.::) 1991 Oxford University Press

Nucleic Acids Research, Vol. 19, No. 13 3543-3547

Identification of nuclear factor 6EF1 and its binding site essential for lens-specific activity of the 61-crystallin enhancer Jun-ichi Funahashi, Yusuke Kamachi, Koji Goto+ and Hisato Kondoh* Department of Molecular Biology, School of Science, Nagoya University, Nagoya 464-01, Japan Received April 16, 1991; Revised and Accepted June 5, 1991

ABSTRACT The lens-specific reglatory element of the 61-crystallin enhancer lies within the core segment (Goto et al., (1990) Mol. Cell. Biol. 10, 935 - 964). The element was allocated within the 55 bp long HN fragment of the core. Block-wise base substitutions were introduced to the 55 bp and their effect on the enhancer activity of the multimers in lens cells was examined. By base sequence alteration of either of the contiguous blocks 5 and 6, with their original sequence of TTGCT and CACCT, respectively, enhancer activity was totally lost. A lens nuclear factor 6EF1 was found which bound specifically to the base sequences defined by the blocks. DNA binding activity very similar to bEF1 was also found in extracts of tissues other than lens, suggesting that 6EF1 participates in lens-specific regulation through tissue-dependent modification or interaction with other factors.

INTRODUCTION The first molecular indication of lens cell differentiaiton in chicken embryo is the onset of b-crystallin mRNA accumulation followed by synthesis of b-crystallin molecules (15, 17). 6crystallin expression stays lens-specific in later periods of the development. To elucidate the molecular cue of lens cell differentiation, we have analyzed lens-specific regulatory elements of the 61-crystallin gene (4, 5, 8) which codes for 6crystallin, identifying a lens-specific enhancer in the third intron of the gene as the major determinant of the tissue specificity (Fig. IA) (5, 9). The enhancer of the 61-crystallin gene is approximately 1 kb long, and its dissection into fragments demonstrated that it is composed of multiple regulatory elements (3). Individual elements have no activity as an enhancer but gain the activity either by heterologous combination or by homologous multimerization. The enhancer activity of the homo-multimers indicated that one of the elements represented by the 120 bp core fragment (Fig. IA) is strictly lens-specific, while other elements showed enhancer acitvity over a much wider spectrum of cell types. *

Therefore, if lens-specific regulation is mediated by sequencespecific DNA binding proteins, the binding sites must be located within the core sequence. Lens specificity is expected to be either in binding activity of one of the proteins, or in transcriptional activation by the bound proteins. To characterize interactions between the putative regulatory proteins and the core DNA sequence, we evaluated various segments of the enhancer core as to their requirement in the enhancer activity and in nuclear factor binding.

MATERIALS AND METHODS Cell culture, transfection and chloramphenicol acetyltransferase (CAT) assay Primary cultures of chicken tissues were prepared from 15-dayold chicken embryos as described by Hayashi et al. (5). A culture in a 3.5-cm dish was transfected with DNA-calcium phosphate coprecipitates containing 0.5 itg of ptkCAT derivative DNAs (Fig. IB), washed after 4 hrs and harvested after 24 hrs for CAT assay (5).

Oligomerization of synthetic polynucleotides Synthetic double-stranded DNAs (Fig. 2A) were ligated at the BamHIIBglII termini, digested with BamHI and BglII to select uni-directional multimers, selected for the teramers by electrophoresis in a 5% polyacrylamide gel, cloned at the BamHI site of pUC 19, and analyzed for nucleotide sequence. Octamers were then made by duplication of the tetrameric sequences, excised and inserted in ptkCAT at the BamHI site (Fig. 1B) as described by Goto et al. (3). Gel mobility shift assay Nuclear extracts were prepared from isolated tissues of 15-dayold chicken embryos by the method described by Dignam et al. (2). The monomer sequence probes labeled by filling-in of the BamHIIBglII termini with a-32P-dATP were incubated with 10 ,tg lens nuclear extract protein, 1 ,^tg of poly(dA-dT), 100 mM KCI, 1 mM dithiothreitol, 20 mM Hepes (pH 7.9), 15% glycerol, 2 mM MgCl2 and 10 ng sequence-specific competitors. Protein-

To whom correspondence should be addressed

+ Present address: Division of Biology 156-29,

California Institute

of Technology, Pasadena, CA 91125, USA

3544 Nucleic Acids Research, Vol. 19, No. 13 DNA complexes were resolved by electrophoresis in 6% polyacrylamide gel, 22 mM Tris-borate and 0.5 mM EDTA, dried and exposed on an X-ray film.

RESULTS Lens-specific activity in the 3' half of the core region Synthetic DNAs BH, DC2 and HN corresponding to the 5' half, middle and 3' half portions, respectively, of the core were prepared (Fig. IA), and the multimers were placed at the BamHI site downstream of the tkCAT reporter gene (Fig. IB) (3, 5) and assessed for enhancer activity by transfecting primary-cultured chicken embryo tissues: lens epithelium, lung, brain, liver, and dermal fibroblasts. Among the fragment multimers tested, only the HN fragment spanning the 55 bp 3' half of the core showed the activity which was lens-specific (21 i 4 fold activation in 11 measurements of the 8-mer in both orientations in lens cells and no significant activation in any other cell types, see also Fig. 2B). Thus, the regulatory element responsible for the lens specificity must lie within the HN fragment.

Effect of block-wise base substitutions in the HN fragment on enhancer activity The HN fragment was divided into blocks numbered 3 to 10 and base substitutions were introduced block-wise into the fragment by chemical synthesis of DNA (Fig. 2A). The substituted base sequence generally had T - - G or C - - A transversions, but when this created a nucleotide sequence known to be a binding site of a nuclear factor, other types of substitutions were chosen. The base-substituted HN fragments were called HN mutants, from HN3 to HN1O, and tandem octamers inserted at the BamHI site of the tkCAT plasmid were assessed for the enhancer activity in comparison with the original HN fragment indicated by HNW. Both orientations of the HN octamers were examined. The result of a representative experiment is shown in Fig. 2B and the summary of the results of several experiments using lens epithelial cell culture in Fig. 2C. In all cases, enhancer activity of an octamerized sequence was independent of the orientation. In lens cells, any block-wise base substitutions resulted in appreciable reduction of the enhancer activity except for HN10. The severest effect was observed with HN5 and HN6. With these base substitutions, enhancer activity was totally lost. In the fibroblasts, tkCAT expression was not affected by association with the HN octamers except for a small augmentation with HN4 which might have been caused by incidental creation of an uncharacterized activator binding site. The results with the fibroblasts confirmed that the down-effect of HN5/HN6 in lens cells was not due to general interference of transcription but to the loss of the lens-specific enhancer activity. Thus, the ten base pairs U%8g8 spanning blocks 5 and 6 are good candidates for the nuclear factor binding site involved in lens-specific regulation. We synthesized subfragments of HN, DC5 and DC7 (Fig. 2A) containing the ten base pairs and tested for the enhancer activity of the octamers. No significant enhancer activity was detectable in any tissue (data not shown). This suggested that additional interactions with nuclear factors at sites other than blocks 5 and/or 6 are required to elicit the enhancer activity. Blocks 8, 3 or 4 may provide the site of the additional interaction. Perhaps the interaction at one of these blocks is sufficient to replenish that interaction at blocks 5/6, and hence the effect of base substitution of one of these blocks was only partial.

A lens nuclear factor 5EF1 which binds to blocks 5 to 6 We looked for protein factors in lens nuclear extract which bind specifically to the HN fragment sequence, especially to blocks 5 and/or 6. Nuclear extracts were prepared from 15 day chicken embryos, and DNA binding proteins in the extract were analyzed by gel mobility shift assay using a radio-labeled HN fragment probe. A very slowly migrating protein-DNA complex was found which was lost specifically by inclusion of the HN fragment sequence as competitor (Fig. 3A). This band was more clearly visible in the presence of poly(dA-dT) (100 ,ig/ml) as competitor of nonspecific protein binding than poly(dI-dC) of the same concentration, and was abolished by treatment with Proteinase K at 100 ng/ml for 5 min before loading on a gel (data not shown). The protein component in the complex was named bEFI (6-crystallin enhancer factor 1). Using the HN mutant sequences as competitor, the bEFI binding site was identified. Octameric HN6 sequence, at 25 fold molar excess (in terms of monomer equivalent) of the monomeric probe, failed to act as a competitor for the binding of bEFI to the HNW probe, and octameric HN5 showed a very reduced activity as a competitor. Other HN mutant sequences competed for bEFI binding as efficiently as HNW. Shorter DNA fragments DC5 and DC7, both encompassing blocks 5 and 6, also bound bEFI (see below). Therefore, bEFI binds to the DNA sequence covered by blocks 5 and 6. In a converse experiment in which monomeric probes had the base substitutions, we found that HN6 failed to bind bEF 1 and that HN5 bound bEFI more weakly than HNW (data not shown). The bEFI binding sequence must reside mostly within block 6 and extend to a few bases into block 5, considering the absence of bEFI binding of HN6 DNAs and residual binding of HN5 DNAs. Since the base substitutions in HN5 and HN6 were exactly those which abolished the enhancer activity of the multimers, A l kb

!

11

11111111 11111 I

/

f

B

H

BH

N

HN

DC2

B

Figure 1. (A) Localizaton of the (1-crystallin enhancer, enhancer core, and core fragments in the gene. The cl-crystallin gene structure is drawn as transcribed from left to right with exons boxed, according to Ohno et al. (13) and Nickerson et al. (12). Restriction sites: B, BamHI; H, Hinfl; N, NcoI. (B) ptkCAT plasmid (5) in which sequences to be tested for enhancer activity were inserted at the BamHI site indicated. The open box represents the tkCAT transcriptional unit with the direction shown by the arrow.

Nucleic Acids Research, Vol. 19, No. 13 3545

A

gat ctAGTCAGCCACTMGCACT"JTCT TGAAATATJTQATTGT TGTTGCTCACCTACCATggat c gat C-tCTMGCACTC T TT TCTGAM-AT TCAT TGT TGT TGCTCACG TACCAT g g a t ga tC l AGTCAGCCDACfTTTGTGAAATATTGATTGTTGTTGCTCACCTACCATggatc 4ATggatc gatctcAGIOTAGCCACTAAGCIqAATAT TCATITGTTGTTGCTCACCTACCA T TICT GTTGTTGGTCACCTAGCAT ggatc gatctAGTOCAGCCAGTGAGOACTTTT mElT gatctc +AGTCAGCCACTAAGCACTTT'TTCTGAAATATT GA1U[,_1-TIGCTCACC TACCATggatc gatc tAGTQAGGCACTMGCA'TTTTTCTGAAATATTCATTiTTCEAOCTACCATggatc gatc tAGTCAGCCACTMGCACTTTTTCTGAAATATTCATTGTTGTTGCTACCATggatc

HNW HN8 HN9 HN1 0 HN3 HN4 HN5 HN6 HN7

gato tAGTCAGCCACTAAGCACTTTTTCTGMATATTCATTGTTGTTGCTCACCOGflggatc gat ctAAATAT'TCATTGTTGTTGCTCACCTACOATggat c

DC5

gatctGTTGCTCACCTACCggatc

DC7

B a 40e 0

-

_

@

..

s,

I N R I N R I N R I N R I N R I N R I N R I N R I N RI I W 1 8 1 9 1 10 1 3 1 4 1 5 1 6 1 7 1

-

b 0*

0

'6'

-

*

S

0

lb * *@

m.

C

*. 00.

*

*@@@e

v ..*.o* *.* *.*,

-

S

e0

I N R I N R I N RI N RI 1 4 1 5 1 6 1 7 1

I N R I N R I N R I N R I 9 1 10 I 8

I W I

40

30

20

1 0~

rEI

T I

10

W_

I

I

N [R

N Fi

N H

N R

N R

W

8

9

10

3

Nb

N H

N H

N f

4

5

6

7

Figure 2. HN fragment mutant sequences and their enhancer activity as measured by expression of tkCAT. (A) Normal (HNW) and base-substituted (HN mutant) sequences of the HN fragment as well as HN subfragments DC5 and DC7. Only sense strand sequences are shown with substituted regions in boxes and with BamHIIBglH linker sequences used to multimerize the HN sequences in lower case letters. (B) A representative CAT assay showing enhancer activity of octameric HN fragments in lens epithelial cells (a) and fibrobalsts (b). Acetylated forms of chloramphenicol are indicated by arrowheads. The pairs of assays are shown with insertion of no (-), original (HNW) and mutant HN fragments indicated below the chromatogram. N and R lanes of each pair indicate the results of normal and reversed orientations, respectively, of the inserted enhancer fragments relative to the direction of CAT transcription. Note CAT activities with HN5 and HN6 fragments comparable to the level without enhancer. (C) Enhancer effect of HN sequence octamers in lens cells as presented by fold activation of tkCAT expression. Each histogram represents the average of the number of measurements in parentheses with the standard deviations indicated by the bars. N and R indicate the orientations of the octameric HN fragments, as in (B).

3546 Nucleic Acids Research, Vol. 19, No. 13 the extracts were first tested with the Oct- I /Oct-2 binding sequence ATGCAAAT [octamer motif (20)] (Fig. 3B). The binding activity of chicken Oct-1 (14) was observed in all extracts, and other binding proteins were noted in brain extracts which may be homologues of Brn-1, 2 and/or 3 reported for rat (6). With HNW or DC5 probes, a DNA-protein complex with a mobility indistinguishable from bEF1 was formed irrespective of the source of the extract (data for DC5 is shown in Fig. 3C). Formation of these complexes were abolished by the presence of unlabeled DC7 and HN sequences as competitor except for HN5 and HN6 (no competition with HN6 and reduced effect with HN5). Therefore, bEFl-like DNA binding activity was not restricted to lens tissues.

we examined by gel mobility shift assay the nuclear extract of cultured lens epithelium in which enhancer activity was assayed. We were able to confirm the presence of the same bEF 1 activity in cultured lens cells. Thus, we conclude that bEF1 binding is essential for the enhancer activity of the HN fragment multimers in lens cells.

Tissue distribution of the 6EF1 activity We inquired whether the bEF1 binding activity is lens specific in parallel with the enhancer activity of the HN fragment octamer. Nuclear extracts of brain and lung as well as lens were prepared from 15 day embryos and examined by gel mobility shift assay. To control the activity of DNA binding proteins in the extracts, A ...

_

K . c 'M

4

e

SWOkl.

T

nasa_ seat

6

t&.

:..

a WW

-

goo

#

-

LiS~~~~~~:-&ii

Wi

aWUI .t i~~~

i;e"4,.t4. w

O."

%#4

Y.,t, m

g, tI

1L.

i

'I 4

1:

Figure 3. Binding of bEFl to the HN sequence. (A) Gel mobility shift assay of lens nuclear extract using HNW monomer sequence as probe in the presence of sequence-specific competitors. 0, without extract; -, no HN sequence competitor; W and the numbers, the original and mutant HN sequences, respectively, in the octameric form as competitor. The position of the bEFI band is indicated by the arrowhead. (B) Comparison of nuclear extracts by gel mobility shift assay of no (0), lens (Le), brain (Br) and lung (Lu) extracts using Oct-l/Oct-2 binding site probe. The probe was 67 bp long containing ATGCAAAT flanked by pUCl9 polylinker sequences. Putative Oct-I band is indicated by the arrowhead. (C) Gel mobility shift of the DC5 probe with the same nuclear extract as in (B). Effect of competitors, HNW otamer (W), HN mutant octamers (4 to 7) were compared with no competitor (-). The position of the bEF I band is indicated by the arrowhead.

Nucleic Acids Research, Vol. 19, No. 13 3547

DISCUSSION We have shown that the 55 bp long HN fragment of the 61-crystallin enhancer bears a strictly lens-specific activity which is exhibited in the form of multimers. Thus, a genetic element regulating tissue specificity must be located within the HN fragment. To identify the lens-specific regulatory element, we examined the effect of block-wise base substitutions on the enhancer activity of the HN fragment. It was found that the enhancer activity in lens cells was totally dependent on the integrity of the base sequence of blocks 5 and 6. The simplest model to account for the observations is that the regulatory element defined by these blocks provides the site of interaction with a nuclear factor and that either tissue distribution or activity to regulate transcription of the factor is lens specific, although other models are equally possible. A protein factor bEF1 was in fact discovered in lens nuclear extract which binds specifically to the base sequence in blocks 5 and 6. The bEF 1 binding site must be mostly within block 6, as indicated by the residual bining activity of HN5 sequence. The complex of bEF1 with DNA probes migrated extremely slowly in polyacrylamide gel, suggesting that bEF1 has a large molecular mass. Although bEFl binding site was defined as an element essential for HN fragment activity, the binding of bEF 1 by itself is not sufficient for eliciting enhancer activity. First, subfragments of HN containing the bEFl binding site showed no enhancer activity, indicating requirement of additional interactions. Second, DNA binding proteins indistinguishable from bEFI by gel mobility shift assay were also found in extracts of non-lens tissues where the HN fragment has no activity. To reconcile the wide distribution of bEF 1-like DNA binding proteins with the absolute requirement of bEF1 binding for the lens-specific enhancer activity of HN fragment multimers, we postulate a few specific models. In the first model, bEFI is ubiquitous, but it is modified or unmasked for transcriptional activator only in lens cells. Transcriptional activation-correlated phosphorylation without affecting DNA binding has been reported for the yeast heat shock transcription factor (18) and for Oct-2 protein (19). Cell type-specific inhibitor is indicated for c-Jun (1). In the second model, additional nuclear factors which cooperate with bEF1 determines the lens specificity. Such factors may interact with HN fragment at places other than blocks 5 or 6, as suggested by lack of enhancer activity in DC5/DC7 multimers. Alternatively, such factors may interact directly with bEF1. It should be noted that the octamer sequence-containing promoters of immunoglobulin genes provide an analogous case. In addition to octamer-binding proteins Oct-1/Oct2, a component detectable only in lymphoid lineage is required for activation of the promoters, and this component is considered to account for the tissue-specific expression of the immunoglobulin genes (7,

16). There are other crystallin classes which begin to be expressed in stages later than b-crystallin in lens development. Regulatory elements apparently involved in lens-specific regulation have been characterized for a- and -y-crystallin genes (10,1 1). There is no sequence similarity found between bEF1 binding site and the regulatory elements of a-by-crystallin genes. In addition, the nuclear factors which bind to a/fl elements appear quite different from bEFI in electrophoretic mobility. It is likely that expression of crystallin genes under different temporal control is governed by distinct nuclear factors in the same tissue.

It remains to be shown how bEF1 is involved in lens-specific regulation and to what extent the mechanism of lens-specific regulation is diversified/unified among different crystallin classes. In order to answer these questions, it is essential to characterize the molecular nature of bEF1. The most straightforward approach is molecular cloning of the cDNA of bEF1, which is underway.

ACKNOWLEDGEMENTS K.Goto was the recipient of a Fellowship from the Japan Society for the Promotion of Science for Japan Junior Scientists. This work was supported by grants from the Ministry of Education, Science and Culture of Japan to H.K. and to K.G., and from the Science and Technology Agency of Japan to H.K.

REFERENCES 1. Baichwal, V.R. and Tjian, R. (1990) Cell, 63, 815-825. 2. Dignam, J.D., Lebovitz, R.M. and Roeder, R.G. (1983) Nucleic Acids Res., 11, 1475-1489. 3. Goto, K., Okada, T.S. and Kondoh, H. (1990) Mol. Cell. Biol., 10, 958-964. 4. Hayashi, S., Kondoh, H., Yasuda, K., Soma, G., Ikawa, Y. and Okada, T.S. (1985) EMBO J., 4, 2201-2207. 5. Hayashi, S., Goto, K., Okada, T.S. and Kondoh, H. (1987) Genes Dev., 1, 818-828. 6. He, X., M.N. Treacy, M.N., Simmons, D.M., Ingraham, H.A., Swanson, L.M. and Rosenfeld, R.G. (1989) Nature, 340, 35-42. 7. Johnson, D.G., Carayannopoulos, L., Capra, J.D., Tucker, P.W. and Hanke, J. (1990) Mol. Cell. Biol., 10, 982-990. 8. Kondoh, H., Yasuda, K. and Okada, T.S. (1983) Nature, 301, 440-442. 9. Kondoh, H., Ueda, Y., Araki, I., Hayashi, S., and Goto, K. (1988) UCLA Symp. New Ser., 88, 189-196. 10. Liu, Q., Tini, M., Tsui, L. and Breitman, M. (1991) Mol. Cell. Biol., 11, 1531-1537. 11. Nakamura, T., Donovan, D., Hamada, K., Sax, C.M., Norman, B., Flanagan, J.R., Ozato, K., Westphal, H. and Piatigorsky, J. (1990) Mol. Cell. Biol., 10, 3700-3708. 12. Nickerson, J.M., Wawrousek, E.F., Hawkins, J.W., Wakil, A.S., Wistow, G.J., Thomas, G., Norman, B.N. and Piatigorsky, J. (1985) J. Biol. Chem., 260, 9100-9105. 13. Ohno, M., Sakamoto, H., Yasuda, K., Okada, T.S. and Shimura, Y. (1985) Nucleic Acids Res., 13, 1593- 1606. 14. Petryniak, B., Staudt, L.M., Postema, C.E., McCormack, W.T. and Thompson, C.B. (1990) Proc. Natl. Acad. Sci. USA, 87, 1099-1103. 15. Piatigorsky, J. (1981) Differentiation, 19, 134-153. 16. Pierani, A., Heguy, A., Fujii, H. and Roeder, R.G. (1990) Mol. Cell. Biol., 10, 6204-6212. 17. Shinohara, T. and Piatigorsky, J. (1976) Proc. NatI. Acad. Sci. USA, 373, 2808-2812. 18. Sorger, P.K. and Pelham, H.R.B. (1988) Cell, 54, 855-864. 19. Tanaka, M. and Herr, W. (1990) Cell, 60, 375-386. 20. Wirth, T., Staudt L. and Baltimore, D. (1987) Nature, 329, 174-178.