:525–530. 2012. 9. Lacroux, C., O. Andreoletti, B. Payre, J. L. Pingret, A. Dissais, and J.-L. Guerin. Pathology of spontaneous and experimental infections by goose haemorrhagic polyomavirus. Avian Pathol. 33:351–358. 2004. 10. Mato, T., Z. Penzes, P. Rueda, C. Vela, V. Kardi, A. Zolnai, F. Misak, and V. Palya. Recombinant subunit vaccine elicits protection against goose haemorrhagic nephritis and enteritis. Avian Pathol. 38:233–237. 2009. 11. Woz´niakowski, G., W. Kozdrun´, and E. Samorek-Salamonowicz. Loop-mediated isothermal amplification for the detection of goose circovirus. Virol. J. 9:110. 2012. 12. Woz´niakowski, G., E. Samorek-Salamonowicz, and W. Kozdrun´. Quantitative analysis of waterfowl parvoviruses in geese and Muscovy ducks by real-time polymerase chain reaction: correlation between age, clinical symptoms and DNA copy number of waterfowl parvoviruses. BMC Vet. Res. 8:29. 2012.
BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.
BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research.
AVIAN DISEASES 58:518–522, 2014
Hemorrhagic Nephritis and Enteritis in a Goose Flock in Poland—Disease Course Analysis and Characterization of Etiologic Agent Andrzej Gaweł,A Grzegorz Woz´niakowski,B Elz_bieta Samorek-Salamonowicz,B Wojciech Kozdrun´,B Kamila Bobrek,AD Katarzyna Bobusia,A and Marcin NowakC A
Department of Epizootiology and Clinic of Bird and Exotic Animals, Faculty of Veterinary Medicine, Wrocław University of Environmental and Life Sciences, pl. Grunwaldzki 45, 50-355 Wrocław, Poland B Department of Poultry Viral Diseases, National Veterinary Research Institute, Partyzantow 57 Avenue, 24-100 Pulawy, Poland C Department of Pathology, Faculty of Veterinary Medicine, Wrocław University of Environmental and Life Sciences, ul. C.K. Norwida 31, 50-375 Wrocław, Poland Received 24 April 2014; Accepted 8 July 2014; Published ahead of print 15 July 2014 SUMMARY. Hemorrhagic nephritis enteritis of geese (HNEG) is an epizootic viral disease caused by infection with goose hemorrhagic polyomavirus (GHPV) that affects domestic geese. This study describes the epizootic analysis, laboratory diagnosis, and molecular characterization of GHPV isolates associated with HNEG cases in Poland. HNEG symptoms persisted in infected flocks for 2 wk with a 32% mortality rate. Primary gross lesions included hemorrhaging of the kidneys, intestines, and lungs. Histopathologic examination confirmed HNEG and identified that the causative agent was similar to other GHPV isolates and identical to the Toulouse 2008 isolate. RESUMEN. Nefritis y enteritis hemorra´gica en una parvada de gansos en Polonia – Ana´lisis del curso de la enfermedad y caracterizacio´n del agente etiolo´gico. La nefritis y enteritis de los gansos (con las siglas en ingle´s HNEG) es una enfermedad viral epizoo´tica causada por la infeccio´n con poliomavirus hemorra´gico del ganso (GHPV) que afecta a los gansos dome´sticos. Este estudio describe el ana´lisis epizoo´tico, el diagno´stico de laboratorio y la caracterizacio´n molecular de los aislamientos del virus de la nefritis y enteritis de los gansos asociados a casos de la enfermedad en Polonia. Los signos de la nefritis y enteritis de los gansos persistieron en las parvadas infectadas por dos semanas con una tasa de mortalidad del 32%. Lesiones macrosco´picas primarias incluyeron hemorragia de los rin˜ones, los intestinos y los pulmones. El examen histopatolo´gico confirmo´ la enfermedad y se identifico´ que el agente causante era similar a otros aislamientos del virus de la nefritis y enteritis de los gansos e ide´ntico al aislamiento de Toulouse del an˜o 2008. Key words: HNEG, GHPV, geese, pathology, genomic analysis Abbreviations: GHPV 5 goose hemorrhagic polyomavirus; HNEG 5 hemorrhagic nephritis enteritis of geese
Polyomaviruses together with papillomaviruses belong to Papovaviridae family. The name originates from Greek, meaning ‘‘viruses causing numerous tumors.’’ Polyomaviruses are icosahedral-shaped DNA viruses 40–50 nm in diameter. Their genome is divided into two regions encoding five main proteins: two regulatory multifunctional T proteins (large and small) and three structural proteins (VP1, VP2, VP3) (5). Polyomavirus infections have been identified in many vertebrates, including mammals and birds. In contrast to mammals, which present subclinical polyomavirus infections, birds present acute and persistent infections accompanied with high mortality rates. Currently, four bird polyomaviruses have been described: avian polyomavirus (APV), isolated from budgerigars (parakeets); goose hemorrhagic polyomavirus (GHPV); and two polyomaviruses identified in wild birds by PCR and genome sequencing: the common crow and finch polyomaviruses (7). The first polyomavirus in birds called APV was described in 1981. APV is an etiologic agent of budgerigar fledgling disease that is devastating in young birds. This disease is characterized by hepatitis, ascites, and hydropericardium with mortality rates approaching 100%. Young budgerigars surviving the infection develop a chronic form of disease with characteristic feather development disorder. APV infections have also been described in other species of parrots presenting similar clinical symptoms; however, the severity of some symptoms differs between species (7). D
Corresponding author; E-mail: [email protected]
Hemorrhagic nephritis enteritis of geese (HNEG) was diagnosed and described for the first time in 1969 in Hungary; however, the etiologic agent (GHPV) was not identified until 2000 (6). The GHPV genome is circular, with double-stranded DNA approximately 5,256 bp long, and it encodes both regulatory T and structural VP proteins characteristic of polyomaviruses. Confirmation that GHPV was the causative agent of HNEG was extraction of viral DNA from the organs of geese infected under laboratory conditions. So far, cases of HNEG have been confirmed in flocks of geese in Hungary, France, and Germany (2,5). The characteristic VP1 fragment has been observed over the last 2–3 yr in flocks of 3–3.5wk-old geese in Poland (8); however, no clinical cases of HNEG had been previously reported. The present study aims at characterizing clinical symptoms of HNEG in a flock of geese. Moreover, the study establishs a mortality curve and anatomopathologic and histopathologic lesions as well as genetic features of the virus in the course of the first clinical case of HNEG in Poland. MATERIALS AND METHODS Case history. Following the interview with the flock owner and conducting a visual inspection at the farm it was determined that the infected geese were kept in poultry houses previously used for Muscovy ducklings rearing. No disinfection was carried out before the 1-day-old goslings were introduced into the farm, which indicates unsatisfactory
518
519
HNEG in Polish geese
Table 1. PCR primer sequences used for the amplification of the whole GHPV genome. Complementary regions along with the expected product size are given. Primer name
GHPVgenome GHPVgenome GHPVgenome GHPVgenome GHPVgenome GHPVgenome GHPVgenome GHPVgenome
1 2 3 4 5 6 7 8
Primer sequence (59–39)
Complementary genome fragment
Amplicon length (bp)
GATGATTGAGGTTAATT AGCCTCTCCTGGCCCTTCTA TGGACTGTTGTAGAAGGG TGGATATTCTAAAAATTG GAACATGTAGTTTAATAT GAGATGCCCTGGAACCTG TTGTCAGGGTCAATATCA ATGAGCTTTAGAGAAATTG
1–17 1640–1690 1661–1679 3260–3278 3211–3229 4800–4818 4781–4799 5237–5256
1690
sanitary conditions. During the first week 130 birds died, primarily due to omphalitis and yolk sack inflammation, then 70 birds died between days 8 and14. On the 14th day, goslings were vaccinated against Derzsy’s disease and from day 15 an increase in rates of mortality was observed. Clinical and postmortem examination. In April 2013, 10 dead 4wk-old geese belonging to the flock of 6,500 birds were delivered to the Department of Epizootiology and Clinic of Bird and Exotic Animals of the Faculty of Veterinary Medicine at the Wrocław University of Environmental and Life Sciences. During the postmortem examination organs were collected and examined histopathologically and microbiologically. Microbiologic testing. Samples used for microbiologic testing were immediately delivered to the laboratory at the Department of Epizootiology and cultured using commercial growth media for isolation of aerobic or anaerobic bacteria and fungi. Histopathologic examination. The material taken for histopathologic testing was fixed for 24 hr in 7% buffered formalin. Sections of respective samples were stained with hematoxylin and eosin then microscopically examined for histopathology. Microphotographs of all examined organs were subjected to computer-assisted image analysis using a computer coupled to an Olympus BX53 optical microscope (Olympus, Shinjuku, Tokyo, Japan) using cell^A software (Olympus Soft Imaging Solution GmbH, Mu¨nster, Germany). RT-PCR and whole-genome sequencing. Diagnostic tests were performed at the National Veterinary Research Institute in Pulawy. Briefly, real-time PCR (RT-PCR) was used to detect the inverted-
1599 1607 475
terminal repeated region of Derzy’s disease virus using the ABI 9500 system (Applied Biosystems, Foster City, CA) as previously described (12). The same method was applied in the identification of potential goose adeno-, circo- (11), or reovirus infections. GHPV was identified using a modified RT-PCR method with primers complementary to the VP1 sequence described by Guerin et al. (6). The presence of GHPV genetic material was detected by the presence of fluorescent curves recorded using the ABI 9500 system. In order to confirm and characterize the complete GHPV genome, four sets of primers were designed (Table 1). The PCR conditions for all four reactions were as follows: 2.5 ml of 103 PCR buffer (1.5 mM MgCl2), 1 ml of dNTP mix (0.8 mM), 0.5 ml Taq polymerase, 2.5 U HotStar (Qiagen, Hilden, Germany), 5 ml of a 1 M betaine (0.2 mM) (Sigma-Aldrich, St Louis, MO), 1 ml each primer (0.4 mM), 1 ml template DNA, and 13 ml of deionized water. The temperature conditions were as follows: 95 C for 5 min followed by 35 cycles at 94 C for 1 min, 62 C for 1 min, and 72 C for 1 min, followed by a final extension step at 72 C for 5 min. Reaction products were analyzed by electrophoresis using 1.5% agarose gels (120 V for 50 min). Agarose gels were stained with ethidium bromide (0.5 mg/ml) for 15 min and visualized under a ultraviolet light transiluminator (Vilber-Lourmat). The size of the respective PCR products was determined using GeneRulerTM Ladder Plus 100 bp molecular mass marker (Thermo Scientific-Fermentas, Vilnus, Lithuania). PCR products were sequenced using PCR primers designed by Genomed (Warsaw, Poland). Raw readings of respective sequences were edited, analyzed, and assembled into a single nucleotide contig using CLC Main Workbench 6 software (CLC Bio, Aarhus, Denmark). The
Fig. 1. Mortality curve in the course of HNEG (total mortality was 32% of the flock).
520
A. Gaweł et al.
Fig. 2.
Leaking bloody nose.
GHPV sequence was then compared to other GenBank sequences that originated from France, Germany, and China. Based on alignments conducted using the neighbor-joining algorithm the phylogenetic tree and nucleotide sequence similarity matrix of the identified GHPV strains was generated.
RESULTS
Clinical and postmortem examination. High mortality rates (.50 birds/day) were observed during the course of the disease. The dynamics of mortality rates was as follows: day 15, 30 birds; day 16, 50 birds; day 17, 150 birds; day 18, 200 birds; day 19, 300 birds; day 20, 300 birds; day 21, 250 birds; day 22, 280 birds; day 23, 240 birds; day 24, 150 birds; day 25, 80 birds; day 26, 30 birds; day 27, 15 birds; and day 28, 10 birds. The mortality rates normalized when surviving birds were 29 days old. Thirty-two percent of the flock (n 5 1085) died between the ages of 15 and 28 days (Fig. 1). Sick birds presented with various symptoms and signs of disease, including diarrhea, loss of locomotor activity, apathy, or nervous system manifestations. During the necropsy examination, in three birds serous and bloody exudate from the nose was observed (Fig. 2)
Fig. 3. Gross lesions in a 4-wk-old goose infected with GHPV. Hemorrhagic petichiae in lungs.
Fig. 4. Gross lesions in a 4-wk-old goose infected with GHPV. Note ascites and swelling of kidneys with hemorrhages.
and pulmonary edema with hemorrhages (Fig. 3), gelatinous effusion (from subcutaneous breast muscles), and subcutis of the skin overlying the breast muscle was observed in all the birds. Similarly, congestion and enlargement of liver and kidneys was observed in addition to the presence of a light-colored yellow effusion in the abdominal cavity (2–20 ml; Fig. 4). Finally, hydropericardium was observed in five birds. All examined birds had hemorrhagic enteritis and three birds suffered also from hemorrhagic inflammation of the cecal mucosa with the mesentery showing clear signs of gelatinous edema in the region of the inflamed intestines (Fig. 5). Microbiologic testing. Microbiologic testing did not identify bacterial or fungal pathogens and allowed for the exclusion of bacteria and fungi as the causative agents of the observed hemorrhagic lesions present in the intestines. Histopathologic examination. The organs most significantly affected were the kidneys and intestines. Histopathologic examination of kidney samples identified edema of the renal tubular epithelium and tissue parenchyma, fatty degeneration of cells, destruction of cell nuclei, and desquamation of tubular lumen cells. The renal parenchyma was heavily congested and contained hemorrhagic foci of variable sizes. In addition, irregular regions of
Fig. 5. Numerous foci of hemorrhages and edema of the intestines.
521
HNEG in Polish geese
Fig. 6. Massive blood congestion in the kidneys combined with parenchymatous degeneration of renal tubular epithelial and their swelling (edema).
necrosis were observed presenting (primarily in the renal cortex) with lymphohistiocytic and heterophilic inflammatory infiltrates (Fig. 6). The small intestines of infected birds presented with pronounced edema of the villi, changes of enterocytes (including karyorrhexis and cell swelling) with numerous hemorrhagic foci (Fig. 7), widespread necrotic lesions, and venous congestion. The pronounced presence of hemosiderin pigment was suggestive of a prolonged period of hemorrhagic inflammation. We also observed that the lamina propria of the villi contained inflammatory cell infiltrates comprised primarily of heterophils. Overall, the inflammatory pattern observed in the intestines was indicative of hemorrhagic enteritis. The bursa of Fabricius and the spleen presented with reduction of lymphocytes; furthermore, splenic congestion was observed. Analysis of liver tissues revealed dilatation of the peri-sinusoidal spaces containing small amounts of edematous fluid. The liver parenchyma contained foci of lymphohistiocytic infiltrates and congestion, and hepatocytes showed signs of parenchymatous degeneration (dimmed, granular cytoplasm of hepatocytes and veiled hepatocyte cell nuclei).
Fig. 8. Strong blood congestion in the lungs combined with extensive hemorrhage and disruption of alveolar wall continuity.
Histologic analysis of lung tissues revealed a pattern of pronounced edema linked to blood congestion and hemorrhagic foci associated with disruption of the pulmonary air capillaries that contained blood-stained edematous fluid and regions containing inflammatory infiltrates. Pronounced blood congestion and edematous lesions in the trachea were also observed (Fig. 8). RT-PCR and whole-genome sequencing. Analysis of samples using RT-PCR excluded infections of geese with parvo-, adeno-, circo-, or reoviruses. The use of RT-PCR for detection of the GHPV VP1 region identified the presence of fluorescent curves corresponding to product bands of the anticipated sizes (1690, 1599, 1607, and 475 bp; Fig. 9). The similarity of the GHPV genomic sequences isolated in Poland in 2013 to the strains originating from Germany, France, and China were high (99.58%–100% similarity). Based on the phylogenetic tree analysis it was concluded that the probable phylogenetic ancestor of the Polish strain was the Toulouse 2000 strain (Fig. 10; Table 2) and the genome sequence of the Polish strain was identical to that of strains isolated in France in 2008 collected from both geese and Muscovy ducks. DISCUSSION
This report describes an outbreak of HNEG in a flock of geese living at a farm previously inhabited by Muscovy ducks. After several duck breeding cycles, the newly acquired goslings were housed in the same poultry houses inhabited by the ducks without first conducting proper disinfection of the living areas. That the farm was previously inhabited by ducks is significant since it has previously been demonstrated that ducks may be asymptomatic carriers of GHPV, thereby serving as a source of infection for susceptible geese (1); this suggests that the ducks that inhabited the farm previously were the
Fig. 7. Gross lesions in a 4-wk-old goose infected with GHPV. Edema of intestines, enteritis with blood-stained content.
Fig. 9.
Sequencing of the whole GHPV genome.
522
A. Gaweł et al.
Table 2. Nucleotide similarity matrix constructed on the basis of GHPV whole genome comparison. The percentage of total nucleotide homology is given.
Poland 2013 (geese) Toulouse 2000 (geese) Toulouse 2008 (geese) Germany 2001 (geese) 106 China (Pekin duck) Toulouse 2008 (Mule duck) Toulouse 2008 (Muscovy duck)
1 2 3 4 5 6 7
1
2
3
4
5
6
7
— 99.62 100.00 99.81 99.77 99.81 100.00
99.62 — 99.62 99.64 99.58 99.58 99.62
100.00 99.62 — 99.81 99.77 99.81 100.00
99.81 99.64 99.81 — 99.77 99.77 99.81
99.77 9.58 99.77 99.77 — 99.73 99.77
99.81 99.58 99.81 99.77 99.73 — 99.81
100.00 99.62 100.00 99.81 99.77 99.81 —
source of infection. This hypothesis was further supported by the epizootic investigation that confirmed that no other goslings obtained from the same reproduction flock presented with GHPV infections, thereby suggesting horizontal transmission rather than vertical viral transmission as a cause of the infections (3). The clinical symptoms associated with GHPV infection including apathy, diarrhea, and nervous system manifestations paralleled symptoms described in cases of the disease in Hungary and France (2,9). Mortality rates in this study were 32%, similar to the mortality range described in the literature associated with HNEG (4%–64%). Similarly, the histologic changes observed in the intestines and kidneys were similar to those previously described (2), although goslings in the present study also presented with significant pulmonary edema with numerous hemorrhagic lesions in the pulmonary alveoli and with some hemorrhagic effusion presenting in the nasal apertures of some cases due to a damaged respiratory system. Genetic analysis of the GHPV isolates obtained during the course of this study indicated that they were highly similar to previously isolated strains from France and Germany based on the .99% similarity of the genome to European GHPV strains. Comparison of the completed GHPV genome sequence also suggested that French GHPV strains were the source of the isolates identified during the course of this study. Interestingly, the genetic variability of GHPV strains was relatively low and independent of the species of waterfowl from which they were isolated. This small degree of variability in the genome of this virus suggests that immune prophylaxis would be highly effective in controlling infections. Currently, research focused on developing a vaccine to prevent hemorrhagic nephritis enteritis of the geese is being conducted worldwide and data suggest that vaccination protects young birds via maternally derived antibodies. Furthermore, a double vaccination
Fig. 10. Phylogenetic tree showing genetic relationships between Polish GHPV isolate and other isolates of European origin.
regimen with a subunit vaccine after birth on days 1 and 18 elicited 100% protection against disease (4,10). REFERENCES 1. Corrand, L., J. Gelfi, O. Albaric, M. Etievant, J. L. Pingret, and J.-L. Guerin. Pathological and epidemiological significance of goose haemorrhagic polyomavirus infection in ducks. Avian Pathol. 40:355–360. 2011. 2. Dobos-Kova´cs, M., E. Horva´th, A. Farsang, E. Nagy, A. Kova´cs, F. Szalai, and S. Berna´th. Haemorrhagic nephritis and enteritis of geese: pathomorphological investigations and proposed pathogenesis. Acta Vet Hung. 53:213–223. 2005. 3. Farsang, A., S. Bernath, and M. Dobos-Kovacs. Case report of goose haemorrhagic polyomavirus in 4-day old goslings indicating vertical transmissibility. Acta Vet. Brno 80:255–257. 2011. 4. Gelfi, J., M. Pappalardo, C. Claverys, B. Peralta, and J. L. Guerin. Safety and efficacy of an inactivated Carbopol-adjuvanted goose haemorrhagic polyomavirus vaccine for domestic geese. Avian Pathol. 39:111–116. 2010. 5. Guerin, J.-L. Hemorrhagic nephritis enteritis of geese (HNEG). In: Y. M. Saif, ed.; A. M. Fadley, J. R. Glisson, L. R. McDougald, L. K. Nolan, and D. E. Swayne, assoc. eds. Diseases of poultry, 12th ed. Blackwell Publishing, Ames, IA. pp. 393–396. 2008. 6. Guerin, J. L., J. Gelfi, L. Dubois, A. Vuillaume, C. BoucrautBaralon, and J. L. Pingret. A novel polyomavirus (goose hemorrhagic polyomavirus) is the agent of hemorrhagic nephritis enteritis of geese. J. Virol. 74:4523–4529. 2000. 7. Johne, R., and H. Mu¨ller. Polyomaviruses of birds: etiologic agents of inflammatory diseases in a tumor virus family. J. Virol. 81:11554–11559. 2007. 8. Kozdrun´, W., G. Woz´niakowski, E. Samorek-Salamonowicz, and H. Czekaj. Viral infections in goose flocks in Poland. Pol. J. Vet. Sci. 15:525–530. 2012. 9. Lacroux, C., O. Andreoletti, B. Payre, J. L. Pingret, A. Dissais, and J.-L. Guerin. Pathology of spontaneous and experimental infections by goose haemorrhagic polyomavirus. Avian Pathol. 33:351–358. 2004. 10. Mato, T., Z. Penzes, P. Rueda, C. Vela, V. Kardi, A. Zolnai, F. Misak, and V. Palya. Recombinant subunit vaccine elicits protection against goose haemorrhagic nephritis and enteritis. Avian Pathol. 38:233–237. 2009. 11. Woz´niakowski, G., W. Kozdrun´, and E. Samorek-Salamonowicz. Loop-mediated isothermal amplification for the detection of goose circovirus. Virol. J. 9:110. 2012. 12. Woz´niakowski, G., E. Samorek-Salamonowicz, and W. Kozdrun´. Quantitative analysis of waterfowl parvoviruses in geese and Muscovy ducks by real-time polymerase chain reaction: correlation between age, clinical symptoms and DNA copy number of waterfowl parvoviruses. BMC Vet. Res. 8:29. 2012.
