Cell, Vol. 60, 665-693,

February

23, 1990, Copyright

0 1990 by Cell Press

HIV-1 Regulator of Virion Expression (Rev) Protein Binds to an RNA Stem-Loop Structure Located within the Rev Response Element Region Shaun Heaphy, Michael J. Gait, Jonathan Karn, Mohinder Singh, MRC Laboratory Hills Road Cambridge CB2 England

Colin Dingwall, lngemar Ernberg, Sheila M. Green, Anthony D. Lowe, and Michael A. Skinner of Molecular Biology 2QH

Summary HIV-1 Rev protein, purified from E. coli, binds specifically to an RNA transcript containing the 223 nucleotide long Rev response element (RRE) sequence. Rev binds to RRE in vitro with an apparent dissociation constant of 1 to 3 nM as determined by filter binding, gel mobility shift assays, or an immunoprecipitation assay using a monoclonal antibody specific for the Rev C-terminus. Antisense RRE sequences are bound by Rev with a 20-fold lower affinity than wild-type RRE sequences. The Rev-RRE complex forms even in the presence of a lO,OOO-fold molar excess of 16s rRNA, whereas formation of the low affinity antisense RRERev complex is efficiently blocked by addition of excess 16s rRNA. A ~33 nucleotide fragment is protected from ribonuclease Tl digestion by the binding of Rev to RRE RNA, suggesting that Rev binds with high affinity to only a restricted region of the RRE. This protected fragment is unable to rebind Rev protein but has been mapped to a 71 nucleotide long Rev binding domain sequence that overlaps the protected fragment. Introduction Transcription of the human immunodeficiency virus type 1 (HIV-l) genome during viral replication shows distinct kinetic phases (Sodroski et al., 1986; Feinberg et al., 1986; Knight et al., 1987; Kim et al., 1989). The initial products of HIV-1 gene expression are short, spliced RNA species approximately 1.8-2.0 kb in length that encode the regulatory proteins Tat, Rev, and possibly Nef. As the infection develops and the levels of Tat and Rev proteins rise in the infected cells, mRNA production shifts progressively toward production of a family of 4.3 kb mRNAs encoding Env and other HIV gene products such as Vif and Vpr and finally, late in infection, to the production of full-length transcripts of 9.3 kb that act as both the virion RNA and the mRNA for the Gag-Pol polyprotein. The Rev protein acts posttranscriptionally to mediate the shift toward expression of the late viral mRNAs (Sodroski et al., 1986; Feinberg et al., 1986; Knight et al., 1987; Sadaie et al., 1988). The activity of Rev is dependent on the presence of a cis-acting sequence (Rosen et al., 1988) called the Rev response element (RRE), which has

been localized t0 a 234 nucleotide sequence within the em gene (Malim et al., 1988, 1989a, 1989b; Felber et al., 1989). Expression of Rev protein permits the appearance in the cytoplasm of transcripts carrying RRE sequences; in the absence of Rev, mRNAs carrying the RRE sequence are retained in the nucleus (Felber et al., 1989; Malim et al., 1989a; Emerman et al., 1989). Although mRNA precursors carrying heterologous splice donor or acceptor sequences may become Rev responsive by the addition of intact RRE sequences (Malim et al., 1989a), it is still unclear whether the effects of the Rev protein are coupled to splicing itself or to a still-undefined pathway that regulates the export of mRNA from the nucleus. RRE sequences from HIV-l, HIV-2, and simian immunodeficiency virus appear to have extensive stem-loop structures (Malim et al., 1989a, 1989b). The precise location of the RRE sequence within the viral mRNA does not seem to be critical for Rev function since RRE sequences are active when present in both introns and exons (Malim et al., 1989a). However, the correct orientation of the RRE is essential since Rev responsiveness is removed upon inversion of the RRE (Malim et al., 1989a). In this paper we present evidence that Rev binds specifically and strongly to RRE sequences in vitro. The binding site for Rev has been located to 71 residues close to the 5’ end of the 234 nucleotide RRE sequence. Evidence for specific interactions between Rev and RRE sequences has also been reported recently by Zapp and Green (1989) and Daly et al. (1989). Results Expression and Purification of Rev Rev protein was produced in Escherichia coli from a synthetic gene corresponding to the sequence of Rev from the HIV-1 BRU strain (Figure 1). The synthetic gene was expressed as a P-galactosidase-Rev fusion protein using methods similar to those previously applied successfully to the expression of HIV-1 Tat (Dingwall et al., 1989). Because Rev from the BRU strain contains no internal methionines, cleavage of the fusion protein with cyanogen bromide (CNBr) was used to release free Rev. Homogeneous Rev protein was obtained following chromatography on Accell CM. Stages in the purification of Rev were monitored by SDS-polyacrylamide gel electrophoresis (Figure 2). The identity of the purified protein was confirmed by immunoblotting using antibodies raised to the N- and C-terminal sequences of Rev and by amino acid analysis (data not shown). After chromatography, the Rev protein preparation was dialyzed against low ionic strength buffer (25 mM Tris-HCI [pH 8.01, 20 mM NaCI, 1 mM MgCI*, 0.5 mM DTT) to remove urea and was concentrated by ultrafiltration. Rev protein remains in solution at concentrations of up to 6 mglml at 4%, but gels in this highly concentrated form at room temperature. We do not know if aggregation of Rev

Cell 686

CTGGTCGCTCTGGCGATTCTGATGAAGACCTTCTCAAAGCCGTTCGC GACCAGCGAGACCGCTAAGACTACTTCTGGAAGAGTTTCGGCAAGCG BmHI

NdeI 30 QSNPPPNPEGTRQARRNRRRRWRER R3 (72)

BclI

R2(65)

"

40

TGGTCTCGTTGGGAGGCGGTTTGGGTCTCCCATGAGCGGTCCGCGCAGCGTTGTCC R4 (72)

Sal

I

CCACCGCGCTTG v

60

50 OROIHSISERILSTYLGRSAEPVPL R5 (60)

70

GTCAGCGTCAAATCCACAGCATTTCCGAGCGCATTCTGAGCACTTACCT CAGTCGCAGTTTAGGTGTCGTAAAGGCTCGCGTAAGACTCGTGAATGG R6 (60) 80 QLPPLERLTLDCNEDCGTSGTQGVG he R7 (541 TTCAGTTGCCTCCCTTA

-+

~~::~~~~:~:~~~~~~~~~~ V Eaq I 90 R9

(62)

110

100 SPQIL"ESPT"LESGTKE**

-3’ -5’ ”

R12

spe I Figure

1. Synthetic

Gene for HIV-1 (BRU)

(47)

Hind

Rev

Oligonucleotides used for the gene assembly are indicated by arrows, and carets denote the gene sequence. Restriction enzyme sites are shaded.

is physiologically significant. To minimize Rev aggregation prior to RNA binding, however, Rev was stored frozen in aliquots containing approximately 200 uglml protein. Specific Binding of RRE RNA by Rev Complexes between Rev and the RRE were detected initially by a nitrocellulose filter binding assay. Twenty picograms of a uniformly labeled T7 RNA polymerase transcript (0.5 PM) corresponding to a 223 nucleotide long

123

4

5

-

Figure

2. Purification

of HIV-1 Rev from

III'

-

16.9 14.4

-\

8s:;

E. coli

Proteins were fractionated on 16% SDS-polyacrylamide gels. Lane 1, insoluble fraction of E. coli carrying pMG670 but not induced. Lane 2, inclusion body fraction from E. coli carrying pMG670 induced with IPTG. Note appearance of @alactosidase-Rev fusion protein of M, *130,000. Lane 3, CNBr digest of 8-galactosidase-Rev fusion protein. Lane 4. purified Rev after chromatography on Accell CM. Lane 5, protein standards.

points of ligation.

The amino acid sequence

is shown

above

fragment from the RRE sequence (RRE residues 2-224; HIV ARV2 residues 7767-6009) was used as a probe. A 6,000-fold molar excess of tRNA and a 50,000-fold weight excess of sonicated salmon sperm DNA were included in all reaction mixtures to prevent nonspecific binding. At saturating concentrations of Rev (1 to 3 nM), approximately 50% of the RRE RNA was retained on the filter (Figure 3A, top panel). By contrast, the affinity of Rev for antisense RRE sequences was approximately 20-fold lower than the affinity of Rev for RRE (Figure 3A, top panel). At much higher concentrations of Rev, binding of Rev to antisense RRE RNA becomes significant, and approximately 40% of input antisense RNA can be bound by 25 nM Rev (Figure 38). Formation of these low affinity complexes is efficiently blocked by addition of a l,OOO- to lO,OOO-fold molar excess of 16s rRNA as a nonspecific competitor RNA sequence. By contrast, complexes between Rev and RRE (formed using 1.25 nM Rev, a concentration close to the Ko for the Rev-RRE complex) are stable even in the presence of lO,OOO-fold molar excess of 16s rRNA (Figure 38). Complex formation between Rev and RRE RNA may also be detected by means of immunoprecipitation assays using a monoclonal antibody (NR4/3C4.22) directed toward the C-terminus of Rev (Figure 3A, bottom panel). Both the immunoprecipitation experiment and the filter binding experiment give similar values for the Ko of the Rev-RRE complex. Assuming that all the Rev molecules are competent to bind RRE, a Ko of *l-3 nM can be calculated. Since the monoclonal antibody is specific for Rev, the RNA binding activity detected in both assays

HIV-l 667

Rev Binds

to a Subdomain

of the RRE

0.6 P z 0.4 .a I Ii 0.2

4 0.0 IO

1

2

4

6 REV (nhblar)

6

10

o’5+

sense

antisense

Figure 4. Gel Mobility Shift Assay of Complex and Sense or Antisense RRE RNA

Formation

between

Rev

Reaction mixtures contained 20 pg of uniformly labeled RRE RNA (left lanes) or antisense RRE RNA (right lanes) and O-1000 nM Rev protein, as indicated above the lanes in (A) and (B). Complexes were fractionated on 6% polyacrylamide gels containing 43 mM Tris-HCI (pH 6.0), 50 mM KCI run for 24 hr at 4% and 20 mA with buffer recirculation

O.Oi

10000 Molar ratio of 16s rRNA/RRE

Figure

3. Complex

Formation

between

Rev and RRE RNA

(A) Nitrocellulose filter binding (top) and immunoprecipitation (bottom) of complexes formed between Rev and RRE RNA (open circles) or between Rev and antisense RRE RNA (filled circles). Reaction mixtures contained 20 pg of unifprmly labeled T7 RNA polymerase transcripts (223 nucleotides long, 600 cpmlpg), O-10 nM purified Rev protein, 1 bg of denatured salmon sperm DNA, 0.45 ug of yeast tRNA, 40 U of RNasin (Promega). 43 mM Tris-HCI (pH 6.0), 50 mM KCI. Reactions were incubated for 15 min at 4% before assaying for Rev binding capacity. (B) Competition between 16s rRNA and RRE for Rev binding. Nitrocellulose filter binding assays were performed as described above but included up to a lO,OOO-fold molar excess of 16s rRNA. Open circles: complexes formed between 1.25 nM Rev and ARE RNA. Filled circles: complexes formed between 25 nM Rev and antisense RRE RNA.

be due to Rev itself and not to contamination of the Rev protein preparation by low levels of an RNA binding protein derived from E. coli.

and 1000 nM. At concentrations of 6.7 and 13.4 nM Rev, where binding to RRE reaches saturation in the filter binding assay, most of the bound RRE RNA migrated as a discrete RNA-protein complex. As the concentration of Rev was increased, additional Rev-RRE RNA complexes with progressively decreasing mobility were formed. Complexes between Rev and antisense RRE sequences were not observed at Rev protein concentrations below 168 nM (Figures 4A and 48). However, at very high Rev concentrations, from 300 to 1000 nM protein, limited binding to antisense RNA was observed (Figure 48). At high Rev concentrations the antisense RNA probe appears to be degraded by a ribonuclease that contaminates the Rev preparation, whereas complexes formed between Rev and RRE were fully protected from endogenous ribonuclease digestion at these protein concentrations (Figure 4B).

must

Rev Forms Multiple Complexes with Intact RRE Complexes between Rev and RRE were also observed by mobility shift analysis on nondenaturing polyacrylamide gels (Figure 4) using Rev concentrations between 6.7 nM

Rev Protects a 33 Nucleotide Long Fragment from Ribonuclease Tl digestion The gel retardation and filter binding data suggested that the RRE sequence contains a high affinity binding site for Rev. At lower concentrations of Rev, the high affinity site becomes saturated, but at higher Rev concentrations additional complexes are formed as a result of either Rev

Cell 666

+REV 123

456 789

35 a 34b 33c

12

-REV 1011 12

3

45

6

1314 15 1617 16

3

d-

314 4

26e

-

Figure Figure 5. Protection of RRE RNA Fragments from Digestion Ribonuclease Tl before or after Binding to 186 nM Rev Protein

by

Binding reactions and ribonuclease digestions were performed and RNA was fractionated on 12% polyacrylamide gels as described in Experimental Procedures. In lanes 10-18, ribonuclease digestion took place before Rev binding; in lanes l-9, after Rev binding. Endpoints for the RRE RNA transcripts are as shown in Figure 7. For each transcript, digests were performed with 0.2, 0.5, and 1 U of enzyme. Lanes l-3 and 10-12: l-96 RRE transcript. Lanes 4-6 and 13-15: 26-122 RRE transcript. Lanes 7-9 and 16-18: 2-224 RRE transcript. Estimated nucleotide lengths of selected fragments are indicated at left.

binding to low affinity sites within the FIRE sequence or oligomerization of Rev protein molecules. To identify the high affinity binding site for Rev within the RRE, ribonuclease protection experiments were carried out. Figure 5 shows a comparison of the ribonuclease Tl digestion patterns of RRE sequences in the presence and absence of Rev. Digestion of free, uniformly labeled RRE RNA with 0.2, 0.5, or 1 U of ribonuclease Tl (Figure 5, lanes 16, 17, 16) produced a pattern of ribonucleaseresistant fragments ranging from approximately 5-33 nucleotides in length. Each of these fragments is a partial digestion product, since the largest predicted Tl oligonucleotide in the RRE sequence is only 12 nucleotides in length. After binding of the RRE RNA in the presence of 166 nM Rev (Figure 5, lanes 7, 6, 9), protected fragments of approximately 33 nucleotides (fragment c) and 26 nucleotides (fragment e) were observed. Estimates of the size8 of the protected fragments are accurate only to within 2 nucleotides because of the sequence-dependent mobility variation of RNA oligonucleotides during polyacrylamide gel electrophoresis. In the presence of Rev protein, fragment c was resistant to digestion by concen-

6. lmmunoprecipitation

of RRE RNA Fragments

Bound by Rev

Binding reactions using 186 nM Rev and ribonuclease Tl digestions (1 tJ of enzyme per reaction) were performed as described in the legend to Figure 5 and Experimental Procedures. Lanes l-3: Revprotected ribonuclease-resistant RRE fragments. Lanes 4-6: immunoprecipitation of Rev-protected ribonuclease-resistant RRE fragments by the NR4/3C4.22 monoclonal antibody. The l-96 RRE transcript (lanes 1 and 4) the 26-122 RRE transcript (lanes 2 and 5) and the 2-224 RRE transcript (lanes 3 and 8) were used. Positions of fragments referred to in Figure 5 and the text are indicated at left.

trations of ribonuclease Tl at least 20-fold higher than the enzyme concentrations required for complete digestion of the free RRE sequence. Fragment e may be a partial digestion product of fragment c since this product progessively accumulates during the digestion of fragment c. By contrast, fragment d (31 nucleotides), which is a relatively stable digestion product of RRE RNA, is not markedly protected from ribonuclease digestion in the presence of Rev. After binding to Rev and digestion with ribonuclease Tl, fragment c could also be selectively precipitated using a monoclonal antibody directed toward the C-terminus of Rev together with a rabbit anti-mouse antibody with affinity for protein A (Figure 6, lane 6). The smaller fragments d and e could not be immunoprecipitated in association with Rev (Figure 6, compare lanes 3 and 6). In control experiments using the anti-Rev monoclonal antibody or rabbit anti-mouse antibody alone, no immunoprecipitation of fragment c was observed. Localization of the Rev Binding Site within the RRE Sequence Gel-purified fragment c was unable to rebind Rev in a filter binding assay. However, during a screen of a partial digest of RRE RNA for fragments that were able to bind to Rev,

HIV-1 Rev Binds 689

to a Subdomain

of the RRE

-I

Z

.-E Z$ SI

i

t

2-224

zi

E

20 302

E

GBoog

+

a010

l-225 7881

l-96 26-122

rev binding

+

7811

7908 7037

52-151

+ 7838

7063

78-174

7950

7889

104200

7985 7915

130225

0.8

+

sot0

1

0.6

Figure 7. Rev Bindlng RRE Fragments

Capacity

of Truncated

(Top) Sequence endpoints of RRE fragment: prepared by PCR amplification of regions of the RRE sequence. PositIons of restrmon endonuclease cleavage sites discussed in the text are indicated on the upper scale. Tthllll Cleavage sites are present m the HIV-2 ROD RRE sequence only, but the analogous POW tions in the HIV-l RRE sequence are indicated (Bottom) Nitrocellulose filter bindlng assays were performed as described I” the legend to Figure 3 and Experimental Procedures using Rev protein concentrations from O-10 nM. Open circles/dashed line: 2-224 RRE transcript. Open circles/continuous line: l-96 RRE transcript. Filled circles: 26-122 RRE transcript. Filled triangles: 52-148 RRE transcript. Open triangles: 78-172 RRE transcript. Filled squares: 104-201 RRE transcript. Open squares: 130-225 RRE transcript.

0.0 0

2

4

8 REV (nMolar)

8

10

a fragment of approximately 70 nucleotides was obtained that was able to rebind Rev with an affinity close to that of the complete 223 residue RRE (data not shown). The failure of the protected 33 nucleotide fragment c to rebind to Rev suggests that this sequence is too small to form an appropriate structure for Rev binding, whereas the 70 nucleotide long fragment is able to refold and present an authentic binding site for Rev. To map more precisely the binding site for Rev within the RRE sequence, a series of truncated RRE sequences, each approximately 96 nucleotides long and overlapping by 70 nucleotides, was prepared by polymerase chain reaction (PCR) amplification and cloned into pGEM vectors. RNA polymerase T7 transcripts from each of these fragments were used in filter binding experiments to assay for Rev binding capacity (Figure 7, top). The RNA fragments corresponding to RRE residues l-96 (HIV residues 7786-7881) and 26-122 (781 l-7907) were able to bind Rev with the same affinity as the 223 nucleotide long RRE transcript (Figure 7, bottom). Because these two fragments overlap, these data map the Rev binding site to between residues 26 and 96 (7811 and 7881) of the RRE sequence. Since the transcript containing RRE residues 52-151 (7837-7936) did not bind Rev, an essential element for the Rev binding activity must be located between positions 26 and 52 of the RRE sequence (7811 and 7837). When the RRE transcripts l-96 and 26-122 were digested with ribonuclease Tl in the presence or absence of added Rev protein, protected fragments similar in length to fragment c obtained from the complete 223 resi-

due RRE transcript were observed (Figure 5). In the case of the l-96 transcript, the protected fragment (b 34) was 1 nucleotide longer than fragment c. For the 26-122 transcript, protected fragments both 1 (b) and 2 (a) nucleotides longer than fragment c were seen. Each of these protected fragments could be immunoprecipitated in association with Rev (Figure 6). Identical patterns of ribonuclease Tl protection were obtained when the concentration of Rev protein was varied between 46 and 930 nM (data not shown), suggesting that the ribonuclease-protected fragments represent the high affinity site for Rev binding. We have not yet formally assigned an exact sequence position to these partial digestion products. However, it seems likely that fragment c is residues 37-69, fragment b is residues 36-69, and fragment a is 35-69, since multiple G residues must be present at the ends of the protected fragments to generate a series of Tl oligoribonucleotides with these relative sizes. Work is in progress to sequence the protected fragments. The Rev Binding Site Maps to a Stem-Loop Structure within the RRE Malim et al. (1989a) have proposed a complex secondary structure for the RRE region based on calculation of “significant” minimal free energy in a sliding window through the env coding sequence. Using the RNA folding programs of Zuker (1989), we have confirmed that the structure proposed by Malim et al. (1989a) is the lowest energy structure predicted for the RRE sequences found in the HXB3 and ARV2 strains. However, the HIV BRU sequence

Cdl 690

ls

U A

GC

Figure 8. Predicted Structure from HIV-1 ARV2 (7811-7781)

A U

c”: looA UW GC AU

G

F AGCAZUAUG

ir

-G

Ups GACG

A tJ=m w*U G GC AGCSdA

for the Rev Binding

Region

in the RRE

Sequence alterations present in HIV-l BRU (bold arrows) and HIV-l HXB3 (thin arrows) are indicated. Broken arrow indicates 5’ end of the 52148 RRE transcipt, which does not bind Rev. Deletion of 5’ sequences up to the Haelll site at residue 84 (boxed residues) abolishes Rev activity in viM) (Malim et al., 1989a, 1989b).

shows a different minimal-energy structure. This structure includes a significant difference in the region of the RRE to which we have mapped the Rev binding site. The region around the Rev binding site (35-92) has the same predicted structure when the calculations are carried out using the entire RRE sequence, or more restricted sequences surrounding this domain. Folding of the BRU sequence Rev binding site (35-92) in a manner analogous to that described by Malim et al. (1989a) produces an unstable structure with a calculated AGo of -14.7 kcallmol as compared with a calculated AGo of -22.1 kcallmol for the ARV2 sequence. However, both the ARV2 and the HXB3 sequences can form structures analogous to the most favorable predicted folded structure for the BRU sequence with only a 12% reduction in their optimal free energy (AG”sRU = -18.3 kcal/mol, AGo= -19.5 kcallmol). We therefore favor the structure shown in Figure 8 for the Rev binding region of the RRE structure. Our results demonstrate that sequences present in the first stem-loop structure are essential for Rev binding. The 52-151 RRE transcript should contain an intact version of the second stem-loop, but is unable to bind Rev. Since the first stem-loop is only 20 nucleotides long, however, the Rev-protected oligoribonucleotides must extend into the second stem-loop. More detailed mapping studies of the Rev binding site are in progress. Discussion We have demonstrated that Rev protein binds specifically to a restricted region of the RRE region RNA sequence. Rev-RRE complexes have an apparent dissociation constant of 1 to 3 nM, assuming that all of the Rev molecules are competent to bind RNA and that the complex contains equimolar proportions of Rev protein and RRE RNA. The Rev protein used in these experiments was prepared by CNBr cleavage of a f3-galactosidase fusion protein and refolded. The value of 1 to 3 nM may be an underestimate

of the true dissociation constant, Since an excess of protein was used in the binding reactions and it is possible that a substantial fraction of the Rev protein prepared from E. coli has not attained a native conformation capable of specific binding to RNA. However, it should be noted that the apparent dissociation constant of the Rev-RRE complex is similar to that of bacteriophage R17 coat protein binding to R17 RNA (Carey et al., 1983; Romaniuk et al., 1987) and higher than the Ko of 10 nM determined by us for the binding of HIV-1 Tat protein to TAR RNA (Dingwall et al., 1989). Vartikar and Draper (1989) have demonstrated specific binding between ribosomal S4 protein and 16s rRNA even though the dissociation constant for this interaction is only 14 mM. Rev is highly sequence specific in its ability to bind RNA. Antisense transcripts of RRE, which are expected to have extensive secondary structures, bind approximately 20-fold less tightly to Rev. Moreover, in competition experiments, addition of 16s rRNA at levels between l,OOO- and lO,OOO-fold molar excess abolishes Rev binding to antisense transcripts but has no effect on Rev binding to RRE. Similarly, the TAR RNA stem-loop structure, which is selectively bound by Tat (Dingwall et al., 1989) and present in viral transcripts containing the RRE sequence, is not bound by Rev at protein concentrations of up to 80 nM (data not shown). The 20-fold difference in apparent dissociation constant between specific Rev binding to RRE sequences and nonspecific Rev binding to antisense (and other) RNA sequences is sufficient to account for the biological specificity of Rev. For example, Vartikar and Draper (1989) reported that the ribosomal S4 protein binds specifically to 16s rRNA, although the binding constant of S4 for its natural site on the 16s rRNA sequence is only5fold higher than that for nonspecific binding between S4 and tRNA. The weak affinity of Rev for ribosomal RNA sequences may also explain the observation that Rev, unlike most nuclear proteins, accumulates in the nucleoli of cells when expressed at high levels (Cullen et al., 1988; Felber et al., 1989; Malim et al., 1989c). It is not yet known which amino acid residues in the Rev protein are essential for RNA binding, but it seems likely that the arginine residues present in the “nucleolar localization signal” of Rev are simply contributing to its nucleic acid binding capacity. Malim et al. (1989a) have shown previously that the in vivo biological activity of Rev requires the presence of sequences between the 5’Styl site at HIV residue 7787 and the 3’ Sau3Al site at 7993 (see also Figures 7 and 8). Deletion of 64 nucleotides from the 5’Styl site to the Haelll site at 7851, as well as deletion of 39 residues from the Alul site at 7954 to the Sau3Al site (Figure 7), abolished Revdependent nuclear release of RNA transcripts. Similarly, deletion of 64 residues between Tthllll sites present in the RRE sequence from the HIV-2 ROD strain (the equivalent deletion in the HIV-1 RRE element would be residues 78387902, inclusive) also abolishes in vivo RRE function (Malim et al., 1989b). In this paper we have shown that only 71 nucleotides between positions 26 and 96 (7811 and 7881) are required for in vitro binding of Rev to the RRE sequence. Our local-

HIV-1 Rev Binds 691

to a Subdomain

of the RRE

ization of the Rev binding site to this region is consistent with the reported in vivo activity of deletions in the RRE region. Deletions extending 5’ to the Haelll site at 7851 abolish RRE function, and these mutations are expected to intl?rrupt the Rev binding site (Figure 8). However, the minimum sequences required for Rev binding in vitro do not appear to be sufficient to confer RRE activity in vivo since deletion of sequences 3’to the Alul site at 7954 abolishes RRE activity, but these sequences are not required for Rev binding. Thus the biological activity of the RRE may necessitate the binding of cellular factors to regions of the RRE not occupied by Rev. Experiments are now in progress to determine whether regions of the RRE present in sequences 3’ of the Rev binding site complement the Rev binding region and confer in vivo sensitivity to Rev. Zapp and Green (1989) and Daly et al. (1989) have also reported experiments demonstrating sequence-specific binding of RRE-derived sequences by Rev. Our estimate of a dissociation constant between 1 nM and 3 nM for the Rev-RRE interaction is in general agreement with Daly et al. (1989), who reported a dissociation constant of 0.3 nM. It should be noted, however, that the experimental protocol of Daly et al. (1989) differed slightly from ours. They prepared Rev protein from an E. coli strain that expresses Rev as an unfused protein, and these authors used longer RRE fragments (454 and 387 nucleotides) and buffers of higher ionic strength than were used in our experiments. Our results are also in substantial agreement with those of Zapp and Green (1989), who reported that Rev confers partial ribonuclease protection to RRE sequences. However, in contrast to our results, Zapp and Green (1989) reported that in vitro Rev binding is abolished by termination of RRE transcripts at the Hinfl site (residue 182) near the 3’ end of the RRE region. The demonstration that Rev, like Tat (Dingwall et al., 1989), is an RNA binding protein should prove to be of great value in the elucidation of the mechanism of action of these important viral Pans-activators. We have been able to map the Rev binding sequences within the RRE more precisely than in previous reports by constructing a series of overlapping RNA probe sequences that span the RRE region. Since additional sequences in the RRE are required for in vivo activity, our results suggest strongly that host proteins are involved in recognizing sequences in the 3’ half of the RRE region. The RNA binding assay we have described should also provide a useful in vitro method for characterizing mutations of RRE and Rev. Experimental

Procedures

Expression and Purification of Rev A synthetic gene was designed for the expression of Rev as a fusion protein with E. coli S-galactosidase (Figure 1). Codons infrequently used in either E. coli or mammalian genes were avoided; where the same amino acid occurred in succession, different codons were chosen. To facilitate later mutagenesis using the “cassette procedure” (Wells et al., 1965), internal restriction sites were placed at suitable intervals by selection of codons that did not alter encoded amino acid sequences. Oligonucleotides 42-72 residues long were synthesized on an Applied Biosystems 360B DNA synthesizer using the phosphoramidate

Procedure. After Purification by polyacrylamide get electrophoresis, 5oo Pmol of each oligonucleotide (except those at the 5’ ends of the gene) were phosphoryleted using T4 polynucleotide kinase and ATP Aliquots (50 Pmol) of each oligonucleotide were ligated as previously described (Heaphy et sl 1987a). and the ligation mixture was ethanol Precipitated twice and cloned in the incorrect or,entst,on for expression Into M13mp19 that had been cut with BamHl and HindIll, The se. quencas of candidate clones were ConfIrmed by the dldeoxy method (Bankier et al , 1987). The gene was excised from one Ml3 clone (MS 206)with the Correct sequence and cloned between the BamHl and HindIll Sites of the pUR289 expresston vector (Ruther and Mulier.HIli, 1963) to produce pMG670. E. coli strain JM109 carrying pMG670 was grown lo late logarlthmlc phase in 2x TY medium (Bankler et al., 1987) at 37°C in the presence of 100 pglml ampicillin and 50 pglml IPTG. The cells were suspendeu in 50 mM Tris-HCI (pH 6.4). 0.1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride, sonicated. and treated with DNAase I. Inclusion bodies containing the D-galactosidase-Rev fusion protein were prepared using nonionic detergents as described by Nagai and ThOgersen (1967). The inclusion body pellet was dissolved in 70% formic acid and cleaved with 100 mglml CNBr for 4 hr. The digest was diluted lo-fold with water, lyophilized, and resuspended in 50 mM Tris-HCI (pH 8.0), 100 mM NaCI, 8 M urea, and fractionated on a 25 ml Accell CM column (Waters Associates) equilibrated with the same buffer. Rev protein elutes between 0.1 and 0.2 M NaCI. Fractions containing Rev protein were dialyzed against 50 mM his-HCI (pH 8.0), 25 mM NaCI, 0.5 mM DTT, 1 mM MgClp, and stored at -20% in aliqUOtS Containing approximately 200 pglml protein. Rev protein preparations gradually lose RNA binding activity with repeated cycles of freezing and thawing. Monoclonal Antibodies Peptides corresponding to residues l-15 (MAGRSGDSDEDLLKA) and residues 102-116 (ILVESPTVLESGTKE) of Rev were synthesized by a semiautomatic, continuous-flow, solid-phase method (Dryland and Sheppard, 1986) using FMOC polyamide-activated ester chemistry (Atherton et al., 1986). Each peptide was coupled to keyhole limpet hemocyanin with glutaraldehyde, and antibodies were raised in rabbits and mice (Heaphy et al., 1987b). Mice were immunized with 50 kg Of KLH-peptide conjugate (injected intraperitoneally in complete Freund’s adjuvant) and boosted with 100 pg (intraperitoneally in incomplete Freund’s adjuvant) at 2 weeks and an additional 100 pg (intravenously) at 8 weeks. Fusions used l@ spleen cells and lo7 NSO murine myetoma cells (Galfrb and Milstein, 1981). After selection of clones in HAT medium, wells producing monoclonal antibodies ware screened by Western blotting using the P-galactosidase-Rev fusion protein as a substrate. Four clones raised against the C-terminal peptida (NR4/ iDi.3, ~Rq2C5.3, NR4/3D3.2, NR413C4.22) showed high affinity for Rev in Western blotting experiments. NR413C4.22 is an IgGl antibody with the highest affinity for Rev. The antibody has low affinity for protein A, but can be purified using protein G-Sepharose. NR4/3D3.2 is an IgM antibody useful for immunofluOreScence detection Of Rev. Plasmids Carrying RRE Sequences HIV sequences referred to include HIV-l IIIB (Ratner et al., 1985; Muesing et al., 1985; EM60 accession code REHTLV3), HIV-l ARV2 (Sanchez-Pescador et al., 1985; EMBO accession code AIARV2), and HIV-l BRU (Wain-Hobson et al., 1985; EMBO accession code HIVBRUCG). A Sty1 fragment (positions 7767-8009) from HIV-l strain ARV2, which was known to contain the RRE, was treated with dNTF% and DNA polymerase I (Klenow fragment) and cloned into the polylinker of pGEM1 (Promega) between the Pstl and Sacl sites. The orientation of the HIV insert in the resultant plasmid (pGEMRRE) was verified by sequence analysis of an EcoRI-Hindlll fragment of pGEMRRE subcloned into Ml3mp19. RRE RNA was prepared by transcription with T7 RNA polymerase after digestion of pGEMRRE with Hindlll. Antisense RNA transcripts were prepared by transcription with SP6 RNA polymerase after digestion of pGEMRRE with EcoRI. Transcription reactions (20 pl) were performed in 40 mM Tris-HCI (pH 7.5), 6 mM MgCIz, 2 mM spermidine, 10 mM NaCI. 1 mM DTT, 500 mM each ATP, GTP, and CTP, containing 1 pg of template DNA, 40 U of RNasin (Promega), and 40 pCi (100 pmol) of [cI-~*P]UTP. A series of seven overlapping DNA fragments, each about 96

Cell 692

nucleotides long and spanning the RRE sequence with overlaps of about 26 nucleotides. was prepared by PCR amplification. Fifty nanograms of pGEMRRE plasmid DNA was amplified in 50 pl reaction mixtures containing PCR buffer (10 mM Tris-HCI (pH 8.31, 50 mM KCI, 1.5 mM MgClz, 0.1 mg/ml gelatin), 200 umol of each dNTR 10 pmol of each oligonucleotide primer, and 1.25 U of Taq DNA polymerase (Cetus). Twenty-five rounds of cycling at 94% for 1 min. 30°C for 1 min, and 7X for 1 min were performed using a PHCl heating block (Techne). Each “forward” oligonucleotide primer contained a 10 bp extension including an EcoRl site, TAGCGAATTC, followed by 20 nucleotides complementary to the 5’ end of the section of RRE to be amplified. Similarly, each “backward” oligonucleotide primer contained a 10 bp extension including a Hindlll site, TGGCAAGCTT, followed by 20 nucleotides complementary to the S’end region of the RRE sequence to be amplified. The amplified DNA was digested with EcoRl and Hindlll and cloned into pGEM1. Sense transcripts of these fragments were prepared by transcription with T7 RNA polymerase after digestion with Hindlll. RNA Binding Aeseys For filter binding assays, each reaction mixture contained 20 pg of uniformly labeled RNA probe (approximately 500 cpm per pg of RNA), 1 ug of sonicated salmon sperm DNA, 0.45 ug of yeast tRNA, and 40 U of RNasin (Promega) in 506 ul of TK buffer (43 mM Tris-HCI [pH 8.01, 50 mM KCI). Incubation was at 4OC for 15 min in the presence of O-10 nM purified Rev protein. In some experiments, other reagents such as 16s rRNA were added to the binding reactions as indicated in the figure legends. To measure binding, each reaction mixture was applied under gentle vacuum to a 0.45 urn Millipore filter that had been prewetted with TK buffer. The filters were washed three times with 600 ul of TK buffer and dried, and radioactivity was counted by liquid scintillation. lmmunoprecipitation assays were carried out by adding 100 ul of culture supernatant containing approximately 56 @ml NR4/3C4.22 antibody, 2 ul of rabbit anti-mouse IgG (5 mg/ml in phosphate-buffered saline), and 40 pl of a 50% slurry of protein A-Sepharose (in phosphate-buffered saline) to the binding reactions. The samples were roll mixed for 1 hr at 4OC and the Sepharose beads separated by centrifugation. After the beads were washed three times with ice-cold TK buffer, radioactivity was determined by liquid scintillation. Samples for gel mobility shift assays were prepared in binding reactions similar to those described above, but using a final volume of 20 ~1. Electrophoresis was carried out using 6% polyacrylamide gels (acrylamide to bisacrylamide ratio of 4O:l) in TK buffer. Following preelectrophoresis for 2 hr, gels were run at 4OC for 24 hr at 20 mA, with buffer recirculation. Rlbonucleeee Protection Aseeys Complexes between Rev and RRE or RRE subfragments were prepared in 5-20 ul reactions containing 168 nM Rev protein and buffers and additions as described above. After binding was complete, samples were digested with O-5 U of ribonuclease Tl (Calbiochem) for 10 min at 3pc. The digestion was terminated by adding an equal volume of 90% formamide (in 0.1 mM EDTA [pH 7.41); the mixture was heated to 8tPC for 2 min. and the digestii products were analyzed by etectrophoresis on 12% polyacrytamide gels containing TBE buffer and 7 M urea (Bankier et al., 1987). Molecular sizes of the digestion products were estimated by comparison with ladders prepared by partial alkaline hydrolysis of RNA molecules of known length. Because of sequence-dependent variation in the mobility of RNA molecules in gels of this type, estimates of fragment size are only accurate to within 2 nucleotides. In some experiments, complexes between Rev and RRE sequences were immunoprecipitated prior to analysis of the ribonuclease Tl digestion products on potyacrylamide gels. Reaction mixtures (100 ul) were incubated with NR4/3C4.22 antibody (50 pl). rabbit anti-mouse IgG (1 rJ, 5 mglml), and protein A-Sepharose (20 Kl) for 1 hr at 4“C as described above. After the Sepharose beads were washed in TK buffer, the beads were resuspended in 100 ul of 90% formamide (in 0.1 mM EDTA [pH 7.41) and heated to 8ooc for 2 min to release the bound RNA; an aliquot of the supernatant was applied to 12% denaturing polyacrylamkle gels as described above.

We thank Robert Valerio for synthesizing the Rev peptides, Terry for preparing synthetic oligonucleotides, and our colleagues MRC AIDS-Directed Programme for their support. J. K. is an lished Investigator of the American Heart Association. The costs of publication of this article were defrayed in part payment of page charges. This article must therefore be marked “adverfisement” in accordance with 18 USC. Section solely to indicate this fact. Received

December

Smith in the Estabby the hereby 1734

21, 1969.

References Atherton, E., Cameron, L., Meldal, M., and Sheppard, R. C. (1986). Self-indicating activated esters for use in solid phase peptide synthesis. Fluorenylmethoxycarbonytamino acid derivatives of 5hydroxy4 oxodihydrobenzotriazine. J. Chem. Sot. Chem. Commun., 1763-1765. Bankier, A. T., Weston, K. M., and Barrell, 8. G. (1987). Random cloning and sequencing by the dideoxy nucleotide chain termination method. Meth. Enzymol. 755, 51-93. Carey, J., Cameron, V., de Haseth. P L., and Uhlenbeck, 0. C. (1983). Sequence specific interaction of R17 coat protein with its ribonucleic acid binding site. Biochamistry 22, 2601-2610. Cullen. B. R., Hauber, J., Campbell, K., Sodroski, J. G., Haseltine, W. A., and Rosen, C. A. (1988). Subcellular location of the human immunodeficiency virus transacting art gene product. J. Virol. 62, 2498-2501. Daly, T. J., Cook, K. S., Gary, G. S., Maione, T E., and Rusche, J. R. (1989). Specific binding of HIV-1 recombinant Rev protein to the Revresponsive element in V&J. Nature 342, 816-819. Dingwall, C.. Emberg, I., Gait, M. J., Green, S. M., Heaphy, S., Karn, J., Lowe, A. D., Singh, M., Skinner, M. A., and Vaferio, R. (1989). Human immunodeficiency virus 1 tat protein binds ffans-activationresponsive region (TAR) RNA in vitro. Proc. Natl. Acad. Sci. USA 86, 6925-6929. Dryland, A., and Sheppard, R. C. (1986). Peptide synthesis. Fart 8. A system for solid-phase synthesis under low pressure continuous flow conditions. J. Chem. Sot. Perkin Trans. I 728, 125137. Emerman, M., Vazeux, R., and Peden. K. (1989). Therevgene of the human immunodeficiency virus affects envelope-specific localization. Cell 57, 1155-1165.

product RNA

Feinberg, M. B., Jarrett, R. F., Aldovini, A., Gallo, R. C., and WongStaal, F (1988). HTLV-III expression and production involve complex regulation at the levels of splicing and translation of viral RNA. Cell 46, 807-817. Felber, B. K., Hadzopoulou-Cladaras, M., Cladaras, C., Copeland, T., and Pavlakis. G. N. (1989). Rev protein of human immunodeficiency virus type 1 affects the stability and transport of the viral mRNA. Proc. Natl. Acad. Sci. USA 86, 1495-1499. Galfre, G., and Milstein, C. (1981). bodies. Meth. Enzymol. 73, 3-46.

Preparation

of monoclonal

anti-

Heaphy, S., Singh, M.. and Gait, M. J. (1987a). Cloning and expression in E. cotiof a syntheticgene for the bacteriocidal protein caltriruseminal plasmin. Protein Engineering I, 425-431. Heaphy, S., Singh. M., and Gait, M. J. (198/b). acid changes in the region of the adenylylation Biochemistry 26, 1688-1696.

Effect of single amino site of T4 RNA ligase.

Kim, S., Bym, R., Groopman, J., and Baltimore, D. (1989). Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: evidence for differential gene expression. J. Viml. 63, 3708-37f3. Knight, D. M., Flomerfelt, F A., and Ghrayeb, J. (1987). Expression of the art/b protein of HIV and study of its role in viral envelope synthesis. Science 236, 837-840. Malim, M. H., Hauber, J., Fenrick, R., and Cullen, B. R. (1988). nodeficiency virus rev frans-activator modulates the expression viral regulatory genes. Nature 335, 181-183.

Immuof the

HIV-1 Rev Binds to a Subdomain 693

of the RRE

Malim, M. H., Hauber, J., Le, S-Y,, Maizel, J. V., and Cullen, B. Ft. (1989a). The HIV-l rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature 338, 254-257. Malim,M. H., Bdhnlein, S., Fenrick, R., Le, S.-Y., Maizel, J. V., and Cullen, B. R. (1969b). Functional comparison of the Rev trans-activators encoded by different primate immunodeficiency virus species, Proc. Natl. Acad. Sci. USA 86, 8222-6226. Malim, M. H., whnlein, S., Hauber, J., and Cullen, 8. R. (1989c). Functional dissection of the HIV-1 Rev trans-activator-derivation of a transdominant repressor of Rev function. Cell 58, 205-214. Muesing, M. A., Smith, D. H., Cabradilla, C. D., Jr., Benton, C. V., Kasky, L. A., and Capon, D. J. (1985). Nucleic acid structure and expression of the huma’n AlDSllymphadenopathy retrkirus. Nature 373, 450-458. Nagai, K., and Thggersen, H. C. (1967). Synthesis and sequencespecific proteolysis of hybrid proteins produced in Escberichia co/i, Meth. Enzymol. 753, 461-481. Ratner, L.. Haseltine, W., Patarca, R., Livak, K. J., Starcich, B. R., Joseph% S. F, Doran, E. R., Rafalski, J. A., Whitehorn, E. A., Baumeister, K., Ivanoff, L., Petteway, S. R., Jr,, Pearson, M. L., Lautenberger, J. A., Papas, T. S., Ghrayeb. J., Chang, N. T., Gallo, R. C., and Wang-Staal, F. (1985). Complete nucleotide sequence of the AIDS virus, HTLV-III. Nature 373, 277-284. Romaniuk, P J., Lowary, l?, Wu, H.-N., Stormo, G., and Uhlenbeck, 0. C. (1987). RNA binding site of R17 coat protein. Biochemistry 26, 1563-1568. Rosen, C. R., Terwilliger, E., Dayton, A. I., Sodroski, J. G., and Haseltine, W. A. (1988). lntragenic cis-acting art gene-responsive sequences of the human immunodeficiency virus. Proc. Natl. Acad. Sci. USA 85, 2071-2075. Riither, clones.

U., and Miiller-Hill, B. (1983). EMBO J. 2, 1791-1794.

Easy

identification

of cDNA

Sadaie. M. R., Benter, T., and Wong-Staal, F. (1986). Site-directed mutagenesisof two trans-regulatory genes (tat-Ill, trs)of HIV-l. Science 239, 910-913. Sanchez-Pescador, R., Power, M. D., Barr, P. J., Steimer, K. S., Stempien, M. M., Brown-Shimer, S. L., Gee, W. W., Renard, A., Randolph, A., Levy, J. A., Dina, D., and Luciw, P A. (1985). Nucleotide sequence and expression of an AIDS-associated retrovirus (ARV-2). Science 227, 484-492. Sodroski, J., Goh, W. C., Rosen, C. A., Dayton, A., Temilliger, E., and Haseltine, W. A. (1986). A second post-transcriptional trans-activator gene required for HTLV-III replication. Nature 327, 412-417. Vartikar, J. V., and Draper, E. D. (1989). S4-16s ribosomal RNA complex. Binding constant measurements and specific recognition of a 46C-nucleotide region. J. Mol. Biol. 209, 221-234. Wain-Hobson, S., Sodgo, F’., Danos, O., Cole, S., and Alizon, M. (1985). Nucleotide sequence of the AIDS virus, LAV. Cell 40, 9-17. Wells, J. A., Vasser, M., and Powers, D. B. (1985). Cassette mutagenesis: an efficient method for generation of multiple mutations at defined sites. Gene 34, 315-323. Zapp, M. L., and Green, M. R. (1989). Sequence-specific the HIV-1 Rev protein. Nature 342, 714-716. Zuker, M. (1989). On finding cule. Science 244, 48-52.

all suboptimal

foldings

binding

by

of an RNA mole-