Mol Biol Rep DOI 10.1007/s11033-014-3075-z
Identification of differentially expressed genes in hypothalamus of chicken during cold stress X. Y. Chen • R. Li • M. Wang • Z. Y. Geng
Received: 6 February 2013 / Accepted: 4 January 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract In order to discover the mechanism of cold stress and identify differentially expressed genes in hypothalamus during cold stress, 4 weeks of age Huainan partridge chickens, Chinese indigenous breed, were chosen for 24 h cold stress and then hypothalamus were isolated and labeled by reverse transcription reaction for cDNA. Labeled cDNA were hybridized with cDNA microarray. After scanning and image processing, the different gene expression profiling of hypothalamus and normal control was investigated. The differentially expressed genes included 334 down-regulated genes and 543 up-regulated genes. In these differentially regulated genes, myosin heavy chain polypeptide 11 (MYH11), light chain polypeptide 9 (MYL9) and tenascin-Y (TNXB), etc., which involved in muscle activity were significantly down-regulated. Genes like cholecystokinin (CCK), neuropeptide Y (NPY), neuropeptide Y receptor 5 (NPY5R), hypocretin receptor 2 (HCRTR2) and hypocretin neuropeptide precursor (HCRT) which responsible for regulation of feeding behavior were significantly up-regulated. In addition, genes responsible for lipid synthesis, like apolipoprotein (APOB) and agouti related protein homolog (AGRP), were also up-regulated. Through pathway analysis using the Kyoto Encyclopedia of Gene and Genomics, during 24 h cold stress, the neuroactive ligand-receptor interaction was firstly initiated in chickens for stimulation of central nervus for feed intake.
Electronic supplementary material The online version of this article (doi:10.1007/s11033-014-3075-z) contains supplementary material, which is available to authorized users. X. Y. Chen R. Li M. Wang Z. Y. Geng (&) College of Animal Science and Technology, Anhui Agricultural University, No. 130, Changjiang West Road, Hefei 230036, China e-mail: [email protected]
Adipocytokine signaling pathway was in high activation for supplementation of body energy. Jak-STAT, Ca2? signaling pathway and other biological reactions were also initiated in response to cold stress. The biological pathways participated in cold stress would provide important information for clarify the mechanism of cold stress and the differentially expressed genes would give much help for screening of candidate genes in breeding of cold stress resistant lines. Keywords Huainan partridge chicken Cold stress Hypothalamus Gene expression
Introduction Chickens are highly sensitive to environmental temperatures which should be controlled within an appropriate range for optimal performance [1]. A standard rearing practice is to maintain the environmental temperature at which neonatal chickens are reared at about 32 °C for about 1 week and then to decrease it gradually. Chickens would gradually leave the external heating after 4 weeks. During this period, sudden decrease of environmental temperature would cause body and/or uniformity not meets the standards, and consequently affecting the production performances [2]. It is widely accepted that chickens exposed to chronic or acute cold stress will cause variable modulatory effects on neuroendocrine system [3–5], antioxidant system [6], immune system [7–9], etc. Cold stress has been one of the major factors restricting poultry development [10]. In 2002, according to incomplete statistics, snowstorm has affected 23,221,900 livestock and 38.14 million dead, a large number of dams aborted or
123
Mol Biol Rep
stillbirth in eastern Inner Mongolia (Taken from the 2002 government work report of the Inner Mongolia Autonomous Region). Low temperature accompany with snowing has caused serious economic losses in the north of China. In 2008, continued snow disasters caused significant economic losses in poultry in South of China. According to statistics, 19.55 million poultry died, 7 million square meters poultry house collapsed, with a direct economic loss of 100 million in currency. Therefore, genetic improvement in cold and disease resistant chicken line through artificial selection program would be the most effective for reducing economic losses caused by cold stress [11]. Researches on the mechanisms of cold stress, neuro-endocrine variation and related gene expression would be much helpful for selection of indicators for chicken cold stress evaluation. In this experiment, differentially expressed genes in hypothalamus in pre- and 24 h post-cold stressed Huainan partridge chickens, a Chinese indigenous breed, was systematically identified by Agilent chick genome array. We expected that study of these differentially expressed genes may increase our understanding of cold stress mechanism and may allow the development of innovative strategies for breeding of anti-stress breeds.
Materials and methods Birds The quality broilers used was an indigenous Chinese breed, the Huainan partridge chicken. A total of 300 physically healthy males at 4 week of age, obtained from Feixi the Old Hens Farming Co., Ltd., were randomly divided into six groups of 50 birds. Three groups were assigned to the control group while the other three were assigned to 24 h cold stress treatment. The six groups were bred individually with nipple drinkers, and rice husk was used as floor bedding. Water and an unmedicated corn-soy-based diet that met the NRC requirements [12] were provided ad libitum. Chickens were housed at a constant temperature of 24–26 °C with artificial temperature control system before experiment. During cold stress, temperature from three pens were rapidly decreased to 2 ± 2 °C within 1 h through air conditioner whereas the chickens in the other three pens were kept continuously in a normal thermal environment [normal temperature (NT): 24–26 °C], which served as the control treatment. After 24 h cold exposure, 10 chickens from each group were euthanized immediately by exsanguinations after electrical stunning via electrodes on both sides of the head to obtain hypothalamus samples [13]. Samples were rapidly removed aseptically and stored in the RNAlater (Sangon Biotech, China) till for RNA extraction. All experimental protocols were approved by
123
the committee for the Care and Use of Experimental Animal at Anhui Agricultural University. Extraction of total RNA and purification of mRNA Total RNA was prepared by the Trizol reagent method (Invitrogen Corporation, Carlsbad, CA, USA) according to the instructions of the manufacturer. After RNA extraction, ten samples from each group were first equivalently mixed to form six mixed samples, three mixed samples of control and three of 24 h cold treatment. The three mixed samples then equivalently mixed again to form two pools, control pool and 24 h cold treatment pool. The mRNA was purified from the pools of total RNA using RNeasy Kit (QIAGEN, German) according to the producer’s protocol. The RNA quantity and quality were determined by 2100 Bioanalyzer (Agilent, American) and Biophotometer (Eppendorf, German) and then stored at -70 °C until analysis. Any RNA samples that showed degradation was excluded from the study. Labeling and hybridization One microgram of total RNA was used for generation Cy3labeled (GE healthcare, England) complementary RNA (cRNA). The labeling reaction was performed according to the manufacturer’s protocol. The samples were hybridized to the Chicken Genome-G2519F Genechip (Agilent, American), stained, washed and scanned according to the standard Agilent protocol. The computer data files to be used in data analysis were generated with SBC analysis system (SAS) Version 2.0, using the statistical algorithm provided. All chip samples were scanned according to the manufacturer’s protocol. Data quality assessment was then performed following the guidance in Agilent data analysis fundamentals manual. All quality control results met Agilent recommended criteria. Data process and analysis For comparison of differential gene expression in pre- and 24 h post-cold stressed chickens, the signal intensity of each probe was divided by that of negative control to filter the genes which were not expressed. The signal intensity of each gene was globally normalized using LOWESS within the R statistics package. Results from the difference analysis were clustered and displayed using R-software (The R-project for Statistical Computing, http:// www.r-project.org/). Each list of differentially expressed genes was analyzed using Kyoto Encyclopedia of Gene and Genomics (KEGG) database by using SAS. For each pathway, the probability values were computed based on
Mol Biol Rep Table 1 Primer sequences and real time quantitative results of 8 genes
Gene name
GeneBank no.
Primer
Relative expression level 0h
DRD3
XM_003640452.1
tgcaggagggtctctctcat
24 h
2.14
8.35
1.05
3.40
2.01
11.23
4.52
20.30
7.23
2.01
tatgcctccctctgaaaacg attaccactctggcccactg
1.89
0.64
tggatgtttggcactgtcat
2.56
6.08
1.37
5.61
1
1
tcaccatgaaggggaggtag GH1
NM_204359.1
ggaggaccagaggtacacca tcccttcttccaggtccttt
CCK
NM_001001741
aggttccactgggaggttct cgcctgctgttctttaggag
POMC
NM_001031098.1
aaggcgaggaggaaaagaag ccttcttgtaggcgcttttg
MYH11
NM_205274.1
gcagctgaccaaactgatga gacggaattcctggaagaca
CHRNA9
NM_204760.1
NPY5R
NM_001031130.1
gccatgttttgccgttaagt TSHB
AF033495.1
GAPDH
JQ280469.1
ctctttggcctgacttttgg tgtgcacacgttttgagaca aaagtccaagtggtggccatc tttcccgttctcagccttgac
R-package Fisher’s exact test. P value \0.05 was considered significant categories. To assess the false discovery rate (FDR) (q-values) of the differentially expressed gene result, a control expression sets were calculated by significance analysis of microarrays according to Tusher’s method [14].
tissues. Relative expression level of each gene in one tissue (DCt) was calculated by Ct target gene—Ct GAPDH; relative expression of each gene in two different tissues (DDCt) was calculated by DCtA - DCtB.
Results Microarray testing by quantitative RT-PCR (qRT-PCR) Differentially expressed genes were selected from results of microarray. 1 lg of total RNA was reverse transcripted using random hexamers and superscript-II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). The primers were designed with Primer 5. Gene symbols and primers are listed in Table 1. QRT-PCR was performed by using Rotor-gene 6000 (Corbett, Australia) and SYBR Green Detection (Takara, Japan).The PCR reactions were performed in a 10 ll volume containing a 19SYBR Green Master Mix, 50 ng cDNA, 300 nM of forward primers, 300 nM of reverse primers. The amplification condition was 50 °C for 2 min; 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 59 °C for 1 min; a final soak at 4 °C was also incorporated. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. All of the samples were measured in duplicate. Two measurements of each tissue sample were averaged for further analysis. The comparative Ct method was used to calculate the relative gene expression level across the
Differentially expressed genes in hypothalamus in preand 24 h post-cold stress Identifying differential expression genes was achieved by using SAS with a FDR of 0.5 %. Comparative analysis revealed that 877 genes were differentially expressed in 24 h post-cold stress compared to pre-cold stress in hypothalamus, from which 543 genes were up-regulated and 334 genes down-regulated (additional file 1). Gene function enrichment was analyzed according to the group of genes that share common biological function, chromosomal location, or regulation. The tendency of these expressed genes in the signaling pathway was analyzed according to the p value, that is, the smaller the p value, the more significant correlation to cold stress. Together with the differentially expressed (DE) genes involved within the threshold (p \ 0.05), the most significant biological process categories are neuroactive ligand-receptor interaction, adipocytokine signaling pathway and cytokine–cytokine receptor interaction (Table 1, additional file 2).
123
Mol Biol Rep Table 2 KEGG biological pathways for differentially expressed genes in 24 h post cold stress KEGG pathway name
Genes involved
p Value
Neuroactive ligand-receptor interaction (NLI)
28
0.0
Adipocytokine signaling pathway (ASP)
3
0.008
Cytokine-cytokine receptor interaction (CRI)
5
0.009
Jak-STAT signaling pathway (JSP)
4
0.011
Pathways identification by overabundant genes
Butanoate metabolism (BM)
2
0.017
Calcium signaling pathway (CSP)
4
0.022
Melanogenesis (MG)
3
0.026
Lysine degradation (LD)
2
0.028
Tryptophan metabolism (TM)
2
0.028
Vascular smooth muscle contraction (VSMC)
3
0.036
Tight junction (TJ)
3
0.05
Additional file 1 877 differentially expressed genes in hypothalamus of Huainan partridge chicken exposed to 24 h cold stress relative to control group. Agilent Probe Set ID, Fold change, Regulation, Gene Symbol, GO Biological Process, GO Molecular Function, GO Cellular Component, Ensembl ID and Chromosome Number are listed in the table. Additional file 2 Differentially expressed genes play key roles in Huainan partridge chicken exposed to 24 h cold stress
Notably, in the up-regulated genes, most genes have been reported to be involved in feed intake adjustment, such as cholecystokinin (CCK), neuropeptide Y (NPY), neuropeptide Y receptor 5 (NPY5R), hypocretin receptor 2 (HCRTR2) and hypocretin neuropeptide precursor (HCRT) that gives rise to two mature neuropeptides, and orexin A and orexin B which bind to orphan G-protein coupled receptors HCRTR1 and HCRTR2, function in the regulation of feeding behavior, metabolism and homeostasis [15]. Since CCK, NPY, NPY5R, HCRTR2 and HCRT are known to be involved in feed intake, it can be of interest to further investigate their potential role during cold stress in detail. Another group of genes known to encode enzymes for glutamate metabolism and neuro-signal transducing peptide appeared to be significantly down regulated, such as phosphomannomutase 2 (PMM2), cholinergic receptor (CHRNA9), etc. Myosin heavy chain polypeptide 11 (MYH11), light chain polypeptide 9 (MYL9) and tenascin-Y (TNXB) were also down regulated for more than three times below. The up regulation of glucagons receptor, apolipoprotein (APOB), proopiomelanocortin (POMC) and agouti related protein homolog (AGRP), and the down regulation of alpha-1-antitrypsin and phospholipids-transporting ATPase suggested lipid synthesis is more important for energy storage than lipid metabolism during 24 h cold stress [16, 17]. Considering all of those significantly changed genes, neuropeptide gamma (TAC1), Gamma-aminobutyric-acid receptor alpha-5 receptor precursor (GABA(a) receptor), thyrotropin
123
releasing hormone (TRH), HCRTR2 were all 10 times more changed after 24 h cold stress.
A pathway analysis database, KEGG, was then applied to genes differentially regulated after 24 h cold stress. Several overrepresented pathways were identified (Table 2), and the enriched pathways appeared not to be independent of one another, many genes involved in one pathway could be also involved in another pathway. As demonstrated, neuroactive and adipocytokine-related pathways were significantly over-represented in post 24 h cold stress. These findings, on the one hand, provide evidence supporting previous experiments [18] that neural signaling transduction play important roles during cold stress. On the other hand, it further demonstrated that particular components of neural and adipocytokine systems can be crucial for the process of cold stress. Validation of gene transcription by real-time PCR Quantitative real-time PCR is still the gold standard for quantitative analysis of mRNA. In order to validate the microarray results, qRT-PCR was carried out on the same set of samples that were analyzed by the microarray approach. A total of eight genes were selected for these verifications. These genes included induced and repressed genes that were significantly expressed and representative in each metabolic pathway. For the genes down regulated in microarray results, genes tested by qRT-PCR were also significantly down-regulated and genes up regulated in microarray were also significantly up-regulated. Representative qRT-PCR results of eight genes are shown in Table 1.
Discussion In this research, Huainan partridge chicken, a Chinese indigenous breed which was included in Convention on Biological Diversity (CBD) as one of the sustainable breed for use, in 4 weeks of age was used in this experiment. Local breeds in Chinese and other countries usually reared under natural environment after 3–weeks of age by captive or thick pad without any additional thermal providing. The sudden environmental change (like La Nina phenomenon) would cause high negative effect on growth and other aspects. Thus, it is highly urgent to explore the underground mechanisms of cold stress which might provide useful methods for selection of anti-stress lines from indigenous breeds.
Mol Biol Rep
In this study, we first examined the gene expression profiles of chicken hypothalamus when exposed to cold stress. Data analysis identified 877 genes that might be significantly correlated with cold stress, out of which 41 genes were functional annotated in KEGG pathway. The list of differentially expressed genes contains many genes which might be important for stress resistance. Most of these genes have not been reported to be related to stress before. For example, MYH11 and MYL9, which encode myosin of smooth muscle has been shown to be significantly down regulated. During cold stress, chicken always curled up with little movement [19], this might because of the down regulation of the two mentioned genes. Cold stress induces physiological responses which are of high priority and energy demanding in homeotherms [20– 22]. Cold stress elevated basal metabolic rate and increased energy metabolism with significant health and welfare down regulation as stressors are believed to affect health and welfare of animals [23, 24]. It is always considered that cold stress alter the function of hypothalamic-pituitary axis resulting in changes in the systemic levels of adrenal and thyroid hormones levels [3, 5, 18, 25, 26]. From the microarray results, TRHR was 7 times up-regulated, TRH was significantly 28 times up-regulated and TSHb was 4 times up-regulated. Furthermore, neuropeptide Y was also 4 times up-regulated. The up-regulation of these genes suggested that neuropeptide and related hormones coparticipated in the stress response. It is suggested that neuroendocrine will rapidly elevated within seconds or minutes during cold stress [26], however, a 24 h sustained high expression level of genes encoding neuroendocrine was observed in this experiment. When animals are exposed to extreme cold stress, a number of biological processes are initiated to maintain body homeostasis [27]. During extreme cold, the outside temperature falls rapidly and substantial amount of dietary energy may be diverted from productive functions to the generation of body heat, thus feed intake will increase to compensate for heat loss. In addition, genes related to promote appetite, such as CCK [28, 29], NPY [30], NPY5, were all substantially up-regulated which might responsible for the stimulation of feed intake to maintain body temperature [31]. After 24 h cold stress, genes related to adipocytokine signaling pathway were significantly activated for thermal production. It is well preferred that lipid metabolism for energy requirement be the first event during cold stress. However, which might be more important during cold stress, lipid synthesis or lipid metabolism? When considering the activated genes after 24 h cold stress, AGRP 7 times up-regulated, POMC 12 times upregulated, and the up regulation of glucagons receptor, APOB, and down regulation of alpha-1-antitrypsin and phospholipids-transporting ATPase, which all suggested
that lipid synthesis for energy storage might be the first response against the cold stress for animals. Conclusions The broiler industry in China is primarily driven by the production of quality chicken. The breeding of these kind of chickens usually need open separating without external heating during winter. Therefore, one of the challenges the producer must overcome in the pursuit of this goal is potential cold stress that the broiler may experience. The present breeds of chickens which have undergone intensive selection for higher production may have lost their ability to cope with cold stress. Therefore, there is need to understand how cold affect health status of chickens and which measure should be first taken. We first examined the gene expression profiles of broiler exposed to cold stress for 24 h. Analysis of those DE genes suggested that many biological pathways participated in cold stress which might provide important information for the clarification of the mechanism of cold stress. Genes responsible for muscle contraction and lipid synthesis would give insight that enzymes for lipid synthesis could be considered for broiler production during a relatively low temperature. The significantly expressed DE genes might be considered as candidate genes for cold stress and more attention should be given for the polymorphisms of those DE genes which might be as marker assisted sites for cold-resistant species breeding. Acknowledgments This work was financially supported by grant from The National Natural Science Foundation for Young Scholars of China (Grant No. 31101710).
References 1. Shinder D, Rusal M, Tanny J, Druyan S, Yahav S (2007) Thermoregulatory responses of chicks (Gallus domesticus) to low ambient temperatures at an early age. Poult Sci 86:2200–2209 2. Yahav S (2000) Domestic fowl—strategies to confront environmental conditions. Avian Poult Biol Rev 11:81–95 3. Noh SJ, Kang DW, Yoo SB, Lee JY, Kim JY, Kim BT, Lee JH, Jahng JW (2012) Stress-responsive hypothalamic-nucleus accumbens regulation may vary depending on stressors. Indian J Exp Biol 50:447–454 4. Chen XY, Jiang RS, Geng ZY (2011) Neuroendocrine responses to cold stress in Chinese indigenous breeds from different latitude. J Anim Vet Adv 10:3043–3047 5. Wang JT, Xu SW (2007) Effects of cold stress on hypothalamic corticotrophin-releasing and thyrotropin-releasing hormone messenger RNA levels in chickens. J Northeast Agric Univ 14:327–332 6. Selman C, Mclaren JS, Himanka MJ, Speakman JR (2000) Effect of long-term cold exposure on antioxidant enzyme activities in a small mammal. Free Rad Biol Med 28:1279–1285
123
Mol Biol Rep 7. Hangalapura BN (2006) Cold stress and immunity: do chickens adapt to cold by trading-off immunity for thermoregulation?. Wageningen University, Wageningen 8. Hangalapura BN, Nieuwland MG, de Vries Reilingh G, Heetkamp MJ, van den Brand H, Kemp B, Parmentier HK (2003) Effects of cold stress on immune responses and body weight of chicken lines divergently selected for antibody responses to sheep red blood cells. Poult Sci 82:1692–1700 9. Hangalapura BN, Nieuwland MG, de Vries Reilingh G, van den Brand H, Kemp B, Parmentier HK (2004) Durations of cold stress modulates overall immunity of chicken lines divergently selected for antibody responses. Poult Sci 83:765–775 10. Blahova´ J, Dobsˇ´ıkova´ R, Strakova´ E, Suchy´ P (2007) Effect of low environmental temperature on performance and blood system in broiler chickens (Gallus domesticus). Acta Vet Brno 76:S17– S23 11. Sonna LA, Fujita J, Gaffin SL, Lilly CM (2002) Effects of heat and cold stress on mammalian gene expression. J Appl Physiol 92:1725–1742 12. National Research Council (1994) Nutrient requirements of poultry, 9th edn. The National Academies Press, Washington DC 13. Department of Agriculture, Plant and Animal Health Inspection Service (2004) Blood and tissue collection at slaughtering and rendering establishments, final rule. 9CFR part 71, Federal Register 69, 10137-10151 14. Tusher V, Tibshirani R, Chu G (2001) Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA 98:5116–5121 15. Ahmed WA, Tsutsumi M, Nakata S, Mori T, Nishimura Y, Fjisawa T, Kato I, Nakashima M, Kurahashi H, Suzuki K (2012) A functional variation in the hypocretin neuropeptide precursor gene may be associated with obstructive sleep apnea syndrome in Japan. Laryngoscope 122:925–929 16. Valassi E, Scacchi M, Cavagnini F (2008) Neuroendocrine control of food intake. Nutr Metab Cardiovasc Dis 18:158–168 17. Iakovleva TV, Makarova EN, Kazantseva A, Bazhan NM (2012) Effect of estradiol on food intake, glucose and fat metabolism in mice C57BL/6 J with mutation yellow at the agouti locus. Ross Fiziol Zh Im I M Sechenova 98:636–645 18. Hangalapura BN, Nieuwland MG, Buyse J, Kemp B, Parmentier HK (2004) Effect of duration of cold stress on plasma adrenal and thyroid hormone levels and immune responses in chicken lines divergently selected for antibody responses. Poult Sci 83: 1644–1649 19. Hirabayashi M, Ijiri D, Kamei Y, Tajima A, Kanai Y (2005) Transformation of skeletal muscle from fast- to slow-twitch
123
20.
21.
22.
23.
24.
25.
26. 27.
28.
29. 30.
31.
during acquisition of cold tolerance in the chick. Endocrinology 146:399–405 Chen XY, Jiang RS, Geng ZY (2011) Differential effects of two indigenous broilers exposed to cold stress and characters of follicle density and diameter. Ital J Anim Sci 10:38–41 Chen XY, Jiang RS, Geng ZY (2012) Cold stress in broiler: global gene expression analysis suggest a major role of CYP genes in cold responses. Mol Biol Rep 39:425–429 Leandro NS, Gonzales E, Ferro JA, Ferro MI, Givisiez PE, Macari M (2004) Expression of heat shock protein in broiler embryo tissues after acute cold or heat stress. Mol Reprod Dev 67: 172–177 Shinder D, Luger D, Rusal M, Rzepakovsky V, Bresler V, Yahav S (2002) Early age cold conditioning in broiler chickens (Gallus domesticus): thermotolerance and growth responses. J Therm Biol 27:517–523 Ipek A, Sahan U (2006) Effects of cold stress on broiler performance and ascites susceptibility. Asian Aust J Anim Sci 19: 734–738 Ma S, Mifflin SW, Cunningham JT, Morilak DA (2008) Chronic intermittent hypoxia sensitizes acute hypothalamic-pituitaryadrenal stress reactivity and Fos induction in the rat locus coeruleus in response to subsequent immobilization stress. Neuroscience 154:1639–1647 Matteri RL, Carroll JA, Dyer CJ (2000) Neuroendocrine responses to stress. Biol Anim Stress 3:43–74 Paca´k K, Palkovits M (2001) Stressor specificity of central neuroendocrine responses: implications for stress-related disorders. Endocr Rev 22:502–548 Roses AD (2009) Stimulation of cholecystokinin-A receptors with Gl181771X: a failed clinical trial that did not test the pharmacogenetic hypothesis for reduction of food intake. Clin Pharmacol Ther 85:362–365 Chandra R, Liddle RA (2007) Cholecystokinin. Curr Opin Endocrinol Diabetes Obes Metab 14:63–67 Kuo LE, Kitlinska JB, Tilan JU, Li L, Baker SB, Johnson MD, Lee EW, Burnett MS, Fricke ST, Kvetnansky R, Herzog H, Zukowska Z (2007) Neuropeptide Y acts directly in the periphery on fat tissue and mediates stress-induced obesity and metabolic syndrome. Nat Med 13:803–811 Palou M, Sa´nchez J, Rodrı´guez AM, Priego T, Pico´ C, Palou A (2009) Induction of NPY/AgRP orexigenic peptide expression in rat hypothalamus is an early event in fasting: relationship with circulating leptin, insulin and glucose. Cell Physiol Biochem 23:115–124
Identification of differentially expressed genes in hypothalamus of chicken during cold stress X. Y. Chen • R. Li • M. Wang • Z. Y. Geng
Received: 6 February 2013 / Accepted: 4 January 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract In order to discover the mechanism of cold stress and identify differentially expressed genes in hypothalamus during cold stress, 4 weeks of age Huainan partridge chickens, Chinese indigenous breed, were chosen for 24 h cold stress and then hypothalamus were isolated and labeled by reverse transcription reaction for cDNA. Labeled cDNA were hybridized with cDNA microarray. After scanning and image processing, the different gene expression profiling of hypothalamus and normal control was investigated. The differentially expressed genes included 334 down-regulated genes and 543 up-regulated genes. In these differentially regulated genes, myosin heavy chain polypeptide 11 (MYH11), light chain polypeptide 9 (MYL9) and tenascin-Y (TNXB), etc., which involved in muscle activity were significantly down-regulated. Genes like cholecystokinin (CCK), neuropeptide Y (NPY), neuropeptide Y receptor 5 (NPY5R), hypocretin receptor 2 (HCRTR2) and hypocretin neuropeptide precursor (HCRT) which responsible for regulation of feeding behavior were significantly up-regulated. In addition, genes responsible for lipid synthesis, like apolipoprotein (APOB) and agouti related protein homolog (AGRP), were also up-regulated. Through pathway analysis using the Kyoto Encyclopedia of Gene and Genomics, during 24 h cold stress, the neuroactive ligand-receptor interaction was firstly initiated in chickens for stimulation of central nervus for feed intake.
Electronic supplementary material The online version of this article (doi:10.1007/s11033-014-3075-z) contains supplementary material, which is available to authorized users. X. Y. Chen R. Li M. Wang Z. Y. Geng (&) College of Animal Science and Technology, Anhui Agricultural University, No. 130, Changjiang West Road, Hefei 230036, China e-mail: [email protected]
Adipocytokine signaling pathway was in high activation for supplementation of body energy. Jak-STAT, Ca2? signaling pathway and other biological reactions were also initiated in response to cold stress. The biological pathways participated in cold stress would provide important information for clarify the mechanism of cold stress and the differentially expressed genes would give much help for screening of candidate genes in breeding of cold stress resistant lines. Keywords Huainan partridge chicken Cold stress Hypothalamus Gene expression
Introduction Chickens are highly sensitive to environmental temperatures which should be controlled within an appropriate range for optimal performance [1]. A standard rearing practice is to maintain the environmental temperature at which neonatal chickens are reared at about 32 °C for about 1 week and then to decrease it gradually. Chickens would gradually leave the external heating after 4 weeks. During this period, sudden decrease of environmental temperature would cause body and/or uniformity not meets the standards, and consequently affecting the production performances [2]. It is widely accepted that chickens exposed to chronic or acute cold stress will cause variable modulatory effects on neuroendocrine system [3–5], antioxidant system [6], immune system [7–9], etc. Cold stress has been one of the major factors restricting poultry development [10]. In 2002, according to incomplete statistics, snowstorm has affected 23,221,900 livestock and 38.14 million dead, a large number of dams aborted or
123
Mol Biol Rep
stillbirth in eastern Inner Mongolia (Taken from the 2002 government work report of the Inner Mongolia Autonomous Region). Low temperature accompany with snowing has caused serious economic losses in the north of China. In 2008, continued snow disasters caused significant economic losses in poultry in South of China. According to statistics, 19.55 million poultry died, 7 million square meters poultry house collapsed, with a direct economic loss of 100 million in currency. Therefore, genetic improvement in cold and disease resistant chicken line through artificial selection program would be the most effective for reducing economic losses caused by cold stress [11]. Researches on the mechanisms of cold stress, neuro-endocrine variation and related gene expression would be much helpful for selection of indicators for chicken cold stress evaluation. In this experiment, differentially expressed genes in hypothalamus in pre- and 24 h post-cold stressed Huainan partridge chickens, a Chinese indigenous breed, was systematically identified by Agilent chick genome array. We expected that study of these differentially expressed genes may increase our understanding of cold stress mechanism and may allow the development of innovative strategies for breeding of anti-stress breeds.
Materials and methods Birds The quality broilers used was an indigenous Chinese breed, the Huainan partridge chicken. A total of 300 physically healthy males at 4 week of age, obtained from Feixi the Old Hens Farming Co., Ltd., were randomly divided into six groups of 50 birds. Three groups were assigned to the control group while the other three were assigned to 24 h cold stress treatment. The six groups were bred individually with nipple drinkers, and rice husk was used as floor bedding. Water and an unmedicated corn-soy-based diet that met the NRC requirements [12] were provided ad libitum. Chickens were housed at a constant temperature of 24–26 °C with artificial temperature control system before experiment. During cold stress, temperature from three pens were rapidly decreased to 2 ± 2 °C within 1 h through air conditioner whereas the chickens in the other three pens were kept continuously in a normal thermal environment [normal temperature (NT): 24–26 °C], which served as the control treatment. After 24 h cold exposure, 10 chickens from each group were euthanized immediately by exsanguinations after electrical stunning via electrodes on both sides of the head to obtain hypothalamus samples [13]. Samples were rapidly removed aseptically and stored in the RNAlater (Sangon Biotech, China) till for RNA extraction. All experimental protocols were approved by
123
the committee for the Care and Use of Experimental Animal at Anhui Agricultural University. Extraction of total RNA and purification of mRNA Total RNA was prepared by the Trizol reagent method (Invitrogen Corporation, Carlsbad, CA, USA) according to the instructions of the manufacturer. After RNA extraction, ten samples from each group were first equivalently mixed to form six mixed samples, three mixed samples of control and three of 24 h cold treatment. The three mixed samples then equivalently mixed again to form two pools, control pool and 24 h cold treatment pool. The mRNA was purified from the pools of total RNA using RNeasy Kit (QIAGEN, German) according to the producer’s protocol. The RNA quantity and quality were determined by 2100 Bioanalyzer (Agilent, American) and Biophotometer (Eppendorf, German) and then stored at -70 °C until analysis. Any RNA samples that showed degradation was excluded from the study. Labeling and hybridization One microgram of total RNA was used for generation Cy3labeled (GE healthcare, England) complementary RNA (cRNA). The labeling reaction was performed according to the manufacturer’s protocol. The samples were hybridized to the Chicken Genome-G2519F Genechip (Agilent, American), stained, washed and scanned according to the standard Agilent protocol. The computer data files to be used in data analysis were generated with SBC analysis system (SAS) Version 2.0, using the statistical algorithm provided. All chip samples were scanned according to the manufacturer’s protocol. Data quality assessment was then performed following the guidance in Agilent data analysis fundamentals manual. All quality control results met Agilent recommended criteria. Data process and analysis For comparison of differential gene expression in pre- and 24 h post-cold stressed chickens, the signal intensity of each probe was divided by that of negative control to filter the genes which were not expressed. The signal intensity of each gene was globally normalized using LOWESS within the R statistics package. Results from the difference analysis were clustered and displayed using R-software (The R-project for Statistical Computing, http:// www.r-project.org/). Each list of differentially expressed genes was analyzed using Kyoto Encyclopedia of Gene and Genomics (KEGG) database by using SAS. For each pathway, the probability values were computed based on
Mol Biol Rep Table 1 Primer sequences and real time quantitative results of 8 genes
Gene name
GeneBank no.
Primer
Relative expression level 0h
DRD3
XM_003640452.1
tgcaggagggtctctctcat
24 h
2.14
8.35
1.05
3.40
2.01
11.23
4.52
20.30
7.23
2.01
tatgcctccctctgaaaacg attaccactctggcccactg
1.89
0.64
tggatgtttggcactgtcat
2.56
6.08
1.37
5.61
1
1
tcaccatgaaggggaggtag GH1
NM_204359.1
ggaggaccagaggtacacca tcccttcttccaggtccttt
CCK
NM_001001741
aggttccactgggaggttct cgcctgctgttctttaggag
POMC
NM_001031098.1
aaggcgaggaggaaaagaag ccttcttgtaggcgcttttg
MYH11
NM_205274.1
gcagctgaccaaactgatga gacggaattcctggaagaca
CHRNA9
NM_204760.1
NPY5R
NM_001031130.1
gccatgttttgccgttaagt TSHB
AF033495.1
GAPDH
JQ280469.1
ctctttggcctgacttttgg tgtgcacacgttttgagaca aaagtccaagtggtggccatc tttcccgttctcagccttgac
R-package Fisher’s exact test. P value \0.05 was considered significant categories. To assess the false discovery rate (FDR) (q-values) of the differentially expressed gene result, a control expression sets were calculated by significance analysis of microarrays according to Tusher’s method [14].
tissues. Relative expression level of each gene in one tissue (DCt) was calculated by Ct target gene—Ct GAPDH; relative expression of each gene in two different tissues (DDCt) was calculated by DCtA - DCtB.
Results Microarray testing by quantitative RT-PCR (qRT-PCR) Differentially expressed genes were selected from results of microarray. 1 lg of total RNA was reverse transcripted using random hexamers and superscript-II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). The primers were designed with Primer 5. Gene symbols and primers are listed in Table 1. QRT-PCR was performed by using Rotor-gene 6000 (Corbett, Australia) and SYBR Green Detection (Takara, Japan).The PCR reactions were performed in a 10 ll volume containing a 19SYBR Green Master Mix, 50 ng cDNA, 300 nM of forward primers, 300 nM of reverse primers. The amplification condition was 50 °C for 2 min; 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 59 °C for 1 min; a final soak at 4 °C was also incorporated. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. All of the samples were measured in duplicate. Two measurements of each tissue sample were averaged for further analysis. The comparative Ct method was used to calculate the relative gene expression level across the
Differentially expressed genes in hypothalamus in preand 24 h post-cold stress Identifying differential expression genes was achieved by using SAS with a FDR of 0.5 %. Comparative analysis revealed that 877 genes were differentially expressed in 24 h post-cold stress compared to pre-cold stress in hypothalamus, from which 543 genes were up-regulated and 334 genes down-regulated (additional file 1). Gene function enrichment was analyzed according to the group of genes that share common biological function, chromosomal location, or regulation. The tendency of these expressed genes in the signaling pathway was analyzed according to the p value, that is, the smaller the p value, the more significant correlation to cold stress. Together with the differentially expressed (DE) genes involved within the threshold (p \ 0.05), the most significant biological process categories are neuroactive ligand-receptor interaction, adipocytokine signaling pathway and cytokine–cytokine receptor interaction (Table 1, additional file 2).
123
Mol Biol Rep Table 2 KEGG biological pathways for differentially expressed genes in 24 h post cold stress KEGG pathway name
Genes involved
p Value
Neuroactive ligand-receptor interaction (NLI)
28
0.0
Adipocytokine signaling pathway (ASP)
3
0.008
Cytokine-cytokine receptor interaction (CRI)
5
0.009
Jak-STAT signaling pathway (JSP)
4
0.011
Pathways identification by overabundant genes
Butanoate metabolism (BM)
2
0.017
Calcium signaling pathway (CSP)
4
0.022
Melanogenesis (MG)
3
0.026
Lysine degradation (LD)
2
0.028
Tryptophan metabolism (TM)
2
0.028
Vascular smooth muscle contraction (VSMC)
3
0.036
Tight junction (TJ)
3
0.05
Additional file 1 877 differentially expressed genes in hypothalamus of Huainan partridge chicken exposed to 24 h cold stress relative to control group. Agilent Probe Set ID, Fold change, Regulation, Gene Symbol, GO Biological Process, GO Molecular Function, GO Cellular Component, Ensembl ID and Chromosome Number are listed in the table. Additional file 2 Differentially expressed genes play key roles in Huainan partridge chicken exposed to 24 h cold stress
Notably, in the up-regulated genes, most genes have been reported to be involved in feed intake adjustment, such as cholecystokinin (CCK), neuropeptide Y (NPY), neuropeptide Y receptor 5 (NPY5R), hypocretin receptor 2 (HCRTR2) and hypocretin neuropeptide precursor (HCRT) that gives rise to two mature neuropeptides, and orexin A and orexin B which bind to orphan G-protein coupled receptors HCRTR1 and HCRTR2, function in the regulation of feeding behavior, metabolism and homeostasis [15]. Since CCK, NPY, NPY5R, HCRTR2 and HCRT are known to be involved in feed intake, it can be of interest to further investigate their potential role during cold stress in detail. Another group of genes known to encode enzymes for glutamate metabolism and neuro-signal transducing peptide appeared to be significantly down regulated, such as phosphomannomutase 2 (PMM2), cholinergic receptor (CHRNA9), etc. Myosin heavy chain polypeptide 11 (MYH11), light chain polypeptide 9 (MYL9) and tenascin-Y (TNXB) were also down regulated for more than three times below. The up regulation of glucagons receptor, apolipoprotein (APOB), proopiomelanocortin (POMC) and agouti related protein homolog (AGRP), and the down regulation of alpha-1-antitrypsin and phospholipids-transporting ATPase suggested lipid synthesis is more important for energy storage than lipid metabolism during 24 h cold stress [16, 17]. Considering all of those significantly changed genes, neuropeptide gamma (TAC1), Gamma-aminobutyric-acid receptor alpha-5 receptor precursor (GABA(a) receptor), thyrotropin
123
releasing hormone (TRH), HCRTR2 were all 10 times more changed after 24 h cold stress.
A pathway analysis database, KEGG, was then applied to genes differentially regulated after 24 h cold stress. Several overrepresented pathways were identified (Table 2), and the enriched pathways appeared not to be independent of one another, many genes involved in one pathway could be also involved in another pathway. As demonstrated, neuroactive and adipocytokine-related pathways were significantly over-represented in post 24 h cold stress. These findings, on the one hand, provide evidence supporting previous experiments [18] that neural signaling transduction play important roles during cold stress. On the other hand, it further demonstrated that particular components of neural and adipocytokine systems can be crucial for the process of cold stress. Validation of gene transcription by real-time PCR Quantitative real-time PCR is still the gold standard for quantitative analysis of mRNA. In order to validate the microarray results, qRT-PCR was carried out on the same set of samples that were analyzed by the microarray approach. A total of eight genes were selected for these verifications. These genes included induced and repressed genes that were significantly expressed and representative in each metabolic pathway. For the genes down regulated in microarray results, genes tested by qRT-PCR were also significantly down-regulated and genes up regulated in microarray were also significantly up-regulated. Representative qRT-PCR results of eight genes are shown in Table 1.
Discussion In this research, Huainan partridge chicken, a Chinese indigenous breed which was included in Convention on Biological Diversity (CBD) as one of the sustainable breed for use, in 4 weeks of age was used in this experiment. Local breeds in Chinese and other countries usually reared under natural environment after 3–weeks of age by captive or thick pad without any additional thermal providing. The sudden environmental change (like La Nina phenomenon) would cause high negative effect on growth and other aspects. Thus, it is highly urgent to explore the underground mechanisms of cold stress which might provide useful methods for selection of anti-stress lines from indigenous breeds.
Mol Biol Rep
In this study, we first examined the gene expression profiles of chicken hypothalamus when exposed to cold stress. Data analysis identified 877 genes that might be significantly correlated with cold stress, out of which 41 genes were functional annotated in KEGG pathway. The list of differentially expressed genes contains many genes which might be important for stress resistance. Most of these genes have not been reported to be related to stress before. For example, MYH11 and MYL9, which encode myosin of smooth muscle has been shown to be significantly down regulated. During cold stress, chicken always curled up with little movement [19], this might because of the down regulation of the two mentioned genes. Cold stress induces physiological responses which are of high priority and energy demanding in homeotherms [20– 22]. Cold stress elevated basal metabolic rate and increased energy metabolism with significant health and welfare down regulation as stressors are believed to affect health and welfare of animals [23, 24]. It is always considered that cold stress alter the function of hypothalamic-pituitary axis resulting in changes in the systemic levels of adrenal and thyroid hormones levels [3, 5, 18, 25, 26]. From the microarray results, TRHR was 7 times up-regulated, TRH was significantly 28 times up-regulated and TSHb was 4 times up-regulated. Furthermore, neuropeptide Y was also 4 times up-regulated. The up-regulation of these genes suggested that neuropeptide and related hormones coparticipated in the stress response. It is suggested that neuroendocrine will rapidly elevated within seconds or minutes during cold stress [26], however, a 24 h sustained high expression level of genes encoding neuroendocrine was observed in this experiment. When animals are exposed to extreme cold stress, a number of biological processes are initiated to maintain body homeostasis [27]. During extreme cold, the outside temperature falls rapidly and substantial amount of dietary energy may be diverted from productive functions to the generation of body heat, thus feed intake will increase to compensate for heat loss. In addition, genes related to promote appetite, such as CCK [28, 29], NPY [30], NPY5, were all substantially up-regulated which might responsible for the stimulation of feed intake to maintain body temperature [31]. After 24 h cold stress, genes related to adipocytokine signaling pathway were significantly activated for thermal production. It is well preferred that lipid metabolism for energy requirement be the first event during cold stress. However, which might be more important during cold stress, lipid synthesis or lipid metabolism? When considering the activated genes after 24 h cold stress, AGRP 7 times up-regulated, POMC 12 times upregulated, and the up regulation of glucagons receptor, APOB, and down regulation of alpha-1-antitrypsin and phospholipids-transporting ATPase, which all suggested
that lipid synthesis for energy storage might be the first response against the cold stress for animals. Conclusions The broiler industry in China is primarily driven by the production of quality chicken. The breeding of these kind of chickens usually need open separating without external heating during winter. Therefore, one of the challenges the producer must overcome in the pursuit of this goal is potential cold stress that the broiler may experience. The present breeds of chickens which have undergone intensive selection for higher production may have lost their ability to cope with cold stress. Therefore, there is need to understand how cold affect health status of chickens and which measure should be first taken. We first examined the gene expression profiles of broiler exposed to cold stress for 24 h. Analysis of those DE genes suggested that many biological pathways participated in cold stress which might provide important information for the clarification of the mechanism of cold stress. Genes responsible for muscle contraction and lipid synthesis would give insight that enzymes for lipid synthesis could be considered for broiler production during a relatively low temperature. The significantly expressed DE genes might be considered as candidate genes for cold stress and more attention should be given for the polymorphisms of those DE genes which might be as marker assisted sites for cold-resistant species breeding. Acknowledgments This work was financially supported by grant from The National Natural Science Foundation for Young Scholars of China (Grant No. 31101710).
References 1. Shinder D, Rusal M, Tanny J, Druyan S, Yahav S (2007) Thermoregulatory responses of chicks (Gallus domesticus) to low ambient temperatures at an early age. Poult Sci 86:2200–2209 2. Yahav S (2000) Domestic fowl—strategies to confront environmental conditions. Avian Poult Biol Rev 11:81–95 3. Noh SJ, Kang DW, Yoo SB, Lee JY, Kim JY, Kim BT, Lee JH, Jahng JW (2012) Stress-responsive hypothalamic-nucleus accumbens regulation may vary depending on stressors. Indian J Exp Biol 50:447–454 4. Chen XY, Jiang RS, Geng ZY (2011) Neuroendocrine responses to cold stress in Chinese indigenous breeds from different latitude. J Anim Vet Adv 10:3043–3047 5. Wang JT, Xu SW (2007) Effects of cold stress on hypothalamic corticotrophin-releasing and thyrotropin-releasing hormone messenger RNA levels in chickens. J Northeast Agric Univ 14:327–332 6. Selman C, Mclaren JS, Himanka MJ, Speakman JR (2000) Effect of long-term cold exposure on antioxidant enzyme activities in a small mammal. Free Rad Biol Med 28:1279–1285
123
Mol Biol Rep 7. Hangalapura BN (2006) Cold stress and immunity: do chickens adapt to cold by trading-off immunity for thermoregulation?. Wageningen University, Wageningen 8. Hangalapura BN, Nieuwland MG, de Vries Reilingh G, Heetkamp MJ, van den Brand H, Kemp B, Parmentier HK (2003) Effects of cold stress on immune responses and body weight of chicken lines divergently selected for antibody responses to sheep red blood cells. Poult Sci 82:1692–1700 9. Hangalapura BN, Nieuwland MG, de Vries Reilingh G, van den Brand H, Kemp B, Parmentier HK (2004) Durations of cold stress modulates overall immunity of chicken lines divergently selected for antibody responses. Poult Sci 83:765–775 10. Blahova´ J, Dobsˇ´ıkova´ R, Strakova´ E, Suchy´ P (2007) Effect of low environmental temperature on performance and blood system in broiler chickens (Gallus domesticus). Acta Vet Brno 76:S17– S23 11. Sonna LA, Fujita J, Gaffin SL, Lilly CM (2002) Effects of heat and cold stress on mammalian gene expression. J Appl Physiol 92:1725–1742 12. National Research Council (1994) Nutrient requirements of poultry, 9th edn. The National Academies Press, Washington DC 13. Department of Agriculture, Plant and Animal Health Inspection Service (2004) Blood and tissue collection at slaughtering and rendering establishments, final rule. 9CFR part 71, Federal Register 69, 10137-10151 14. Tusher V, Tibshirani R, Chu G (2001) Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA 98:5116–5121 15. Ahmed WA, Tsutsumi M, Nakata S, Mori T, Nishimura Y, Fjisawa T, Kato I, Nakashima M, Kurahashi H, Suzuki K (2012) A functional variation in the hypocretin neuropeptide precursor gene may be associated with obstructive sleep apnea syndrome in Japan. Laryngoscope 122:925–929 16. Valassi E, Scacchi M, Cavagnini F (2008) Neuroendocrine control of food intake. Nutr Metab Cardiovasc Dis 18:158–168 17. Iakovleva TV, Makarova EN, Kazantseva A, Bazhan NM (2012) Effect of estradiol on food intake, glucose and fat metabolism in mice C57BL/6 J with mutation yellow at the agouti locus. Ross Fiziol Zh Im I M Sechenova 98:636–645 18. Hangalapura BN, Nieuwland MG, Buyse J, Kemp B, Parmentier HK (2004) Effect of duration of cold stress on plasma adrenal and thyroid hormone levels and immune responses in chicken lines divergently selected for antibody responses. Poult Sci 83: 1644–1649 19. Hirabayashi M, Ijiri D, Kamei Y, Tajima A, Kanai Y (2005) Transformation of skeletal muscle from fast- to slow-twitch
123
20.
21.
22.
23.
24.
25.
26. 27.
28.
29. 30.
31.
during acquisition of cold tolerance in the chick. Endocrinology 146:399–405 Chen XY, Jiang RS, Geng ZY (2011) Differential effects of two indigenous broilers exposed to cold stress and characters of follicle density and diameter. Ital J Anim Sci 10:38–41 Chen XY, Jiang RS, Geng ZY (2012) Cold stress in broiler: global gene expression analysis suggest a major role of CYP genes in cold responses. Mol Biol Rep 39:425–429 Leandro NS, Gonzales E, Ferro JA, Ferro MI, Givisiez PE, Macari M (2004) Expression of heat shock protein in broiler embryo tissues after acute cold or heat stress. Mol Reprod Dev 67: 172–177 Shinder D, Luger D, Rusal M, Rzepakovsky V, Bresler V, Yahav S (2002) Early age cold conditioning in broiler chickens (Gallus domesticus): thermotolerance and growth responses. J Therm Biol 27:517–523 Ipek A, Sahan U (2006) Effects of cold stress on broiler performance and ascites susceptibility. Asian Aust J Anim Sci 19: 734–738 Ma S, Mifflin SW, Cunningham JT, Morilak DA (2008) Chronic intermittent hypoxia sensitizes acute hypothalamic-pituitaryadrenal stress reactivity and Fos induction in the rat locus coeruleus in response to subsequent immobilization stress. Neuroscience 154:1639–1647 Matteri RL, Carroll JA, Dyer CJ (2000) Neuroendocrine responses to stress. Biol Anim Stress 3:43–74 Paca´k K, Palkovits M (2001) Stressor specificity of central neuroendocrine responses: implications for stress-related disorders. Endocr Rev 22:502–548 Roses AD (2009) Stimulation of cholecystokinin-A receptors with Gl181771X: a failed clinical trial that did not test the pharmacogenetic hypothesis for reduction of food intake. Clin Pharmacol Ther 85:362–365 Chandra R, Liddle RA (2007) Cholecystokinin. Curr Opin Endocrinol Diabetes Obes Metab 14:63–67 Kuo LE, Kitlinska JB, Tilan JU, Li L, Baker SB, Johnson MD, Lee EW, Burnett MS, Fricke ST, Kvetnansky R, Herzog H, Zukowska Z (2007) Neuropeptide Y acts directly in the periphery on fat tissue and mediates stress-induced obesity and metabolic syndrome. Nat Med 13:803–811 Palou M, Sa´nchez J, Rodrı´guez AM, Priego T, Pico´ C, Palou A (2009) Induction of NPY/AgRP orexigenic peptide expression in rat hypothalamus is an early event in fasting: relationship with circulating leptin, insulin and glucose. Cell Physiol Biochem 23:115–124
