EBP are essential for the activity of the human apolipoprotein B gene second-intron enhancer.

Vol. 12, No. 3

MOLECULAR AND CELLULAR BIOLOGY, Mar. 1992, p. 1134-1148

0270-7306/92/031134-15$02.00/0 Copyright © 1992, American Society for Microbiology

Hepatocyte Nuclear Factor 1 and C/EBP Are Essential for the Activity of the Human Apolipoprotein B Gene Second-Intron Enhancer ALAN R. BROOKS"12

AND

BEATRIZ LEVY-WILSON2*

Gladstone Institute of Cardiovascular Disease, Cardiovascular Research Institute, 1 and Department of Pharmaceutical Chemistry, University of Califomnia, San Francisco, San Francisco, California 94141_91002 Received 23 July 1991/Accepted 23 December 1991

The tissue-specific transcriptional enhancer of the human apolipoprotein B gene contains multiple proteinbinding sites spanning 718 bp. Most of the enhancer activity is found in a 443-bp fragment (+621 to +1064) that is located entirely within the second intron of the gene. Within this fragment, a 147-bp region (+806 to +952) containing a single 97-bp DNase I footprint exhibits significant enhancer activity. We now report that this footprint contains four distinct protein-binding sites that have the potential to bind nine distinct liver nuclear proteins. One of these proteins was identified as hepatocyte nuclear factor 1 (HNF-1), which binds with relatively low affinity to the 5' half of a 20-bp palindrome located at the 5' end of the large footprint. A binding site for C/EBP (or one of the related proteins that recognize similar sequences) was identified in the center of the 97-bp footprint. This binding site is coincident or overlaps with the binding sites for five other proteins, two of which appear to be distinct from the C/EBP-related family of proteins. The binding site for a nuclear factor designated protein I is located between the HNF-1 and C/EBP binding sites. Finally, the 3'-most 15 bp of the footprinted sequence contain a binding site for another nuclear protein, which we have called protein II. Mutations that abolish the binding of either HNF-1, protein II, or the C/EBP-related proteins severely reduce enhancer activity. However, deletion experiments demonstrated that neither the HNF-1-binding site alone, nor the combination of binding sites for HNF-1, protein I, and C/EBP, nor the C/EBP-binding site plus the protein II-binding site is sufficient to enhance transcription from a strong apolipoprotein B promoter. Rather, HNF-1 and C/EBP act synergistically with protein II to enhance transcription of the apolipoprotein B gene. -86 to -52 (28, 29, 41). Mutational analysis indicates that binding of LFA-1 is essential for the activity of the apoB promoter in liver- and intestine-derived cell lines (28, 41). These sequences, however, are not the only ones required for regulating the transcription of the apoB gene in the liver and intestine. Indeed, we identified a tissue-specific transcriptional enhancer located mainly in the second intron of the human apoB gene (4). A 718-bp PvuII fragment including sequences from the first and second introns enhanced expression not only of the apoB promoter but also of the heterologous thymidine kinase promoter in transcriptionally active HepG2 and CaCo-2 cells but not in HeLa cells, in which the apoB gene is not transcribed. Most of the enhancer activity was contained within a 443-bp segment (4) situated entirely within the second intron. A genetic polymorphism within this region has been reported (35). A 147-bp fragment, which we have designated the core enhancer, accounted for some 75% of the enhancer activity of the 443-bp segment (4). In addition, a negative regulatory region (reducer) located 5' of the transcription start site that reduces transcription from the apoB promoter has recently been identified (44). The enhancer and the reducer operate independently of one another (44). Experiments with intestinal CaCo-2 cells utilizing a strong apoB promoter (-139 to +121) have revealed that the reducer acts by active repression of transcriptional activators that interact with the sequences from -111 to -88 of the apoB promoter, while the enhancer interacts directly with components of the basal transcriptional machinery (45). It seems likely that the level of apoB transcription is tightly controlled by the combined action of several regulatory elements. Here we report that the 147-bp core enhancer contains a

Apolipoprotein B (apoB) is the sole protein component of low-density lipoprotein (LDL) and is the ligand for the recognition of LDL by the LDL receptor (for a review, see reference 21). Elevated levels of LDL cholesterol and plasma apoB have been correlated with an increased risk of developing atherosclerosis (5, 50), while moderately decreased levels of LDL cholesterol and hypobetalipoproteinemia (51, 57) are generally associated with decreased risk of atherosclerosis. Therefore, it is important to understand the mechanisms that control the expression of the apoB gene. The human apoB gene contains 29 exons and 28 introns (3) and is transcribed primarily in the liver and intestine (30), although apoB mRNA has also been detected in the placenta of some mammals (17). Thus, transcription of the apoB gene is regulated in a tissue-specific manner. In expressing cells, the apoB gene is contained within a 47.5-kb DNase I-sensitive domain that is flanked by nuclear matrix attachment sites (34), which may serve to isolate the gene in a looped chromatin domain. In transient transfection assays, the 260 bp immediately upstream of the transcription start site are sufficient for expression in liver hepatoma cells and colon carcinoma cells (8, 16, 46) but not in HeLa or Chinese hamster ovary cells, which do not synthesize apoB. The cis-acting elements within this region and the protein factors that interact with them have been investigated by several groups (8, 16, 28, 41). Important sequence elements lie between positions -124 and -91 and positions -85 and 57 (28), and binding sites for C/EBP and LFA-1 (also called AF-1 and NF-BA1) have been identified in the region from -

*

Corresponding author. 1134

VOL. 12, 1992

HNF-1 AND C/EBP ENHANCE ApoB EXPRESSION

contiguous array of binding sites for at least nine distinct liver nuclear proteins spanning a region of 97 bp. One of these proteins is the liver-enriched transcription factor he-

introduction of the desired mutations were verified by dideoxynucleotide sequencing (48) of double-stranded plasmid DNA (58). The XbaI insert from Pvul47mutA was subsequently inserted at the XbaI site of plasmid -85CAT (46). Mutations in the putative binding site for protein II were made by amplifying the DNA between oligonucleotides Xba7/1 5' and TXMUT. The amplified DNA was digested with XbaI and inserted in the forward orientation at the XbaI site of plasmids pPVUCAT and -85CAT, and the resulting clones were designated 147FmutII. The integrity of the apoB

patocyte nuclear factor 1 (HNF-1, LFB-1) (for a review, see reference 39), which has been implicated in the transcriptional activation of several liver-specific genes. A binding site for another important liver-enriched transcription factor, C/EBP (27, 33) (or one of the related proteins that recognize similar sequences), was also identified within this 147-bp enhancer segment. These two protein-binding sites are necessary for maximal activation of transcription. Moreover, our results indicate that HNF-1 and C/EBP must interact synergistically with a novel protein factor (designated protein II) which recognizes the 3' end of the core enhancer in order to achieve maximal enhancement of transcription. MATERIALS AND METHODS Plasmid construction. Plasmid Pvu443F contains the 443-bp SmaI-PvuII enhancer region from the second intron of the human apoB gene (4) inserted immediately upstream of the apoB promoter (-898 to +121) fused to the reporter chloramphenicol acetyltransferase (CAT) gene. Plasmid Pvu147F (referred to as Xba7/1 in reference 4) contains a 147-bp fragment spanning nucleotides +806 to +952 of the apoB gene inserted at an XbaI site immediately upstream of the apoB promoter (-898 to + 121) fused to the CAT gene. To disrupt the 20-bp palindrome within footprint E of the enhancer, plasmids Pvu443F and Pvu147F were linearized at a unique SpeI site that lies at the center of the palindrome. After the removal of 5' overhangs with mung bean nuclease, the plasmids were ligated to KpnI linkers (5'-GGGTACCC 3'), digested with KpnI to remove excess linkers, and religated. The number of linkers introduced was determined by dideoxynucleotide sequencing (48) of double-stranded plasmid DNA (58). To create deletions within the 147-bp core enhancer, four oligonucleotides complementary to 18-nucleotide stretches within the 147-bp core enhancer were synthesized. In addition, each oligonucleotide contained a tail incorporating the recognition site for the restriction enzyme XbaI. The polymerase chain reaction (PCR) was then used to amplify the DNA between the pairs of oligonucleotides Xba7/1(5') and X-TAS, Xba7/1(3') and T/XS, and XbaCore(3') and Xba Core(5'), using plasmid TKCAT6-1 (4) as a template. The amplification products were digested with XbaI and inserted into the XbaI site of pPVU-CAT (4) to generate plasmids designated PvuXba-Taq, PvuTaq-Xba, and PvuXbaCore, respectively. The integrity of the apoB DNA in each deletion was validated by dideoxynucleotide sequencing (48) of double-stranded plasmid DNA (58). The XbaI inserts from these plasmids were excised and ligated into the XbaI site of plasmid -85CAT (46), which contains the region from -85 to + 121 of the apoB gene, fused to the CAT gene. To create mutations in the putative binding site for C/EBP, we synthesized an oligonucleotide, designated SPE854, spanning nucleotides +853 to +902 of the apoB gene and containing the desired point mutations. The PCR was then used to amplify the DNA between this oligonucleotide and a second oligonucleotide, designated vector which is complementary to vector sequences adjacent to the HindIII site of plasmid Pvu147R, which was used as the template. The amplified DNA was digested with SpeI and HindIII and used to replace the corresponding SpeI-HindIII fragment in Pvu147R to generate the plasmid designated Pvul47mutA. The integrity of the apoB DNA within this plasmid and the

1135

DNA within these plasmids and the introduction of the desired mutations were verified by DNA sequencing (58). An EcoRI fragment containing the complete coding region for mouse HNF-la was excised from plasmid pBCSmHNFa (a kind gift of D. Mendel) and inserted at the EcoRI site of pGEM-1 (Promega, Madison, Wis.) such that transcription with T7 RNA polymerase gave rise to sense RNA. The resulting plasmid was designated pGEM-1/mHNF-la. Cell culture and transient expression assays. HepG2 cells were cultured as previously described (4) and cotransfected by the calcium phosphate precipitation method (24) with 10 ,ug of the CAT gene expression plasmid and 5 ,ug of an internal reference plasmid (pRSV ,-gal), in which the ,B-galactosidase gene is under the control of the Rous sarcoma virus promoter. The cells were shocked 4 h later for 2 min with 15% glycerol, harvested 40 h after transfection, resuspended in 200 ,ul of 0.25 M Tris-HCl (pH 7.5), and disrupted by four cycles of freeze-thawing. After pelleting of the cell debris, 30 pul of extract was assayed for 3-galactosidase activity (26). The extract was then heated at 65°C for 10 min to destroy endogenous deacetylases, centrifuged to remove precipitated proteins, and assayed for CAT activity (22). CAT activity was quantitated on an AMBIS radioanalytical imaging system and corrected for differences in transfection efficiencies between flasks by dividing by the 1-galactosidase activity. Preparation of nuclear extracts and gel mobility shift assays. Nuclear extracts from mouse liver were prepared essentially as described by Gorski et al. (23), except that the extract was dialyzed against 20 mM HEPES (N-2-hydroxyethyl)-1-piperazineethanesulfonic acid, pH 7.6)-0.5 mM EDTA-0.1 mM dithiothreitol-0.1 mM phenylmethylsulfonyl fluoride for 12 h at 4°C. The extract was then lyophilized and dissolved in 25 mM HEPES (pH 7.6)-40 mM KCl-0.1 mM EDTA-10% glycerol-1 mM dithiothreitol. Gel mobility shift assays were performed as previously described (4). Proteins synthesized in rabbit reticulocyte lysates were added directly to the binding reaction mixture. Antiserum was added to the binding reaction mixture immediately after addition of the nuclear extract. In vitro transcription and translation. To produce synthetic RNA for mouse HNF-la, pGEM-1/mHNF-la was linearized with BamHI and transcribed with T7 RNA polymerase as recommended by the manufacturer (Promega). Plasmid pGEM-1HNF-3A, which contains the human HNF-3A cDNA (32) in the vector pGEM-1 (Promega), was a gift of R. Costa. After linearizing with BamHI, RNA was synthesized by using T7 RNA polymerase. In vitro synthesized mHNF-la and HNF-3A RNA were translated in nucleasetreated rabbit reticulocyte lysate as recommended by the supplier (Promega). Synthesis of oligonucleotides. Oligonucleotides were synthesized on an Applied Biosystems model 380B DNA synthesizer and purified on OPC columns (Applied Biosystems,

1136

BROOKS AND LEVY-WILSON

Foster City, Calif.) as described by the manufacturer. All oligonucleotides are listed 5' to 3':

X-TAS, T-XS, XbaCore (3' ), XbaCore(5' , Xba7/15' , Xba7/1 (3'), vector, SPE854, TXMUT,

MOL. CELL. BIOL.

with a nuclear protein similar or identical to HNF-1, but also strongly suggest that the binding site for this protein is

AAATCGTCTAGAGCTTCGAATCAATGACTA AAATCGTCTAGAATGTGAGGGTGAGGAAAT AAATCGTCTAGAAAGTCAGTATTTCCTCAC

AAATCGTOTAGACTGTCCTGTTTATCAGTG GGATTGTCTAGACGCTGGCCT TTAACCTGTAGAGGTCAGGTA TGACAGCTTATCATCCATAAG

AGTGACTAGTCATTGATTCGAAGCATGTAAAGGTGCGGAAAAGTTGACTT GATCTCTAGAGGTCAGGTAAATAGGAAGTGCGTGGATCTTCGATT

The pairs of complementary single-stranded oligonucleotides used in the gel mobility shift assays were annealed and then purified on native 15% acrylamide gels. Doublestranded oligonucleotides containing the recognition sites for transcription factors AP1, AP2, CTF/NF1, Spl, and AP3 were purchased from Stratagene (San Diego, Calif.).

RESULTS The core enhancer contains a binding site for HNF-1. We have previously localized a significant portion of the activity of the apoB second-intron enhancer to a 147-bp fragment (the core enhancer), which contains a single 97-bp DNase I footprint (4). The base sequence of this footprint is 80% conserved between the human and mouse genes (38). Gel mobility shift assays suggested that the 5' end of this footprint may contain a binding site for the transcription factor HNF-1 (4). We proposed that this HNF-1-binding site was probably located at the center of an almost perfect 20-bp palindrome, which contains a sequence that matches the consensus HNF-1 recognition site (14, 39) at 7 of 12 positions. To demonstrate that the core enhancer contained a binding site for HNF-1, we first carried out a series of gel mobility shift assays using a nuclear extract from mouse liver that had been enriched in the content of HNF-1 (a kind gift of D. Mendel and G. Crabtree). As illustrated in Fig. 1A, this extract gave rise to a specific retarded complex when incubated with the double-stranded 28-mer oligonucleotide 3-28 that contains the strong HNF-1-binding site from the 1-fibrinogen promoter (15). Formation of this complex was entirely eliminated by inclusion of a 150-fold molar excess of unlabeled ,B-28 oligomer in the binding reaction mixture (lane 3). A retarded complex of similar mobility was generated when the nuclear extract was incubated with an XbaI-TaqI restriction fragment that encompasses the 5'-most 65 bp of the apoB core enhancer and contains the putative HNF-1binding site (lane 5). A map showing the location of this probe is shown in Fig. 1B. Furthermore, the complex between the XbaI-TaqI DNA and the nuclear extract was specifically competed for by a 150-fold molar excess of the 1-28 oligomer (lane 6) but not by an equivalent molar excess of an oligonucleotide containing the binding site for the transcription factor C/EBP (lane 7) (transthyretin oligomer 2 in reference 25). Surprisingly, PAL20, a 20-bp doublestranded oligonucleotide corresponding to the 20-bp palindrome from the apoB core enhancer and containing the putative HNF-1 binding site, failed to compete for the formation of this complex (Fig. 1A, lane 8). These results indicate that the XbaI-TaqI probe forms a specific complex

situated partly or entirely outside of the palindrome. To investigate the importance of the palindrome in the formation of the HNF-1-like complex, we took advantage of a unique SpeI site situated at the exact center of the palindrome. After digestion with SpeI, the 5' overhanging nucleotides were removed with mung bean nuclease, thereby deleting 4 bp from the sequence that is homologous to the consensus HNF-1 recognition site. The palindrome was further disrupted by the insertion of one or two KpnI linkers. In one of the selected clones, designated V16A4, an additional 4 bp were deleted from the 3' end of the Spel site. The sequence of this clone around the site of the mutation is shown in Fig. lB. The XbaI-TaqI fragment was isolated from this clone, end labeled, and used as a probe in a gel mobility shift assay with the HNF-1-enriched mouse liver nuclear extract (Fig. 1A, lane 10). This mutated form of the XbaITaqI fragment was incapable of forming a HNF-1-like complex, suggesting that the binding site for the protein responsible for this complex lies at least partly within the palindrome. To confirm that HNF-1 is responsible for the major retarded complex seen with the XbaI-TaqI probe, a polyclonal antibody (40) raised against a portion of the recombinant mouse HNF-1 protein was used. This antibody does not block binding of HNF-1 to its recognition sequence but does cause an alteration in the mobility of the retarded complex observed in a gel mobility shift assay (40, 59). Figure 1C illustrates the effect of the HNF-1 antibody on the binding of HNF-1-enriched mouse liver nuclear extract to the 3-28 oligomer (lanes 1 to 3) and the XbaI-TaqI fragment (lanes 4 to 6). The presence of the antibody results in a small but significant shift in the mobility of the retarded complexes formed with both probes. This result confirms that HNF-1 binds to the XbaI-TaqI fragment of the core enhancer. Addition of antibody also results in the formation of a new retarded band of higher mobility (designated as X in Fig. 1C) with the XbaI-TaqI probe but not with the 13-28 probe. The identity of this second complex and the reason for its formation remain unclear. Next, we compared the affinity of HNF-1 for the apoB enhancer relative to that of the 1-fibrinogen promoter binding site (Fig. 2). The 1-28 oligomer and the wild-type XbaI-TaqI fragment were end labeled to the same molar specific activity and incubated with the HNF-1-enriched nuclear extract in the presence of either a 5- or 10-fold excess of unlabeled 13-28 oligomer. In the absence of competitor, the percentage of probe converted to complex was less for the XbaI-TaqI fragment (lane 6) than for the 1-28 oligomer (lane 2). Furthermore, a fivefold excess of unlabeled 13-28 oligomer entirely eliminated formation of the

VOL. 12, 1992

A

3-28

Probe

Extract

-

+

Competitor

+

.

HNF-1 AND C/EBP ENHANCE ApoB EXPRESSION Xba l -Taq V16 I4

Xba I - Taql

- -T

+

Competitor

cnN _ _

ap

I 1

2

3

~

~

- a

:4

S 4

I

5

4

6

8

7

9 10

q+921

Xba

.. T^

+952

Taq I - Xba I Taq I

ATCAGTGA-C-T-A-G-T-C-A-TTGAT ATCAGTGAGGGTACCCGGGTACCCTGAT Probe

mHNF-laantibody Extract

of

mouse

3-28

Xbal-Taql

-

+

-

-

+

BSA +

+

BSA

+

+

1

*

I

5 6 7 8

FIG. 2. Measure of the affinity of the interaction between HNF-1 and its sequence in the apoB core enhancer. The XbaI-TaqI fragment from the core enhancer (lanes 5 to 8) and the oligomer (lanes 1 to 4) were end labeled to the same molar specific activities and used as probes in the gel mobility shift assay with the HNF-1enriched mouse liver nuclear extract. Unlabeled 1-28 oligomer was included in some of the binding reaction mixtures at the fold molar excess indicated above each lane. BSA, 2 ,ug of bovine serum albumin in place of nuclear extract.

1-28

+871

C

r

.I

_~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

+806

Binding

+

K

64

Taqs

1.

+

No

Xba I

Xba I - Taq I

FIG.

-

a

HNF-1 complex-

Taq I

w.t.

aa

-

I6S AXc

:~~~~~~vw

V16A4

-

Xba I - Taq I + BSA *

_-

am

B

Probe | f-28 Extract BSA + +

1137

....

HNF-1 complex formed with the XbaI-TaqI probe (lane 7), whereas an identical amount of unlabeled 1-28 oligomer reduced binding of HNF-1 to the ,B-28 probe by only about 70% (lane 3). In the presence of a 10-fold excess of unlabeled 3-28 oligomer, about 10% of the HNF-1/P-28 complex remained (lane 4). From these results, we conclude that the HNF-1-binding site within the XbaI-TaqI fragment exhibits a lower affinity compared with that of the strong binding site from the ,B-fibrinogen promoter. Both HNF-1 and HNF-3A are able to bind to the core

Afta

.+

plasmid 147V16A4 and end labeled with [cx-32P]dCTP and Klenow DNA polymerase. The double-stranded 1-28 oligomer was end labeled with [y-32P]ATP and polynucleotide kinase. In each case, an equal amount of HNF-1-enriched mouse liver nuclear extract was used. The additions of extract and the fold molar excess of unlabeled competitor DNA are indicated above each lane. Arrowhead indicates position of HNF-1 complex. (B) Diagram of the core enhancer showing the locations of the restriction fragments used as probes in gel mobility shift assays. The shaded box represents the location of the 97-bp footprint. The nucleotide sequence of the 20-bp palindrome (wild type [w.t.]) that spans positions +850 to +869 and the corresponding sequence of the clone V16A4 are shown at the bottom of panel B. The arrows indicate the two halves of the palindrome. (C) End-labeled XbaI-TaqI fragment (lanes 4 to 6) or ,3-28 oligomer (lanes 1 to 3) were incubated with HNF-1-enriched mouse liver nuclear extract in the presence or absence of 1 ,ul of rabbit polyclonal antiserum raised against recombinant mouse HNF-ot (mHNF-lot) under the same conditions used for the gel mobility shift assay. The binding reaction mixtures were then fractionated on a 5% native acrylamide gel. BSA, 2 pug of bovine serum albumin in place of nuclear extract. Arrowhead indicates position of HNF-1 complex. The band marked with an X is from

W-x

k_ts

2

liver nuclear

3 proteins

to the

Xbal-TaqI

fragment of the core enhancer in gel mobility shift assays. (A) The 67-bp XbaI-TaqI fragment was isolated from plasmid Pvu147F or

described in the text.

1138

MOL. CELL. BIOL.


-Hrob: Extracl

.

_

C,4

nth es rze:-

orotei"r

*:)i-npetitc

-INF--

I

_

onmple

HNF-3A *:;omplex

1

r

T

u

FIG. 3. Binding of synthetic HNF-1 and HNF-3A to the XbaITaqI fragment of the core enhancer. Mouse HNF-la (mHNF-la) and HNF-3A were synthesized in rabbit reticulocyte lysate, and 3 pl of the programmed lysate was included in the binding reaction of a standard gel mobility shift assay. Three microliters of lysate that had been programmed with brome mosaic virus (BMV) RNA (supplied by Promega) was used as a control. In lane 2, mouse liver nuclear extract was used as the source of HNF-1. Unlabeled competitor DNA was included in sonie binding reaction mixtures at the fold molar excess indicated. The probes used were the XbaI-TaqI fragment from clone Pvu147F (lanes 1 to 7) or from clone 147V16A&4 (lanes 8 and 9). BSA, 2 ,ug of bovine serum albumin.

enhancer. To establish conclusively the presence of an HNF-1-binding site in the XbaI-TaqI portion of the core enhancer, a cDNA clone encoding mouse HNF-lot (31) was transcribed in vitro, and the resulting RNA was translated in rabbit reticulocyte lysate. Binding of this in vitro-synthesized protein to the XbaI-TaqI probe was assessed in a gel mobility shift assay (Fig. 3). As a control, reticulocyte lysate programmed with brome mosaic virus RNA was used, and this generated a number of retarded complexes (lane 3). Nevertheless, when the reticulocyte lysate was programmed with synthetic RNA encoding mouse HNF-lot (mHNF-la) (lane 4), it produced an additional complex, absent from the control (brome mosaic virus-programmed lysate), that migrated with the same mobility as did the predominant HNF-1 complex observed with mouse liver nuclear extract (lane 2). Furthermore, this complex was specifically competed for by a 10-fold molar excess of the 13-28 oligomer (lane 5), thus demonstrating conclusively that the apoB core enhancer contains a binding site for HNF-1. Sequence comparison between the footprint in the core enhancer and recognition sequences for known transcription factors (4) revealed two regions with homology to the consensus binding site for HNF-3 (11), another trans-acting factor implicated in activation of liver-specific genes. One of these regions lies within the XbaI-TaqI probe. HNF-3 has been resolved into three distinct binding activities, termed HNF-3A, -B, and -C (32), and the cDNA for HNF-3A has been cloned (32). To determine whether the putative HNF-3 recognition sequence within the XbaI-TaqI fragment is func-

tional, RNA was synthesized in vitro from an expression plasmid containing the HNF-3A cDNA (a kind gift of R. Costa). As illustrated in Fig. 3, synthetic HNF-3A gave rise to a retarded band with the XbaI-TaqI probe (lane 6) that was not observed with the control lysate (lane 3). This retarded complex was competed for by a 10-fold molar excess of a double-stranded oligonucleotide containing the strong HNF-3 binding site from the transthyretin promoter (lane 7) (11) (also a gift of R. Costa). The mobility of this retarded band was similar to that of the complex between in vitro-synthesized HNF-3A and the oligomer containing the transthyretin HNF-3-binding site (data not shown). When the XbaI-TaqI fragment containing the mutation in the 20-bp palindrome (V16A4) was used as a probe, the same HNF-3 complex was observed (lane 9). From these results, it can be concluded that in in vitro experiments in which relatively pure protein is used, HNF-3A is able to bind to the core enhancer and that binding is not abolished by the mutations introduced in clone V16A4. The validity of these results was strengthened by the finding that neither in vitro-synthesized mHNF-la nor HNF-3A formed specific retarded complexes with a TaqI fragment that spans the central portion of the core enhancer (data not shown), despite the fact that this segment contains a sequence that matches the HNF-3 consensus sequence at 9 of 11 positions (4). However, the physiological relevance of the binding of in vitro-synthesized HNF-3A to our XbaI-TaqI probe is unclear, given that no distinct HNF-3 complex was formed when this probe was incubated with the HNF-1-enriched nuclear extract. This failure cannot be attributed to an absence of HNF-3 protein in this extract, since a strong retarded complex was formed when this extract was incubated with the oligomer containing the HNF-3 binding site from the transthyretin promoter (data not shown). Binding of HNF-1 is necessary for full activity of the apoB enhancer in HepG2 cells. To test the functional importance of the HNF-1-binding site within the core enhancer, the 20-bp palindrome harboring the likely recognition site for this protein was disrupted by insertion of KpnI linkers at a unique SpeI site that lies at the center of the palindrome. Linker insertion mutations were made in both the 443-bp enhancer fragment and the 147-bp core enhancer (Fig. 4). Four clones containing either one or two KpnI linkers inserted at the SpeI site were selected. These mutated variants of the enhancer were initially placed in the forward orientation immediately upstream of apoB promoter sequences spanning nucleotides -898 to + 121 fused to the CAT reporter gene. The ability of the wild-type and mutated variants of the enhancer to increase expression from the apoB promoter was then tested by transient transfection of HepG2 cells. In agreement with our previous results (4), the wild-type 443-bp enhancer increased CAT activity by 3.4fold. The introduction of one linker at the SpeI site (443V8) reduced the activity of the enhancer to 1.9-fold, which is 38% of the activity seen with the wild-type sequence. When two linkers were inserted (443V16), CAT activity was reduced further, so that the enhancer activity was only 16% of that observed with the wild-type 443-bp enhancer. In this series of experiments, the 147-bp core enhancer (147F) exhibited the same enhancer activity as did the 443-bp fragment. Insertion of two linkers at the SpeI site (147V16) reduced the activity of the core enhancer to 20% of that exhibited by the wild-type sequence. A similar reduction of enhancer activity was observed with clone 147V16A4, in which an extra 4 bp were deleted from the 3' side of the SpeI site. Gel mobility shift assays using the XbaI-TaqI fragment

VOL. 12, 1992


B

AASpeI +4

Enhancer

Relative

Activity %

N

CAT

Activity S.D.

Enhancer Activity N %

10

4421

443 F

-85

-898 Relative CAT Activity S.D.

43 Enhancer

3.4 ±0.4

6 100

443 VS I

I

1

1.9 ±02

8

38

443 V161

l=

I

1.4 ±0.1

4

16

16.3 ±1.3

4 100

6.5

4

±0.1

36

147 F

3.5 ±0.8 10 100

36.3 _0.7 4 100

147 V16

1.5 ±0.1

6

20

15.9 ±1.6

147 Vl6A4

1.4 _0.2

6

16

c

HNF-1 Consensus: G T T A A T N A T IWI

W.T.Apo.B:

I

I

I

TAAC I

I

IGGGTACCCI

ATCAGTGA

447 V8

A T C A G T G A IGcGGTACCC IT C A T T G A T

147

42

ATCAGTGA-C-T-A-G- TCATTGATTCGA

443 V8

443 V16

4

ATCAGTGA

TCATTGAT

E~~CATTGAT

VI16

A 147V16A4 ATCAGTGAG ^i~TGATTCGA FIG. 4. Effect of disrupting the HNF-1-binding site on enhancer

activity in transiently transfected HepG2 cells. (A) The apoB enhancer regions and their mutations that were cloned upstream of apoB promoter sequences -898 to +121 (-898) or -85 to +121 (-85) linked to the CAT gene. (B) CAT activity expressed relative to that of the promoter alone, whose activity was set to 1.0. S.D., standard deviation; N, number of independent transfection experiments performed. The results are also expressed as percentage of the activity of the wild-type enhancer (either 443 or 147) in the % columns. (C) Nucleotide sequence of the 20-bp palindrome from the apoB enhancer and the corresponding sequences of the four linker insertion mutants shown above. The horizontal arrows indicate the two halves of the palindrome. Above the wild-type (W.T.) sequence is shown the homology to the HNF-1 consensus recognition sequence. The boxed nucleotides represent KpnI linkers.

isolated from plasmid 147V16A4 demonstrated that this form of the enhancer is unable to bind HNF-1 (Fig. 1A, lane 10). Thus, loss of HNF-1 binding results in an 80% reduction in the activity of both the core enhancer and the 443-bp enhancer. The core enhancer, the 443-bp enhancer, and one mutant variant of each were also placed in the forward orientation immediately upstream of a minimal apoB promoter (-85) containing just 85 bp of 5'-flanking sequence, linked to the CAT gene. This minimal apoB promoter has only 23% of the activity of the -898 promoter in HepG2 cells (46). The results of transient transfection assays of these minimal promoter constructs in HepG2 cells are also presented in Fig. 4. In this minimal promoter the 443-bp enhancer increased CAT activity by some 16-fold. This marked increase in the magnitude of the enhancer effect compared with its activity in the larger apoB promoter could have two explanations. First, increasing the proximity of the enhancer to the transcriptional start site might enable transacting factors bound to the enhancer to interact more readily with the basal transcription complex. Alternatively, the enhancer may exert a larger influence upon the weaker -85 promoter, where the basal transcription complex is more responsive to additional positive influences. Evidence from our laboratory supports the second possibility (45). Disruption of the palindrome by insertion of two linkers reduced mutant

1139

the effect of the 443-bp enhancer upon the -85 promoter to 6.5-fold, which is 36% of that observed with the wild-type sequence. Thus, in contrast to the -898 promoter, mutation of the HNF-1 binding site in the context of the -85 promoter leaves significant residual enhancer activity. This may reflect a difference in the mechanism of action of the enhancer at a distance. The 147-bp core enhancer increased transcription from the -85 promoter by 36-fold, which is 2-fold greater than the effect observed with the 443-bp fragment. Mutation of the HNF-1 site as in the 147V16 mutant reduced enhancer activity to 40%. Thus, the loss of HNF-1 binding had a less pronounced effect on the ability of the core enhancer to increase expression from the minimal apoB promoter (-85) than from the -898 promoter. These results demonstrate that the HNF-1-binding site detected in the gel retention studies is functional and necessary for full enhancer activity. The binding site for HNF-1 lies in the 5' half of the palindrome. The mutations introduced into 147V16A4 abolished binding of HNF-1 (Fig. 1A, lane 10), indicating that the binding site for HNF-1 is close to the palindrome. Given the palindromic nature of most HNF-1-binding sites, we predicted that its binding site lay symmetrically over the palindrome, whose sequence matches the HNF-1 consensus sequence at 7 of 12 positions. Nevertheless, PAL20, a 20-bp double-stranded oligonucleotide that spans the entire palindrome, did not compete for binding of HNF-1 to the XbaITaqI probe (Fig. 1A, lane 8). In addition, when PAL20 was labeled and used as a probe, it was unable to form the HNF-1 complex (data not shown). Suspecting that a 20-bp sequence might be inherently too short to allow HNF-1 binding (although it does contain its recognition sequence), we synthesized a double-stranded oligonucleotide extending 4 bp beyond either end of PAL20, designated as PAL28 (Fig. 5C). When PAL28 was labeled and used in a gel mobility shift assay with the HNF-1-enriched mouse liver extract, no HNF-1 complex was formed (Fig. 5A, lane 3). In a control binding reaction performed in parallel, a strong HNF-1 complex was formed with the ,-28 oligomer (lane 1). Since PAL28 extends as far as the 3' end of the XbaI-TaqI fragment, binding of HNF-1 must require sequences further 5' of those contained within PAL28 (Fig. 5C). An oligomer containing all of the footprinted sequences within the XbaITaqI fragment designated PAL35 was therefore synthesized and tested in the gel mobility shift assay. When incubated with the liver extract, PAL35 formed a retarded complex with the same mobility as that formed with the HNF-1binding 0-28 oligomer (Fig. SA, lane 6). This complex was entirely competed for by a 100-fold molar excess of both unlabeled PAL35 (lane 7) and ,-28 (lane 8), thus confirming its identity as the HNF-1 complex. This result shows that HNF-1 binding requires perhaps as many as 11 bp 5' of the palindrome. A nucleotide sequence matching the HNF-1 consensus binding site at 9 of 12 positions was found in this region (Fig. SB). To confirm that this sequence was the binding site for HNF-1, a variant of the PAL35 oligonucleotide, designated PAL35M1, containing five base substitutions within the putative HNF-1 recognition sequence was synthesized. The sequences of PAL35 and PAL35M1 are shown in Fig. SB, and the locations of the base substitutions are indicated by asterisks in Fig. SC. PAL35M1 was unable to compete for binding of HNF-1 to PAL35 (Fig. SA, lane 9). Furthermore, labeled PAL35M1 was unable to bind HNF-1 (lane 11). Instead, PAL35M1 formed a faster-migrating complex that seemed to be specific since it was competed for by a 100-fold excess of unlabeled PAL35M1 (lanes 11 and 12). One possible explanation for the appearance of this new

1140

_~


MOL. CELL. BIOL.

complex is that preventing HNF-1 from binding allowed another protein to bind. On the basis of our previous results, Probe -28, PAL -DAL jD t we f1>suspected that this new complex might be caused by _ ____-v--o E binding of HNF-3, but competition with the oligomer conBSA + Extract BSA taining the HNF-3-binding site from the transthyretin promoter showed that this was not the case (data not shown). It . ornpetit -o -therefore seems likely that the base substitutions within PAL35M1 created a binding site for a protein that is irrelevant to this study. wa Oft ~Pft 0-0 0% dft 60% These results taken together localize the HNF-1-binding site to a sequence that includes the 5' half of the palindrome NFf * " and that matches the HNF-1 consensus sequence at 9 of 12 ormplex positions. In light of these results, the earlier finding that the linker insertion mutant 147V16A4 was unable to bind HNF-1 is provocative. As illustrated in Fig. 5C, only a single nucleotide at the very 3' end of the HNF-1 recognition sequence is altered (from C to G) in this mutant. It appears that this single nucleotide change may be sufficient to ,* ~ ig prevent the binding of HNF-1. Indeed, this base is particuI.4 larly well conserved among known HNF-1-binding sites; 24 of 26 have a C at this position (39). However, perhaps sequences outside of those generally considered as the HNF-1 recognition sequence are also required for binding. In this case, the gross disruption of the palindrome by the insertion of two linkers may contribute to the loss of HNF-1 binding. This may also explain why the insertion of only a single linker in the 443-bp enhancer did not exert as large an rc 5 7? C t-^.a 12 effect upon enhancer activity as did the insertion of two linkers (Fig. 4). d ! In addition to HNF-1, the core enhancer contains a binding PAL 35 CTGTCCTGTTTATCAGIrGAcTAGTcATTGATTcGA site for C/EBP. The 97-bp DNase I footprint within the core enhancer is presumably composed of the binding sites for PAL35MG several trans-acting factors. The 5' end of this footprint binds HNF-1 and perhaps also HNF-3. To investigate DNAprotein interactions in the remainder of this footprint, the -----aA-"NA'.';,--.,! 147-bp core enhancer was digested with TaqI, which yields, -"" AG'T -.!A 7 TA lim in addition to the 5' XbaI-TaqI fragment, a 50-bp TaqI fragment containing the central portion of the footprint and a _________ 31-bp TaqI-XbaI fragment containing the 3'-most 14 bp of the footprint (Fig. 1B). The binding of mouse liver nuclear proteins to the TaqI and TaqI-XbaI fragments was investigated by using the gel mobility shift assay. Figure 6A illustrates the results obtained when the TaqI fragment was used as a probe. At least six distinct complexes, designated ~--~~~-~ a to f, were formed (lane 2), each of which represents the binding of one or more nuclear proteins to the TaqI fragFIG. 5. Binding of HNF-1 to variouIS oligonucleotides spanning ment. A 100-fold molar excess of unlabeled TaqI fragment the 20-bp palindrome of the core enhanc Ser. (A) The double-stranded (lane 3) efficiently competed for formation of all six retarded oligonucleotide probes indicated at the top were end labeled and complexes, whereas a similar excess of the 1-28 oligomer used in gel mobility shift assays with the HNF-l-enriched mouse (lane 4) or of the oligonucleotide containing the binding site liver nuclear extract. Lanes labeled BS 'A contained 2 ,ug of bovine (ln 4) oofte olileotidcontaning thebindsi serum albumin in place of the nuclear exctract. Unlabeled competitor for HNF-3 (lane 5) failed to compete for any of the bands. DNA was included in some of the bind ling reaction mixtures at the Furthermore, oligonucleotides containing the binding sites fold molar excess indicated. (B) Sequenoce of oligonucleotide PAL35 for APi, AP2, Spi, and CTF/NF1 (150-fold molar excess) and the substitution mutations made inX oligonucleotide PAL35M1 were unable to compete for any of the complexes (data not The boxed areas above the sequence ir idicate the two regions with shown). These results show that all of the bands are highly homology to the consensus recognitiorn sequence for HNF-1, and specific and that none are the result of binding of HNF-1, the number of bases that match the 4 consensus is indicated. (C) HNF-3, AP1, AP2, Spl, or CTF/NF1. However, a 100-fold Nucleotide sequence of the footprinted region within the XbaI-TaqI molar excess of the oligonucleotide containing the binding fragment of the core enhancer and the I locations of oligonucleotides site for C/EBP from the transthyretin enhancer (lane 6) did used in gel mobility shift assays. The ocation of the palindrome is efficiently compete for the major retarded complex d and indicated by arrows. The recognition sit te for HNF-1 was defined by also for complexes a and b. The C/EBP oligomer also DNA binding assays using the oligonu:cleotides represented by the b. artially compete digomer the bold lines below the sequence. The ast erisks indicate the locations partially competed ford complexIhe e butBP did not affect the of point mutations in the oligonuclec )tides. Also shown aligned formation of complexes c and f. This result suggested that beneath the wild-type sequence is t]he sequence of the linker one or more of the proteins binding to the TaqI fragment was insertion mutant V16A4. C/EBP or one of the related proteins that recognize the same sequence as C/EBP (1, 6, 9, 18, 43, 47, 54). A

-T

H

r

.

-

A

,

..

.'-'

,


VOL. 12, 1992

1141

B___

A Probe

Heat-+1+ + + l +l+l + + +

Extract BSA

IL _ Competitor C 0

Taq I - Xba I

Probe

Taq I

0

W in

Extract BSA +

+

+

+

+

+

+

+

+

+

C%l ||

| Ct | Zco< Competitor - _a.

LII

0D 0V0C

0 CD

C

C

CD

*

0

".

-_

_

-

FIG. 6. Binding of liver nuclear proteins to the TaqI and TaqI-XbaI fragments of the core enhancer. The TaqI (A) and TaqI-XbaI (B) fragments of the core enhancer were isolated from clone Pvu147F, end labeled with [a-32P]dCTP and Klenow enzyme, and incubated with 2 ,ug of unfractionated mouse liver nuclear extract in a gel mobility shift assay. In lanes 9 and 10, the nuclear extract was heated at 80°C for 7 min, centrifuged to remove precipitated proteins, and then added to the binding reaction mixture. Unlabeled competitor DNA at the indicated molar excess was included in some of the binding reaction mixtures. Lanes designated BSA contained 2 ,ug of bovine serum albumin in place of nuclear extract.

Heating the extract at 80°C for 7 min before adding it to the binding reaction eliminated the formation of complexes a, b, and c (Fig. 6A, lane 9). However complex d, the major complex that was competed for by the C/EBP oligomer, was relatively unaffected by heat treatment. Because heat stability is a well-documented characteristic of C/EBP (27), this result lends support to the proposal that complex d is the result of binding of C/EBP to the TaqI fragment. Interestingly, complexes e and f were also heat stable. Complexes a and b, the other two complexes competed for by the C/EBP oligomer, were not heat stable and are therefore ruled out as being caused by binding of C/EBP. The 31-bp TaqI-XbaI fragment formed only a single retarded complex when incubated with mouse liver nuclear extract (Fig. 6B, lane 2) that was heat labile (data not shown). Formation of this complex was efficiently competed for by a 100-fold molar excess of the unlabeled TaqI-XbaI fragment (lane 3). In an attempt to identify the protein generating this retarded complex, a series of unlabeled oligonucleotides containing known binding sites for a number of transcription factors were used as competitors. Only an oligonucleotide containing the binding site for AP2 (lane 8) displayed any effect on complex formation, and only at a rather high molar excess. Thus, the identity of the protein binding to the TaqI-XbaI probe, which we will refer to as protein II, remains obscure. Binding of C/EBP is necessary for full activity of the enhancer. Analysis of the DNA sequence within the TaqI fragment revealed three regions with homology to the proposed consensus sequence (TCNTACTC) for C/EBP (12), and these are indicated by the arrows above the sequence in Fig. 7B. Two of these motifs are separated by 2 bp and arranged as an inverted repeat. The third segment homolo-

gous to the C/EBP consensus partly overlaps with one of the others. No other significant similarities to the C/EBP consensus exist within the core enhancer. To test the hypothesis that this was indeed the binding site for C/EBP, six point mutations were created within this sequence as described in Materials and Methods. The point mutations were designed to cause maximal disruption of the homology to the C/EBP consensus sequence and are shown below the wild-type sequence in Fig. 7B. These mutations were made in the context of the 147-bp core enhancer, and the resultant clone was designated mutA. The 50-bp TaqI fragment was isolated from this clone and tested for binding to mouse liver nuclear proteins in parallel with the wild-type TaqI fragment (Fig. 7A). The wild-type TaqI fragment exhibited the same pattern of six retarded bands (lane 2) as seen previously. A 25-fold molar excess of the wild-type TaqI fragment competed efficiently for formation of all these complexes (lane 4). However, a similar excess of the TaqI fragment from mutA partially competed for the formation of complexes c and f but not at all for any of the other complexes (lane 5). When the TaqI fragment from mutA was used as a probe in the gel mobility shift assay, only two retarded complexes with mobilities similar to those of complexes c and f were observed (lane 7). Thus, point mutations within the putative C/EBP-binding site abolished the binding of C/EBP (complex d), confirming the location of the binding site, and also prevented the binding of proteins responsible for complexes a, b, and e. This result suggests that the binding sites for the proteins responsible for complexes a, b, and e overlap with the C/EBP-binding site. The idea that the retarded complexes seen with the mutant TaqI fragment are caused by the same proteins responsible for the formation complexes c and f with the wild-type probe is supported by

1142

MOL. CELL. BIOL.


-cUe B -.SA

Extract ,BSA .'CrToDe*"'

--.-

cm 5DP

c,Ir

idA

-

;< EBP-

^complex

_

1

2

3

4

5

6

7 8

9

--_-

GCTGAGGGTGAGGAAATACTGA'TT hC

Relative CAT

Promoter:

-898

ActIvlty -85

FIG. 7. Effect of mutations in the C/EBP site on binding of nuclear proteins and enhancer activity. (A) The TaqI fragment of the core enhancer was isolated from clone Pvu147F or from clone Pvu147mutA (TaqI mutA) and end labeled with [oa-32P]dCTP and Klenow enzyme. Binding of unfractionated mouse liver nuclear extract (2 ,ug per reaction) was assayed in the gel mobility shift assay. Unlabeled competitor DNA was included in some binding reaction mixtures at the molar excess indicated. BSA, bovine serum albumin. (B) Sequence (+879 to +903) of the core enhancer in the vicinity of the C/EBP-binding site. The arrows denote the three regions with homology to the consensus C/EBP recognition sequence. Also shown are the point mutations made in the clone mutA. w.t., wild type. (C) Results of transient transfections of HepG2 cells with plasmids containing the core enhancer (147) or the core enhancer containing mutations in the C/EBP site (147mutA) inserted upstream of the -898 apoB promoter segment or the -85 promoter segment. CAT activity is expressed relative to that of the promoter alone, whose activity was set to 1.0, and is the average of four independent transfections. S.D., standard deviation; N, number of independent transfections.

the fact that unlabeled mutant TaqI DNA competed for complexes c and f (Fig. 7A, lane 5). These two complexes formed with the mutant TaqI probe reflect specific interactions, because they were competed for by a 25-fold excess of unlabeled mutant TaqI DNA (lane 8) but not by a 100-fold molar excess of the oligomer containing the C/EBP-binding site (lane 9). From these results, it seemed likely that the binding sites for the proteins generating complexes c and f may lie outside of the C/EBP-binding site. Alternatively, since the formation of complexes c and f was strengthened with the mutA clone, it is possible that these two proteins may also bind in the vicinity of the C/EBP site. In summary, the TaqI fragment from the core enhancer binds six proteins, one of which is C/EBP or one of the related proteins that

recognize similar sequences. The binding sites for three of the remaining proteins (complexes a, b, and e), one of which (e) is heat stable (Fig. 6A), appear to overlap with that of C/EBP. To test the functional importance of the C/EBP-binding site, mutA was tested for its ability to increase the activity of both the -898 apoB promoter and the minimal (-85) apoB promoter when transiently transfected into HepG2 cells. The mutant and wild-type core enhancer fragments were both placed in the reverse orientation upstream of the -898 promoter and in the forward orientation upstream of the -85 promoter. The results are presented in Fig. 7C. The wildtype core enhancer increased transcription from the -898 apoB promoter by 1.7-fold, whereas the core enhancer containing the C/EBP mutation had the same activity as did the promoter alone. Thus, at least in the reverse orientation, in which the core enhancer consistently exhibits a rather low activation potential, binding of C/EBP is essential for the enhancer to function. In the context of the minimal apoB promoter, containing just 85 bp of 5'-flanking sequence, the C/EBP mutation reduced the activity of the core enhancer from 36-fold to 18-fold. So in this context, the C/EBP binding site contributes 50% of the activation potential of the core enhancer. Because of the low activity of the core enhancer in the reverse orientation in the -898 promoter, it is difficult to be sure that the magnitude of the effect of the mutation is significantly different when assayed in the two promoters. Nevertheless, it is clear from these results that the C/EBPbinding site constitutes an important cis-acting element of the core enhancer. The binding sites for proteins c and f overlap with the C/EBP-binding site. To define the binding sites for the proteins responsible for complexes c and f, we synthesized four double-stranded oligonucleotides designated El to E4 (Fig. 8) spanning the entire 50-bp TaqI region of the core enhancer. Oligonucleotide El formed a single specific retarded band in the gel mobility shift assay (Fig. 8, lanes 1 to 7). However, the El oligonucleotide failed to compete for any of the complexes formed upon the TaqI fragment (lane 23), indicating that El is bound by a protein whose recognition sequence lies in the immediate vicinity of the 5'-most TaqI site. We refer to the protein recognizing this site as protein I. Oligonucleotide E2 formed three retarded bands when incubated with mouse liver nuclear extract (Fig. 8, lane 9). These complexes were efficiently competed for by the oligonucleotide containing the binding site for C/EBP but not by oligonucleotide El. Furthermore, when the TaqI fragment was used as a probe, oligonucleotide E2 generated a competition pattern almost identical to that of the C/EBP oligomer (lanes 21 and 22). This finding confirms that the binding sites for proteins giving rise to complexes a, b, d, and e all lie within a 25-bp region containing the previously identified C/EBP-binding site. Oligonucleotide E3 failed to form any specific complexes when tested in the gel mobility shift assay (data not shown) and was unable to compete for any of the proteins binding to the TaqI fragment (Fig. 8, lane 21). Taken together, these results show that the binding sites for proteins c and f must lie very close to and probably overlap with the C/EBPbinding site. The observation that mutations that disrupt binding of C/EBP appear to strengthen the binding of proteins c and f (Fig. 7) is consistent with this conclusion. Oligonucleotide E4, which encompasses all of the footprinted sequences from the TaqI-XbaI fragment, formed a single retarded complex (Fig. 8, lane 14). The mobility of this


VOL. 12, 1992 Probe Extract

E2

El BSA|

I

+

WL

Competitor

x| x1 =

+ + + 1BSA

+

LU z UJL Uw qA 1i 1 1 115 ISi1 XK0 0

x

Taq

E4 BSA +

+ +

+

+

BSA+

+

+

LU

LU

0 0 N Nx Ix i>- I- I-I I _ (I 0C

0

uL

X

0

0

1143

I

+

+

L

LU

+

Li 0xl

x 1.

o

Cd

~~~~~~~~~~~~~~~~~~I::

'" iw. _ *# 4 _b-0.

-"a

.

adce f

Eg

iii:

1

2

3

4

5

6

7

X

9

10 11

12

Taql

Taql

+871

+921

C/EBP -~

El E2

E3 E4

FIG. 8. Binding of nuclear proteins to oligonucleotides spanning the TaqI fragment of the core enhancer. The double-stranded oligonucleotides illustrated at the bottom were end labeled with [-y-32P]ATP and used in a gel mobility shift assay with unfractionated mouse liver nuclear extract. In lanes 18 to 24, the 50-bp TaqI fragment from the core enhancer was used as a probe. Lanes labeled BSA contained 2 ,ug of bovine serum albumin in place of the nuclear extract. Unlabeled competitor oligonucleotides were included in some of the binding reaction mixtures as indicated.

complex was very similar to that formed with the TaqI-XbaI fragment (data not shown), strongly suggesting that it was the result of binding of protein II to the E4 oligomer. However, we cannot entirely discount the possibility that oligonucleotide E4 is recognized by a protein distinct from protein II that nevertheless produces the same shift in the mobility of the probe in a gel retardation assay. HNF-1- and C/EBP-binding sites are necessary but not sufficient for full activity of the core enhancer. Mutagenesis of the HNF-1- and C/EBP-binding sites showed that binding of both of these factors is essential for full activity of the core enhancer. To investigate further the minimal sequence elements required for the function of the core enhancer, three deletions of the core enhancer were made by using the PCR. These deletions were cloned upstream of both the -898 apoB promoter and the -85 apoB promoter and assayed for enhancer activity in transient transfections of HepG2 cells (Fig. 9). The Xba-Taq clone, which corresponds almost exactly to the XbaI-TaqI fragment of the core enhancer and contains only the HNF-1-binding site, exhibited no enhancer activity in the context of the -898 promoter. The Taq-Xba clone, which contains the 3' half of the core enhancer and includes the C/EBP-binding site and the protein II-binding site, also failed to augment expression from the -898 promoter. Even when the HNF-1-, protein I-, and C/EBPbinding sites were present together, as in clone XbaCore, no enhancer activity was detected. From these results, it is clear that neither HNF-1 nor C/EBP, alone or in combina-

tion with protein I,

can

enhance expression from the -898

promoter. This implicates the binding site for protein II as an essential component of the core enhancer. Use of the -85 apoB promoter allowed a more sensitive

for cis-acting elements within the core enhancer. However, since the DNA fragments being tested were placed only 85 bp upstream of the transcription start site, this cannot be considered a true measure of enhancer strength. The Xba-Taq clone that contained the binding site for HNF-1 (and perhaps also HNF-3) increased CAT activity by sevenfold in the forward orientation. This result demonstrates that this region acts as an independent positive element in the context of a weak promoter. However, the positive effect of the Xba-Taq clone was only 18% of that of the intact core enhancer. The Taq-Xba clone exhibited CAT activity 15-fold higher than that of the control, which corresponds to 39% of the activity of the 147-bp core fragment. Thus, in the context of the -85 promoter, the combination of protein-binding sites within the Taq-Xba clone, which includes the C/EBP-binding site and the binding site for protein II, exerted a twofold stronger effect upon transcription than did the HNF-1-binding site (clone Xba-Taq). Surprisingly, the XbaCore clone that includes the binding sites for HNF-1, C/EBP, and protein I showed only a 6.4-fold enhancement of CAT activity in the forward orientation, which is less than that observed with the Xba-Taq clone that contains only the HNF-1-binding site. In the reverse orientation, the positive effect of the XbaCore clone was slightly assay

1144


MOL. CELL. BIOI..

B Taq +871

A

Taq +921

-898 CAT

Ln1 147

_952 E

+806

Xba - Taq

+875

Taq - Xba Xba Core

+876 +838

+903

Relative CAT Activity (HepG2) -85 CAT

S.D. F 2.6 + 0.3 R 1.7 : 0.2 F 1.1 t0.2

F

R 1.1 ±0.1 4 F 0.9 ± 0.1 4

F

N 4 4 4 R 1.0 ±0.1 4

S.D. N F 36.3 t0.7 4 7.2 t1.4 4

14.7 ±0.9 4 6.4 ±0.6 4 R 10.5 ±1.4 4

FIG. 9. Deletion analysis of the apoB core enhancer in HepG2 cells. (A) Map of the core enhancer (147) in which the location of the 97-bp footprint E is shaded. Locations of the HNF-1- and C/EBP-binding sites are indicated. Below this map are illustrated the three deletion clones of the core enhancer. Each deletion was cloned in either the forward (F) or reverse (R) orientation upstream of either the -898 or the -85 apoB promoter CAT plasmid and transiently transfected into HepG2 cells. (B) CAT activity relative to that of the promoter alone, whose activity was set to 1.0. S.D., standard deviation; N, number of independent transfections have already been defined. *, the orientation of this clone was not determined.

stronger (10.5-fold). This finding suggests that protein I alone does not contribute significantly to the activity of the enhancer, at least in the context of the -85 promoter. From these results, it may be concluded that combining the C/EBP-binding site with the binding sites for HNF-1 and protein I does not significantly augment the level of transcriptional activation obtained with the HNF-1-binding site alone. A corollary of this conclusion is that the binding site for protein II must contribute significantly to the activation potential of the core enhancer. This deduction is in agreement with the observation that the Taq-Xba clone exhibited the strongest positive effect on transcription from the -85 promoter. When two tandem copies of the enhancer region contained within XbaCore were inserted in reverse orientation upstream of the -898 promoter, CAT activity was increased by 1.8-fold (data not shown). In contrast, five copies of the enhancer segment contained within the XbaTaq clone exhibited almost no enhancer activity upon the -898 promoter (data not shown). Thus, the HNF-1 site alone cannot act as an enhancer even when multimerized, but it can do so when multimerized in combination with the binding sites for C/EBP and protein I. Five tandem copies of the enhancer sequences contained within the Taq-Xba clone increased CAT activity by 5.4-fold when placed upstream of the -898 promoter (data not shown), emphasizing the importance of cis-acting elements within this region of the core enhancer. Thus, the core enhancer contains a number of positive cis-acting elements, which can act independently when placed close to the transcription start site of a weak apoB promoter. However, all of these elements are necessary to obtain the full positive effect of the core enhancer in the context of the -85 promoter, and all are required to obtain any enhancer activity in the strong -898 promoter. Disruption of protein II binding affects enhancer activity. The experiments presented in Fig. 9 implicated the binding site for protein II as an important component of the enhancer. We assumed that the binding site for this protein lies within the footprinted region of the TaqI-XbaI fragment and made four-nucleotide substitutions and a one-nucleotide deletion in this region. The resulting clone was designated mutlI, and the sequence of the TaqI-XbaI fragment of this clone is shown together with the wild-type sequence in Fig. 10B. Binding of protein II to the TaqI-XbaI fragment from mutIl was reduced by more than 10-fold (Fig. 10A, lanes 1 and 5). Furthermore, this mutant TaqI-XbaI fragment was

unable to compete for the binding of protein II to the wild-type TaqI-XbaI fragment (lane 3). The effect of disrupting the protein II-binding site on the activity of the 147-bp core enhancer was tested by transient transfection of HepG2 cells (Fig. lOB). In the context of the strong -898 apoB promoter, enhancer activity was reduced by 70%, while in the context of the -85 apoB promoter, disruption of protein II binding reduced the activity of the core enhancer by 50%c. These results demonstrate that binding of protein II to the apoB core enhancer is essential for its activity. Furthermore, taken together with our previous results showing that disruption of HNF-1 and/or C/EBP binding also impaired enhancer activity, these data strongly suggest that protein II is the third component required for the full activity of the core enhancer.

DISCUSSION We have shown that the core region of the second-intron enhancer of the apoB gene is composed of the binding sites for nine liver nuclear proteins (Fig. 11). The well-characterized transcription factor HNF-1 binds to the very 5' end of the footprinted sequences, on the 5' half of a 20-bp palindrome. Mutations that prevented binding of HNF-1 showed that this factor is essential for the function of both the core enhancer and the 443-bp enhancer fragment. Deletion experiments showed that the HNF-1-binding site functioned synergistically with other protein-binding sites within the core enhancer. The C/EBP site along was not sufficient to elicit this synergistic effect; sequence elements containing the binding site for protein II were also required. The affinity of HNF-1 for the core enhancer site is at least 10-fold lower than its affinity for the strong HNF-1-binding site from the ,-fibrinogen promoter. This may explain why the HNF-1 site alone is unable to activate transcription at a distance from the -898 apoB promoter but acts synergistically with other DNA-binding proteins. However, it seems unlikely that protein-binding sites about 45 bp distant could have their synergistic effect by directly increasing the affinity of HNF-1 for this site. Our findings in this regard are reminiscent of what has been reported for HNF-1 activation of other genes. Activation of the o1-antitrypsin promoter by HNF-1 was shown to be dependent on another factor (LFA-1) that binds immediately upstream of the HNF-1 site (42). Similarly, it was recently reported that HNF-1 can activate transcription of the hepatitis B virus pre-SI promoter only when the

VOL. 12, 1992


A

Probe

Extract

TaqI

Taq I-Xba

Taq I-Xba

1145

TaqI

mut 11

+ 4+ _ _ BSAi

+

n

Competitor

Jo

r

cE:

x

x

_ o°

o

II HNF-1 DIMER

C/EBP DIMER (d) (or related protein) + proteins a,b,c,e,f

FIG. 11. Proposed arrangement of protein factors binding to the apoB core enhancer. The thick black line represents the 97-bp footprint of the core enhancer, and the locations of the cutting sites for TaqI are shown. HNF-1 (cross-hatched ellipses) and C/EBP (d) are shown binding as homodimers. The five other proteins (a, b, c, e, and f) that bind to the same or overlapping sites as does C/EBP are shown as shaded ellipses. The 3'-most 14 bp of the footprint are bound by protein II.

1

B

3

2

4

5

WT CGAACCTCCACCCCCTTCCTATTTACCTGACCT muttl

C

-GA

G-A-A

-898

Promoter

147 F 147 F mut 11

-85

Relative CAT S.D. N

Relative

Activity

Activity

CAT

S.D. N

2.6

-0.3

8

37.5

5.5

4

1.5

_0.1

6

17.6

- 2.5

4

FIG. 10. Effects of mutations in the binding site for protein II on binding of nuclear proteins and enhancer activity. (A) The TaqIXbaI fragment of the core enhancer was isolated from clone Pvu147F or from clone 147FmutII (TaqI-XbaI mutII) and end labeled with [a-32P]dCTP. Binding of unfractionated mouse liver nuclear extract to these probes was tested by the gel mobility shift assay. Some reaction mixtures contained unlabeled competitor DNA as indicated. (B) Sequence (+921 to +953) of the wild-type (WT) TaqI-XbaI fragment together with the point mutations and one-nucleotide deletion made in clone mutII. (C) Results of transient transfections of HepG2 cells with plasmids containing the core enhancer (147F) or the core enhancer containing mutations in the binding site for protein II (147FmutII) inserted upstream of the -898 apoB promoter segment or the -85 promoter segment. CAT activity is expressed relative to that of the promoter alone, whose activity was set to 1.0. S.D., standard deviation; N, number of independent transfections.

adjacent binding site for the ubiquitous transcription factor Oct-1 is occupied (59). In this case, it was clear that Oct-1 did not act by increasing the affinity of HNF-1 for its binding site. However, the HNF-1 site alone could activate the hepatitis B virus pre-Si promoter when it was placed 5 bp from the TATA box (10). It was therefore suggested (59) that HNF-1 has only a weak transcriptional activation domain, capable of activating transcription when placed close to the basal transcription machinery but requiring additional factors when the binding site is further upstream. In the case of the human C-reactive protein promoter, it was reported that HNF-1 that was bound at two low-affinity sites separated by

80 bp functioned synergistically to activate transcription (53). Cooperativity between trans-acting factors has been well documented by others (7, 13, 20, 36, 37, 49). Cooperativity could occur by two different mechanisms: cooperative binding to DNA or cooperative trans activation, in which two or more factors interact in such a way as to have a synergistic effect on some rate-limiting step in the assembly of the basal transcription complex. There is evidence that both of these mechanisms can operate. For example, the yeast transcriptional activator GAL4 was shown to bind cooperatively to its binding sites on DNA in vivo (20). However, GAL4 and the mammalian transcription factor ATF also exhibit synergistic activation of transcription when each of the factors is present at concentrations that ensure saturation of its binding sites (37). This finding provides indirect evidence for cooperative trans activation. Spl that is bound to a binding site in the promoter has been shown to act synergistically with six Spl-binding sites placed downstream of the reporter gene (13). Furthermore, Spl that is deficient in DNA binding could superactivate transcription, probably by the formation of multimeric Spl complexes that provide a more effective activation domain (13). Recently, these observations were extended to show that Spl bound to DNA at distant sites could self-associate by protein-protein interactions, thereby looping out the intervening DNA and concomitantly activating transcription cooperatively (52). The transcription factor HNF-1 is a divergent member of the homeodomain family of proteins (2, 19) and has been implicated in the liver-specific transcription of many genes (for a review, see reference 39). Although initially thought to be strictly liver specific, functional HNF-1 protein has also been detected at comparable levels in rat kidney (56) and in the human intestine-derived cell line CaCo-2 (4). HNF-1 mRNA is present at high levels in the kidney and intestine of rats and mice and in mouse stomach and rat spleen, as well as in the liver (2, 31, 56). In fact, none of the transcription factors that have been implicated in the transcription of liver-specific genes (C/EBP, HNF-1, HNF-3, and HNF-4) are expressed in a strictly liver-specific manner (56). This finding has led to the suggestion that liver-specific transcription requires the simultaneous expression of all these factors (and perhaps others). Furthermore, many of the genes that are considered to be liver specific are expressed in other tissues also. In the case of the apoB gene, the fact that HNF-1 is also expressed at high levels in the intestine suggests that it may contribute to apoB expression in that tissue.

1146


Our experiments identified a binding site for C/EBP, another factor implicated in liver-specific expression, within the core enhancer. Mutagenesis of this site showed that it also is important for the activity of the enhancer and that proteins binding here act synergistically with proteins bound at adjacent sites. In addition, the binding site for C/EBP overlaps at least partially with the binding sites for five other proteins. Three of these are related to C/EBP in that their binding is eliminated by competition with an oligonucleotide containing the binding site for C/EBP and by mutation of the C/EBP-binding site. The recent molecular cloning (1, 6, 9, 18, 43, 47, 54) of several mammalian transcription factors confirms that C/EBP is a member of a family of at least four proteins, designated C/EBP a, 1, 8, and crpl (6, 54), that can recognize the same binding site in DNA (54). The mouse protein C/EBP ,B (6) (also called AGP/EBP [9]) has a high degree of sequence similarity to C/EBP (hereafter referred to as C/EBP a) and, like C/EBP a, contains the leucine zipper dimerization motif. Proteins that are homologs of C/EBP a have been cloned from human (NF-IL6 [1]) and rat (LAP [181, IL-6DBP [47], and crp2 [54]) cells. All of these proteins appear to be positive transcriptional activators. NF-IL6 and IL-6DBP have been implicated as mediators of interleukin-6 signal transduction and bind to promoter elements of several acute-phase protein genes (1, 47). The third member of the family has been called C/EBP 8 (6) and is identical to the rat protein crp3 (54). Sequence comparisons show that crpl constitutes the fourth member of this family (54). Both C/EBP 1 and C/EBP 8 have been implicated as important in adipocyte differentiation (6). DBP is a liver-enriched factor that exhibits similarity to C/EBP in the basic region of the DNA-binding domain but lacks a leucine zipper (43). However, DBP is able to bind to the same sequence in the albumin promoter as does the C/EBP family of proteins, and expression of DBP in the liver follows a circadian rhythm (55). All members of the C/EBP family bind to DNA as dimers and are able to form heterodimers with each other. Indeed, all possible pairwise dimer interactions have been demonstrated in vitro (54). Furthermore, C/EBP a, C/EBP 1, and C/EBP 8 are all expressed in rat liver, albeit at different levels (54), and thus have the potential to form heterodimers in vivo. It therefore seems likely that the four related mouse liver proteins that bind to the C/EBP site of the apoB core enhancer are homo- or heterodimers of members of the C/EBP family. Clearly, only a single dimeric protein can bind to this site at any one time. Thus, in vivo there may be competition for binding to this site that could modulate, the activity of the enhancer. The function of proteins c and f, which are clearly distinct from the C/EBP proteins but appear to bind to overlapping sites, is unclear at this time. The results in Fig. 4 and 9 indicate that the mechanism of action of the enhancer may be different when it is placed close to the transcription start site of a weak apoB promoter than when it is placed at a distance from a strong apoB promoter. All the protein-binding sites in the core enhancer are required for significant transcriptional activation when the enhancer is 898 bp from the transcription start site of the strong apoB promoter. In contrast, individual protein-binding sites are able to function independently when placed 85 bp from the start site of a weak apoB promoter. Thus, a complex array of proteins bound to the core enhancer may be required to act cooperatively to enhance transcription at a distance.

MOL. CELL. BIOL.

ACKNOWLEDGMENTS We are indebted to Dirk Mendel and Gerald Crabtree for providing the mouse liver extract enriched for HNF-1, together with the ,3-28 oligonucleotide, the HNF-1 antiserum, and the HNF-1 expression plasmids. We also thank Robert Costa for the HNF-3A cDNA and oligonucleotide. This work was supported by Program Project grant HL41633 (to B.L.-W.) from the National Institutes of Health.

REFERENCES 1. Akira, S., H. Isshiki, T. Sugita, 0. Tanabe, S. Kinoshita, Y. Nishio, T. Nakajima, T. Hirano, and T. Kishimoto. 1990. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J. 9:1897-1906. 2. Baumhueter, S., D. B. Mendel, P. B. Conley, C. J. Kuo, C. Turk, M. K. Graves, C. A. Edwards, G. Courtois, and G. R. Crabtree. 1990. HNF-1 shares three sequence motifs with the POU domain proteins and is identical to LF-B1 and APF. Genes Dev. 4:372-379. 3. Blackhart, B. D., E. H. Ludwig, V. R. Pierotti, L. Caiati, M. A. Onasch, S. C. Wallis, L. Powell, R. Pease, T. J. Knott, M. L. Chu, R. W. Mahley, J. Scott, B. J. McCarthy, and B. LevyWilson. 1986. Structure of the human apolipoprotein B gene. J. Biol. Chem. 261:15364-15367. 4. Brooks, A. R., B. D. Blackhart, K. Haubold, and B. LevyWilson. 1991. Characterization of tissue-specific enhancer elements in the second intron of the human apolipoprotein B gene. J. Biol. Chem. 266:7848-7859. 5. Brunzell, J. D., A. D. Sniderman, J. J. Albers, and P. 0. Kwiterovich, Jr. 1984. Apoproteins B and A-I and coronary artery disease in humans. Arteriosclerosis 4:79-83. 6. Cao, Z., R. M. Umek, and S. L. McKnight. 1991. Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev. 5:1538-1552. 7. Carey, M., Y. S. Lin, M. R. Green, and M. Ptashne. 1990. A mechanism for synergistic activation of a mammalian gene by GAL4 derivatives. Nature (London) 345:361-364. 8. Carlsson, P., and G. Bjursell. 1989. Negative and positive promoter elements contribute to tissue specificity of apolipoprotein B expression. Gene 77:113-121. 9. Chang, C. J., T. T. Chen, H. Y. Lei, D. S. Chen, and S. C. Lee. 1990. Molecular cloning of a transcription factor, AGP/EBP, that belongs to members of the C/EBP family. Mol. Cell. Biol. 10:6642-6653. 10. Chang, H. K., B. Y. Wang, C. H. Yuh, C. L. Wei, and L. P. Ting. 1989. A liver-specific nuclear factor interacts with the promoter region of the large surface protein gene of human hepatitis B virus. Mol. Cell. Biol. 9:5189-5197. 11. Costa, R. H., D. R. Grayson, and J. E. Darnell, Jr. 1989. Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and al-antitrypsin genes. Mol. Cell. Biol. 9:1415-1425. 12. Costa, R. H., D. R. Grayson, K. G. Xanthopoulos, and J. E. Darnell, Jr. 1988. A liver-specific DNA-binding protein recognizes multiple nucleotide sites in regulatory regions of transthyretin, a1-antitrypsin, albumin, and simian virus 40 genes. Proc. Natl. Acad. Sci. USA 85:3840-3844. 13. Courey, A. J., D. A. Holtzman, S. P. Jackson, and T. Tjian. 1989. Synergistic activation by the glutamine-rich domains of human transcription factor Spl. Cell 59:827-836. 14. Courtois, G., S. Baumhueter, and G. R. Crabtree. 1988. Purified hepatocyte nuclear factor 1 interacts with a family of hepatocyte-specific promoters. Proc. Natl. Acad. Sci. USA 85:79377941. 15. Courtois, G., J. G. Morgan, L. A. CampbeUl, G. Fourel, and G. R. Crabtree. 1987. Interaction of a liver-specific nuclear factor with the fibrinogen and a,-antitrypsin promoters. Science 238:688-692. 16. Das, H. K., T. Leff, and J. L. Breslow. 1988. Cell type-specific expression of the human apoB gene is controlled by two cis-acting regulatory regions. J. Biol. Chem. 263:11452-11458. 17. Demmer, L. A., M. S. Levin, J. Elovson, M. A. Reuben, A. J. Lusis, and J. I. Gordon. 1986. Tissue-specific expression and

VOL. 12, 1992

developmental regulation of the rat apolipoprotein B gene. Proc.

Natl. Acad. Sci. USA 83:8102-8106. 18. Descombes, P., M. Chojkier, S. Lichtsteiner, E. Falvey, and U. Schibler. 1990. LAP, a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein. Genes Dev. 4:1541-1551. 19. Frain, M., G. Swart, P. Monaci, A. Nicosia, S. Stimpfli, R. Frank, and R. Cortese. 1989. The liver-specific transcription factor LF-B1 contains a highly diverged homeobox DNA binding domain. Cell 59:145-157. 20. Giniger, E., and M. Ptashne. 1988. Cooperative DNA binding of the yeast transcriptional activator GAL4. Proc. Natl. Acad. Sci. USA 85:382-386. 21. Goldstein, J. L., and M. S. Brown. 1977. The low-density lipoprotein pathway and its relation to atherosclerosis. Annu. Rev. Biochem. 46:897-930. 22. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051. 23. Gorski, K., M. Carneiro, and U. Schibler. 1986. Tissue-specific in vitro transcription from the mouse albumin promoter. Cell 47:767-776. 24. Graham, F. L., and A. J. van der Eb. 1973. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52:456-467. 25. Grayson, D. R., R. H. Costa, K. G. Xanthopoulos, and J. E. Darnell. 1988. One factor recognizes the liver-specific enhancers in al-antitrypsin and transthyretin genes. Science 239:786-788. 26. Herbomel, P., B. Bourachot, and M. Yaniv. 1984. Two distinct enhancers with different cell specificities coexist in the regulatory region of polyoma. Cell 39:653-662. 27. Johnson, P. F., W. H. Landschulz, B. J. Graves, and S. L. McKnight. 1987. Identification of a rat liver nuclear protein that binds to the enhancer core element of three animal viruses. Genes Dev. 1:133-146. 28. Kardassis, D., M. Hadzopoulou-Cladaras, D. P. Ramji, R. Cortese, V. I. Zannis, and C. Cladaras. 1990. Characterization of the promoter elements required for hepatic and intestinal transcription of the human apoB gene: definition of the DNA-binding site of a tissue-specific transcriptional factor. Mol. Cell. Biol. 10: 2653-2659. 29. Kardassis, D., V. I. Zannis, and C. Cladaras. 1990. Purification and characterization of the nuclear factor BAl. A transcriptional activator of the human apoB gene. J. Biol. Chem. 265:21733-21740. 30. Knott, T. J., S. C. Rail, Jr., T. L. Innerarity, S. F. Jacobson, M. S. Urdea, B. Levy-Wilson, L. M. Powell, R. J. Pease, R. Eddy, H. Nakai, M. Byers, L. M. Priestley, E. Robertson, L. B. Rall, C. Betsholtz, T. B. Shows, R. W. Mahley, and J. Scott. 1985. Human apolipoprotein B: structure of carboxyl-terminal domains, sites of gene expression, and chromosomal localization. Science 230:37-43. 31. Kuo, C. J., P. B. Conley, C. L. Hsieh, U. Francke, and G. R. Crabtree. 1990. Molecular cloning, functional expression, and chromosomal localization of mouse hepatocyte nuclear factor 1. Proc. Natl. Acad. Sci. USA 87:9838-9842. 32. Lai, E., V. R. Prezioso, E. Smith, 0. Litvin, R. H. Costa, and J. E. Darnell, Jr. 1990. HNF-3A, a hepatocyte-enriched transcription factor of novel structure is regulated transcriptionally. Genes Dev. 4:1427-1436. 33. Landschulz, W. H., P. F. Johnson, E. Y. Adashi, B. J. Graves, and S. L. McKnight. 1988. Isolation of a recombinant copy of the gene encoding C/EBP. Genes Dev. 2:786-800. 34. Levy-Wilson, B., and C. Fortier. 1989. The limits of the DNase I-sensitive domain of the human apolipoprotein B gene coincide with the location of chromosomal anchorage loops and define the 5' and 3' boundaries of the gene. J. Biol. Chem. 264:2119621204. 35. Levy-Wilson, B., L. Soria, E. H. Ludwig, M. Argyres, A. R. Brooks, B. D. Blackhart, W. Friedl, and B. J. McCarthy. 1991. A polymorphism in a region with enhancer activity in the second intron of the human apolipoprotein B gene. J. Lipid Res. 32:137-145.


1147

36. Lin, Y. S., M. F. Carey, M. Ptashne, and M. R. Green. 1988. GAL4 derivatives function alone and synergistically with mammalian activators in vitro. Cell 54:659-664. 37. Lin, Y. S., M. Carey, M. Ptashne, and M. R. Green. 1990. How different eukaryotic transcriptional activators can cooperate promiscuously. Nature (London) 345:359-361. 38. Ludwig, E. H., B. Levy-Wilson, T. Knott, B. D. Blackhart, and B. J. McCarthy. 1991. Comparative analysis of sequences at the 5' end of the human and mouse apolipoprotein B genes. DNA Cell Biol. 10:329-338. 39. Mendel, D. B., and G. R. Crabtree. 1991. HNF-1, a member of a novel class of dimerizing homeodomain proteins. J. Biol. Chem. 266:677-680. 40. Mendel, D. B., L. P. Hansen, M. K. Graves, P. B. Conley, and G. R. Crabtree. 1991. HNF-la and HNF-13 (vHNF-1) share dimerization and homeo domains, but not activation domains, and form heterodimers in vitro. Genes Dev. 5:1042-1056. 41. Metzger, S., T. Leff, and J. L. Breslow. 1990. Nuclear factors AF-1 and C/EBP bind to the human apoB gene promoter and modulate its transcriptional activity in hepatic cells. J. Biol. Chem. 265:9978-9983. 42. Monaci, P., A. Nicosia, and R. Cortese. 1988. Two different liver-specific factors stimulate in vitro transcription from the human otl-antitrypsin promoter. EMBO J. 7:2075-2087. 43. Mueller, C. R., P. Maire, and U. Schibler. 1990. DBP, a liver-enriched transcriptional activator, is expressed late in ontogeny and its tissue specificity is determined posttranscriptionally. Cell 61:279-291. 44. Paulweber, B., A. R. Brooks, B. P. Nagy, and B. Levy-Wilson. 1991. Identification of a negative regulatory region 5' of the human apolipoprotein B promoter. J. Biol. Chem. 266:2195621961. 45. Paulweber, B., and B. Levy-Wilson. 1991. The mechanisms by which a human apolipoprotein B gene enhancer and reducer interact with the promoter are different in cells of hepatic and intestinal origin. J. Biol. Chem. 266:24161-24168. 46. Paulweber, B., M. Onasch, B. P. Nagy, and B. Levy-Wilson. 1991. Similarities and differences in the regulatory elements at the 5' end of the human apolipoprotein B gene between hepatic and intestinal cells. J. Biol. Chem. 266:24149-24160. 47. Poli, V., F. P. Mancini, and R. Cortese. 1990. IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP. Cell 63:643-653. 48. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 49. Schuile, R., M. Muller, H. Otsuka-Murakami, and R. Renkawitz. 1988. Cooperativity of the glucocorticoid receptor and the CACCC-box binding factor. Nature (London) 332:87-90. 50. Sniderman, A., S. Shapiro, D. Marpole, B. Skinner, B. Teng, and P. O. Kwiterovich, Jr. 1980. Association of coronary atherosclerosis with hyperapobetalipoproteinemia [increased protein but normal cholesterol levels in human plasma low density (1) lipoproteins]. Proc. Natl. Acad. Sci. USA 77:604-608. 51. Steinberg, D., S. M. Grundy, H. Y. I. Mok, J. D. Turner, D. B. Weinstein, W. V. Brown, and J. J. Albers. 1979. Metabolic studies in an unusual case of asymptomatic familial hypobetalipoproteinemia with hypoalphalipoproteinemia and fasting chylomicronemia. J. Clin. Invest. 64:292-301. 52. Su, W., S. Jackson, R. Tjian, and H. Echols. 1991. DNA looping between sites for transcriptional activation: self-association of DNA-bound Spl. Genes Dev. 5:820-826. 53. Toniatti, C., A. Demartis, P. Monaci, A. Nicosia, and G. Ciliberto. 1990. Synergistic trans-activation of the human C-reactive protein promoter by transcription factor HNF-1 binding at two distinct sites. EMBO J. 9:4467-4475. 54. Williams, S. C., C. A. Cantwell, and P. F. Johnson. 1991. A family of C/EBP-related proteins capable of forming covalently linked leucine zipper dimers in vitro. Genes Dev. 5:1553-1567. 55. Wuarin, J., and U. Schibler. 1990. Expression of the liverenriched transcriptional activator protein DBP follows a stringent circadian rhythm. Cell 63:1257-1266.

1148


56. Xanthopoulos, K. G., V. R. Prezioso, W. S. Chen, F. M. Sladek, R. Cortese, and J. E. Darnell, Jr. 1991. The different tissue transcription patterns of genes for HNF-1, C/EBP, HNF-3, and HNF-4, protein factors that govern liver-specific transcription. Proc. Natl. Acad. Sci. USA 88:3807-3811. 57. Young, S. G. 1990. Recent progress in understanding apolipoprotein B. Circulation 82:1574-1594.

MOL. CELL. BIOL. 58. Zhang, H., R. Scholl, J. Browse, and C. Somerville. 1988. Double stranded DNA sequencing as a choice for DNA sequencing. Nucleic Acids Res. 16:1220. 59. Zhou, D. X., and T. S. B. Yen. 1991. The ubiquitous transcription factor Oct-1 and the liver-specific factor HNF-1 are both required to activate transcription of a hepatitis B virus promoter. Mol. Cell. Biol. 11:1353-1359.

StyI polymorphism in an enhancer region of the second intron of the apolipoprotein B gene in hyper- and hypocholesterolemic subjects.

DNaseI hypersensitive sites at the 3' end of the human apolipoprotein B gene.

Radioimmunoassay for human plasma apolipoprotein B.

Isolation and characterization of human Lp-B lipoprotein containing apolipoprotein B as the sole apolipoprotein.

EBP at the hepatitis B virus enhancer.

EBP binds to and transactivates the enhancer element II of the hepatitis B virus.

EBP beta) gene (CEBPB) maps to human chromosome 20q13.1.

The three carboxy-terminal amino acids of human interleukin-6 are essential for its biological activity.

Exclusion of linkage between the human apolipoprotein B gene and abetalipoproteinemia.

Tetranucleotide repeat polymorphism in the apolipoprotein B gene.

Proximal GATA-binding sites are essential for human HSD3B1 gene transcription in the placenta.

EBP gamma.

EBP).

Haplotype analysis of the human apolipoprotein B mutation associated with familial defective apolipoprotein B100.

Apolipoprotein B gene polymorphisms are associated with lipid levels in men of South Asian descent.

RAD25 (SSL2), the yeast homolog of the human xeroderma pigmentosum group B DNA repair gene, is essential for viability.

Apolipoprotein B mRNA editing: a new tier for the control of gene expression.

Pedigree and sib-pair linkage analysis suggest the apolipoprotein B gene is not the major gene influencing plasma apolipoprotein B levels.

The phosphorylated form of the enhancer-binding protein NTRC has an ATPase activity that is essential for activation of transcription.

Residues located on membrane-embedded flexible loops are essential for the second step of the apolipoprotein N-acyltransferase reaction.

Rat apolipoprotein B differs in solubility properties from human apolipoprotein B.

enhancer elements in the avian leukosis virus long terminal repeat enhancer.

Modification of the apolipoprotein B gene in HepG2 cells by gene targeting.

Alpha interferon suppresses hepatitis B virus enhancer activity and reduces viral gene transcription.