Rasby 0, Poledne R, Hjermann I, Tonstad S, Berg K, Leren TP. StyI polymorphism in an enhancer region of the second intron of the apolipoprotein B gene in hyper- and hypocholesterolemic subjects. Clin Genet 1992: 42: 217-223. The regulation of the human apolipoprotein (apo) B gene that plays a crucial role in lipid metabolism is apparently very complex, with multiple cis- and trans-acting regulatory factors. One of these factors is an enhancer region in the second intron. In this region a point mutation at position + 722 has been found that is detectable by the restriction enzyme StyI. The report of Levy-Wilson et al. (1991) could suggest that the mutant allele (abolished StyI site) is associated with hypocholesterolemia. To investigate further the possible effect of this mutation on plasma cholesterol levels, we have compared the frequency of the mutant allele between 206 hypercholesterolemicNorwegian or Czech subjects on one hand, and 165 hypocholesterolemic Norwegian or Czech subjects on the other hand. No significant difference in frequency was found between the hypercholesterolemic and the hypocholesterolemicgroups. This finding indicates either that the mutation at position +722 does not affect the enhancer activity or that this in virro enhancer activity is of little or no clinical significance. One of the Norwegian hypercholesterolemicsubjects who was of Czech descent possessed the apoB 3500 mutation that leads to defective binding of low density lipoprotein (LDL) to the LDL receptors. Haplotype analysis of the apoB gene in her family showed that the mutation-bearing allele was identical to that reported in other countries, indicating a common gene source.

Approximately 70% of plasma cholesterol is transported in low density lipoprotein (LDL) (Herbert et al. 1983), and a high level of LDL is a major risk factor for coronary heart disease (Grundy 1986). In humans, LDL is a metabolic product of very low density lipoprotein (VLDL). VLDL is synthesized by the liver and is assembled within hepatocytes before secretion into the space of Disse. Ultimately VLDL enters the circulation through the hepatic vein. In the blood the majority of VLDL is converted to IDLYof which approximately one half is further metabolized to LDL (Havel & Kane 1989a). VLDL contains apolipoprotein B (apoB) apolipoprotein E and the apolipoprotein Cs. The crucial role of apoB for the normal synthesis of VLDL is demonstrated by the absence of 'VLDL and other apoB-containing lipoproteins in the autosomal recessive disorder abetalipoproteinemia (Havel & Kane 1989b). The locus for the apoB gene is on chromosome

Oddveig Resby', Rudol Poledne', lngvu Hjermanns, Senna Tonstad', Kire Berg'.' and Trond P. Leren' 'Department of Medical Genetics. UllevAi Univer-

sity Hospital, Oslo, Norway, *Laboratory for

Atherosclerosis Research - IKEM, Prague, Czechoslovakia 3Departmentof Internal Medicine. uneva University Hospital. Oslo, 'Lipid Clinic, Rikshospitalet, Oslo and 'Institute of Medical Geneti, University of Oslo, Oslo, Norway

-

-

Key words apolipropmtein B cholesterol Czechs enhancers mutations Norwegians tranxriptional regulation

-

-

-

-

Trond P. Leren, Department of Medical Genetics, Ullevaal Hospital, fCl Box 1036 Blindern, N-0315 Oslo, Norway Received 26 May, revis@dversion received and accepted fM publication 9 July 1992

2 ( 2 ~ 2 3 )(Knott et al. 1985). The gene spans 43 kilobases (kb) consisting of 29 exons and 28 introns (Blackhart et al. 1986). The DNA sequences required for promoter activity have been shown by transfection experiments to be located within 261 bp immediately upstream of the transcriptional start site (Das et al. 1988, Carlsson & Bjursell 1989, Kardassis et al. 1990). The apoB gene contains a TATA box and a CAAT box within 60 bp upstream of the transcriptional start site (Blackhart et al. 1986). The transcriptional regulation of the apoB gene is apparently very complex with multiple cisacting positive and negative elements that bind several transcriptional regulatory factors (Das et al. 1988, Carlsson & Bjursell 1989, Levy-Wilson et al. 1988, Metzger et al. 1989, Scott 1990, Kardassis et al. 1992). Possibly, genetic variation within these elements could explain parts of the large variation seen in plasma cholesterol levels within a population. One of these cis-acting elements is an enhancer

217

Rssby et al.

element that is localized in a 443 bp fragment (positions +62 1 to + 1064) of the second intron (Brooks et al. 1991). This element has enhancer activity in transcriptionally active cells only, and may therefore play a role in the tissue specific regulation of apoB synthesis. The possibility of genetic variation within this element has been studied by Levy-Wilson et al. (1991). They employed a method based upon chemical cleavage of mismatched heteroduplexes to search for point mutations. They found an A - + G nucleotide substitution at position 722 that abolished a StyI restriction endonuclease cutting site. Groups of normal and hypocholesterolemic subjects were then examined with respect to this mutation. No mutants were found among 121 normal subjects, whereas 4 mutants were found among 5 1 hypocholesterolemic subjects (Levy-Wilson et al. 1991). The reported findings suggested the possibility of an association between absence of the StyI site and hypocholesterolemia. We report here the results of a study aimed at confirming or rejecting this notion. To this end, we have studied the frequency of the StyI variants in groups of hypercholesterolemic and hypocholesterolemic Norwegian or Czech subjects. The hypercholesterolemic subjects were also studied with respect to the missense mutation in codon 3500 of the apoB gene (CGG-CAG) that causes the genetic trait familial defective apoBlOO (FDB) (Soria et al. 1989).

+

for coronary heart disease. No differences were found between the subjects in the two groups with respect to body mass index or fasting insulin concentration. Dietary record analysis and fatty acid composition of triglycerides in VLDL were similar in the two groups. Of the 100 subjects in each group, 63 hypercholesterolemicand 83 hypocholesterolemic subjects were included in the study on the basis of availability of DNA. None of the hypercholesterolemic subjects had classical familial hypercholesterolemia (FH) or secondary hypercholesterolemia, and none of the hypocholesterolemic subjects had secondary hypocholesterolemia. The distribution of age and gender, as well as the serum lipid values, are shown in Table 1.

Analysis of Sty1 polymorphism at position +722 in the second intron of the apoB gene

The Norwegian series were the following: 69 hypercholesterolemic subjects referred to lipid-lowering treatment at the Lipid Clinic, Rikshospitalet, 75 hypercholesterolemic and 82 hypocholesterolemic healthy subjects recruited from an ongoing screening program for risk factors for coronary heart disease among 40-year-old subjects in Oslo. Because one of the 75 Norwegian hypercholesterolemic subjects was born in Czechoslovakia of Czech parents, she was excluded from association analysis between the StyI polymorphism and serum cholesterol levels. All other Norwegian subjects were Caucasians of Norwegian descent. The Czech subjects were selected from the project: “Genetic and Environmental Determination of Hypercholesterolemia”. This project was started in 1988 and has been described elsewhere (Pistulkova et al. 1991). In brief, total serum cholesterol was determined in 2000 Prague children aged 11-12. One hundred subjects with cholesterol values above the 95th percentile and 100 subjects with

The A+G mutation at position +722 in the apoB gene was searched for by cutting DNA, which had been amplified by the polymerase chain reaction (PCR), with the restriction enzyme StyI. DNA was extracted from white blood cells using a model 340A DNA extractor from Applied Biosystems Inc. (Foster City, CA). Four hundred nanograms of DNA were used for the PCR. The primers used to amplify a 534 bp fragment were those described by Levy-Wilson et al. (1991) (Primer .1:5’AATGTCAGCCTGGTCTGTCCAAGTA-3’, Primer 25’-TGAGTCCAGCTGCAGTGATGACAG-3’). The primers were synthesized on a model 38 IA DNA synthesizer from Applied Biosystems Inc. (Foster City, CA). A DNA Thermal cycler from Perkin Elmer Cetus (Emeryville, CA) was used for the PCR.The PCR was performed in the presence of 25 pmol of each primer, 200 pM dNTPs, 3% DMSO, 25 mM Taps-HCI, 50 mM KC1, 2 mM MgCI2, 1 mM dithiothreitol, (pH 9.3), using 2.5 U of Taq DNA polymerase (Boehringer Mannheim, Mannheim) in a final volume of 100 pl. After an initial denaturation of 7 rnin at 94”C, 30 cycles consisting of 2 min at 94”C, 1 rnin at 60°C and 2 min at 72°C were followed by a terminal extension for 10 rnin at 72°C. Twenty pl of the PCR products were incubated with 15-20 U of the restriction endonuclease StyI (New England Biolabs, Beverly, MA) under the conditions recommended by the manufacturer. The digests were analyzed by polyacrylamide gel (6%) electrophoresis (2 h, 150 V). The gels were stained with ethidium bromide and photographed. In the presence of the StyI site, the 534 bp fragment was

cholesterol values between the 5th and 10th percen-

cut into a 353 bp and a 181 bp fragment (Levy-

tile were recruited for investigation of risk factors

Wilson et a]. 1991).

Materials and methods Subjects

218

STY1 polymorphism in the APOB gene Table 1. Number. sex. mean age, total serum cholesterol, HDL GhOleSterOl, ttiglycerides (mmoVI) among hypercholesterolemic 01 hypocholesterdemic subjects from the Screening program of 40-year-old subjects in Oslo, patients from the Lipid Clinic at Rikshospitalet and f r m the study in Prague of Genetic and Environmental Determination of Hypercholesterolemia (MeaniSD). Also shown is the number of heterozygotes for the Sty1 polymorphism in intron 2 of the apoB gene Age (range)

Total serum cholesterol

HDL cholesterol

Heterozygotes for the Sty1 polymorphism

SeriedSource

Diagnosis

Sex

n

Screening program in Oslo

Hypercholesterolemia

Males Females Total

61 40 (40-40) 9.11 (a0.51) 14 40 (4040) 9.07 (i0.77) 75 40 (40-40) 9.11 (i0.56)

1.26 (i0.29) 1.49 (t0.25) 1.30 (i0.30)

Hypocholesterolemia

Males Females Total

45 40 (“lo) 3.36 (*0.29) 37 40 (4040) 3.22 (10.191 82 40 (40-40) 3.30 (10.26)

1.26 (a0.32) 1.02 (i0.49) 1.33 (i0.35) 0.77 (i0.32) 1.29 (~0.33) 0.91 (i0.44)

2 1 3 1 1 2

Lipid Clinic, Rikshospitalet

Hypercholesterdemiii

Males Females Total

49 44 (26-65) 7.94 (a1.01) 20 53 (26-74) 8.47 (i1.12) 69 47 (26-74) 8.10 (i1.06)

1.20 (*0.29) 1.50 (i0.32) 1.30 (t0.32)

1.90 (a1.07) 1.43 (zt0.70) 1.76 (i0.99)

0 0 0

The Prague Study

Hypercholesterolemiii

Males Females Total

28 11 (11-12) 5.28 (10.70) 35 11 (11-12) 5.22 (aD.73) 63 11 (11-12) 5.25 (i0.71)

1.51 (a0.37) 1.41 (zt0.31) 1.46 (i0.34)

0.97 (i0.39) 1.07 (i0.41) 1.02 (i0.40)

0 1 1

Hypocholesterdemia

Males

53 12 (11-12)

1.30 (*0.30) 1.33 (i0.30) 1.31 (10.30)

1.03 (i0.67) 0.92 (i0.43) 0.99 (i0.60)

0 I

3.66 (a0.70)

Fernales 30 If (11-12) 3.68 (a0.81) Total

83 11 (11-12)

Analysis of haplotype markers in the apoB gene

Nine haplotype markers in the apoB gene were analyzed in patients possessing mutant apoB alleles. The markers were: a 9 bp insertion/deletion polymorphism in the signal peptide (Boerwinkle & Chan 1989), a polymorphic ApaLI site in exon 4 (Young & Hub1 1989), polymorphic HincII and PvuII sites in intron 4 (Rajput-Williams et al. 1988), a polymorphic AluI site in exon 14 (Wang et al. 1988), polymorphic XbaI aind MspI sites in exon 26 (Soria et al. 1989), a polymorphic EcoRI site in exon 29 (Ludwig & McCarthy 1990), and a minisatellite length polymorphisim approximately 200 bp 3’ of the apoB structural gene (Huang & Breslow 1987, Ludwig et al. 1989). The nomenclature for classifying the different haplotypes was that of Ludwig & McCarthy (1990). Analysis of the apoB-3500 mutation (Arg+Gln)

Analysis of the 3500 mutation i n apoB was performed by PCR using a single prirner-template mismatch in the 5‘ primer, as described by Hansen et al. (1991). Introducing this mismatch, a MspI restriction site is created in the normal allele, but not in the 3500 mutation-bearing allele. With the 5’ primer encompassing nuc1eotid.e 10628 to 10657 and a C for T mismatch at position 10656 (5’CCAACACTTACTTGAATTCCAAGAGCAC~C3’) and the 3’ primer encompassing nucleotides 10747 to 10776 (5’-CTGTGCTCC:AGAGGGAATATATGCGTTGG-3’), a 149 bp fragment is amplified. The nuceotides were numbepred according to

3.66 (zt0.74)

Triglycerides

3.41 (i2.33) 1.47 (~0.96) 3.04 (~2.26)

1

Knott et al. (1986). In the mutation-bearing allele, but not in the normal allele, this fragment is cut into a 120 bp and a 29 bp fragment with the enzyme MspI. Following a polyacrylamide gel (1 2%) electrophoresis (80 V, overnight), the fragments were visualized by ethidium bromide staining. DNA sequencing

DNA sequencing of symmetric PCR templates was performed using a Model 373A Automated DNA Sequencer from Applied Biosystems Inc. (Foster City, CA). Two PCRs using nested primers were used to ensure specific amplification and significant amounts of the desired fragment. The first PCR had a higher annealing temperature than the second. For the second PCR, 1 pi of the products from the first PCR was used as the template. The 5’ primer in the second PCR had at its 5’ end the sequence for the -21M13 universal primer. For the first PCR, the 5‘ primer was B10388 (5’TATGGAAGTGTCAGTGGCAA-3’) encompassing nucleotides 10388-10421, and the 3’ primer was 6 Msp I (5’-CTAAGGATCCTGCAATGTCA AGGT-3‘) encompassing nucleotides 11 124-11101. The PCR reaction mixture contained 5 pmol of each primer, 1 U Taq DNA polymerase, 200 pM dNTPs, 25 mM Taps-HC1, 50 mM KCI, 2 mM MgC12, 1 mM dithiothreitol (pH =9.3) in a volume of 100 p1. Initial denaturation for 7 min at 94°C was followed by 25 cycles of 2 min at 94”C, 1 min at 50°C and 2 min at 72°C before a 10-min terminal extension at 72°C. One p1 of the reaction products was used as the template for the second 219

Resby et al.

PCR. The 5’ primer used for the second PCR containing a -21M 13 tail at its 5’ end, was 4-3500 M13 (5’-TGTAAAACGACGGCCAGTTCTCGGGAA TATTCAGGAACTATTG-3’)encompassing nucleotides 10644-10668, and the 3‘ primer was 5-3500

A

(S’-GTGCTCCCAGAGGGAATATATGCGT-3’)

encompassing nucleotides 10823-10799. The second PCR reaction mixture contained 25 pmol of each primer, 2.5 U Taq DNA polymerase, 200 pM dNTPs, 25 mM Taps-HC1, 50 mM KCI, 2 mM MgCI2, 1 mM dithiothreitol (pH = 9.3) in a volume of 100 pl. Initial denaturation for 7 min at 94°C was followed by the same thermal cycling as the first PCR, except for the annealing step, which was carried out at 43°C for 1 min. Before DNA sequencing was started, 20 pl of the reaction products were analyzed in an ethidium bromide-stained agarose gel to verify the presence of a distinct band of the correct size and the absence of non-specific bands. The remaining 80 pl of the PCR products were then diluted by adding 2 ml ddHzO before dNTPs and primers were removed by ultrafiltration (Centricon 100, Amicon, Beverly, MA). Of the approximately 100 pl concentrate, 1 pl was used for the A and C tracks and 2 pl were used for the G and T tracks. The cycle-sequencing protocol using Taq DNA polymerase and dye primers (-21M13) was as recommended by the manufacturer (Applied Biosystems tnc., Foster City, CA). Serum lipid analyses

Total cholesterol, high density lipoprotein (HDL) cholesterol and triglycerides were analyzed in serum by standard enzymatic methods. Only nonfasting values for serum lipids were available for the 40-year-old Norwegians who were recruited through the screening program for risk factors for coronary heart disease in Oslo. All other samples were drawn after an overnight fast.

Results Test for association between the Sty1 polymorphism in the apoB gene and serum cholesterol levels

Among the Norwegian adults, 3 out of 143 hypercholesterolemic subjects and 2 out of 82 hypocholesterolemic subjects were heterozygous for the StyI site, suggesting a frequency of the mutant allele of 1.1% and 1.2%, respectively. Among the Czech children, 1 out of 63 hypercholesterolemic subjects and 1 out of 83 hypocholesterolemic subjects were heterozygous for the StyI site, suggesting a frequency of the mutant allele of 0.8% and O.6%, respectively. Combining the Norwegian and Czech subjects, the gene frequency of the allele with the 220

6 1-1 1-2 11-1 11-2 11-3 Hrplotypm 1 9 4 1 -48

.I. .I. .I. .I. .I. +

*I*

-I-

.I.

-1. -1-

4 . .I. .I.

+

-I- -I-I- -1. -I- -1. -I- -1-I- -I-

-1. -1.

-

-

-

-I- .I. -I. .I. -I* .I.

-I- 48140

-I- .I.

-I- 48146 -I- 48/46 46

-I-

-

4 . +

-I* 46130 -I. 3a140

-

Fig. I. Haplotype marker analyses at the apoB locus. Localization of 9 haplotype markers at the apoB locus. Fig. la shows the haplotype marker analyses of the apoB gene among the seven subjects possessing the mutation at +722 of the second intron of the apoB gene. Fig. I b shows the haplotype analysis of the apoB gene in the family possessing the apoB 3500 mutation. The subject numbers in Fig. I b refer to the pedigree in Fig. 2.

absent StyI site among the hypercholesterolemic and hypocholesterolemic subjects was 414 12 (0.97%) and 3/330 (0.9%), respectively (X2=0.01, I d.f., p=0.93). Haplotype marker analysis at the apoB locus

Complete haplotype analysis could not be undertaken because DNA from relevant family members was not available. Instead, 9 haplotype markers

wI ::::

I 1.111 a w m a c k o l n t c r r l HDL c b o l t r t c r d

::ti

Trlg1gcctrid.s

2.09

1.71

II TnW =rum cholrrhrol ROL shlrrhrol Trigi~*rldea

6.11

9.31

1.31 1.53

1.07

-

8.50 1.52 0.69

c

Fig. 2. The apoB 3500 mutation in a Czech family. A 149

bp fragment encompassing codon 3500 of the apoB gene was amplified and digested with the restriction enzyme MspI. In the presence of the mutation of codon 3500, the fragment is cut into two Fragments of 120 bp and 29 bp, of which only the former is visible. The half-filled symbols represent those possessing the mutant allele. C (control) represents the plasmid p43 (Soria et al. 1989) that was used as a positive control.

STYI polymorphism in the APOB gene were analyzed to determine ii: the haplotype of the mutation-bearing allele was consistent with the deduced haplotype 251 / 15-30 (Ludwig & McCarthy 1990) found by Levy-Wilson et al. (1991). The results of this haplotype marker analysis are shown in Fig. la, and are consistent with the haplotype 251/15-30 of the mutation-bearing allele in all 7 subjects.

Family studies showed that her father and one of her brothers also possessed this mutation (Fig. 2). Haplotype analysis of the apoB gene using 9 haplotype markers reveakd that the 3500-mutationbearing allele in all three subjects was 194/-48 (Fig. lb). Discussion

The 143 Norwegian and 65 Czech hypercholesterolemic subjects were also screened for the apoB 3500 (Arg+Gln) mutation by a PCR method. One of the Norwegian subjects possessed the 3500 mutation (Fig. 2), and this was confirmed by DNA sequencing of symmetric PCR products (Fig. 3). This subject was a 47-year-old female of Czech descent who had been excluded from analysis of the association between the StyI polymorphism and serum cholesterol levels amon,g the Norwegians. Her lipid and apolipoprotein values were: total serum cholesterol: 7.41 mmol/l, triglycerides: 0.62 mmol/l,HDL cholesterol: 1.35; mmol/l, apolipoprotein B: 139 mg/ 100 ml, apol.ipoprotein AI: 138 mgl100 ml and Lp(a) lipoprotein: 9.0 mg/ 100 ml.

In this study we have analyzed the polymorphic StyI site in a 443 bp enhancer fragment of the second intron of the apoB gene, to investigate a suggested association between the mutant allele (abolished StyI site) and low serum cholesterol levels. Comparisons were made between a total of 206 hypercholesterolemic, non-FH subjects and 165 hypocholesterolemic subjects. In the total series, the frequency of the mutant allele was 0.97% among the hypercholesterolemic subjects and 0.9% among the hypocholesterolemic subjects. These frequencies were not significantly different. No difference between the Norwegian and Czech series was observed. Therefore, our study does not confirm the suggested association between absence of the StyI site and hypocholesterolemia (Levy-Wilson et al. 1991). There could be several explanations for this. Be-

A

B

Frequency of the apoB 3500 mutatiori in hypercholesterolemic subjects

1

Fig. 3. Sequencing of a codon 3500-containing fragment of the apoB gene. A symmetric 179 bp PCR product encompassing codon 3500 was sequenced from the normal subject 11-1 in Fig. 2 (A) and from subject 11-3 in Fig. 2 possessing the apoB 3500 mutation as determined by the PCR-MspI screening assay. Note the heterozygosity of subject 11-3 at codon 3500 (CGG+CAG). An N is assigned by the computer software to indicate heterozygosity.

22 1

Rmby et al. cause of the low frequency of the mutant allele, the sample size in this study might have been too small. Even though the StyI polymorphism does not itself affect lipid level, it could possibly be in linkage disequilibrium with functionally important domains. However, since our extensive haplotype marker analysis of the apoB gene was consistent with the Norwegian and Czech mutation-bearing alleles, being identical to that observed in Austrian subjects (Levy-Wilson et al. 1991), this explanation is unlikely. Among Austrian subjects no mutant alleles were observed among 121 normocholesterolemic subjects, whereas 3 out of 11 hypocholesterolemic subjects possessed the mutant allele (LevyWilson et al. 1991). One plausible possibility is that the StyI polymorphism does not actually have any impact on VLDL and thereby LDL synthesis. Although the StyI polymorphism at position +722 is located within a 443 bp fragment that has in v i t m enhancer activity, the majority of this enhancer activity is confined to the down-stream region between nucleotides +806 to +952 (Brooks et al. 1991) that has been shown to contain four distinct proteinbinding sites (Brooks & Levy-Wilson 1992). Furthermore, the A-+G transition does not affect the binding of nuclear proteins as determined by gel retardation assays (Levy-Wilson et al. 1991). These in vztro data are also consistent with our findinzs that the abolished StyI site is not associated with hypocholesterolemia. It seems possible that the discrepancy between the frequency of the abolished Sty1 site among Austrian hypocholesterolemic subjects on one hand and Norwegian and Czech subjects on the other hand, is due to a chance occurrence because of the small sample size of Austrian hypocholesterolemic subjects in the study of LevyWiIson et al. (1991). Although expression of the human apoB gene is controlled in a tissue-specific manner and regulation of tissue-specific gene expression is generally controlled at the level of transcription, there are data indicating that this may not be the case for the apoB gene. Pullinger et al. (1989), who studied the synthesis of apoB in rat hepatocytes and HepG2 cells, found that oleate enhanced apoB secretion 3 4 fold without changing the apoB m-RNA level. Neither was the 50-75% reduction in apoB secretion by insulin and albumin associated with changes in the apoB m-RNA level. Their finding that the half-life of apoB m-RNA is in excess of 16 h may suggest that the short-term regulation of the apoB secretion is not regulated through a change in transcription of the apoB gene or in the stability of m-RNA. Similar conclusions have also been reached by Davidson et al. (1988). These observations are consistent with the notion that apoB 222

is constitutively expressed, and that differences in apoB secretion must be due to co-translational or post-translational processes as suggested by Pullinger et al. (1989). There is also evidence that the rate of intracellular degradation of newly synthesized apoB may be one of the post-translational processes by which the secretion of apoB is regulated (Bostram et al. 1988, Borchardt & Davis 1987). Furthermore, these data may suggest that mutations in the apoB gene, leading to decreased synthesis of VLDL, predominantly affect the intracellular processing of apoB, rather than affecting the transcription. Our study has also shown the existence of the apoB 3500 mutation in the Czech population. Haplotype analysis of the apoB gene in the Czech family was consistent with the mutation being on the same haplotype as found for other FDB patients (Ludwig & McCarthy 1990). These findings therefore indicate a common gene source for the apoB 3500 mutation. The Czech proband had inherited the mutation from her father. Somewhat surprisingly, however, the father had normal values for total serum cholesterol, while the proband’s mother had been diagnosed as having polygenic hypercholesterolemia. Previously, a wide variation has been found in total serum cholesterol among FDB patients. In one study, total serum cholesterol was found to range between 7.1 mmol/l and 13.6 mmol/l (TybjargHansen et al. 1990). As demonstrated by the proband’s father, FDB patients may in fact have completely normal values for total serum cholesterol. None of the 145 hypercholesterolemic Norwegian subjects possessed the apoB 3500 mutation. This finding indicates that this mutation must be a relatively rare cause of hypercholesterolemia in Norway. Acknowledgements This work was supported by grants from The Fndtjof Nansen Foundation for the Advancement of Science, The Norwegian Research Council on Cardiovascular Diseases, The Norwegian Research Council for Science and the Humanities and Anders Jahre’s Foundation for the Promotion of Science.

References Blackhart BD, Ludwig EM, Pierotti VR, Caiati L, Onasch MA, Wallis SC, Powell L, Pease R, Knott TJ, Chu M-L, Mahley RW, Scott J, McCarthy BJ, Levy-Wilson B. Structure of the human apolipoprotein B gene. J Biol Chem 1986: 262: 1536P15367.

Boenvinkle E, Chan L. A three codon insertion/deletion polymorphism in the signal peptide of the human apolipoprotein B (apoB) gene directly typed by the polymerase chain reac-

tion. Nucleic Acids Res 1989: 17: 4003. Borchardt RA, Davis RA. Intrahepatic assembly of very low

STY1 polymorphism in the APOB gene density lipoproteins: rate of transport out of the endoplasmatic reticulum determines rate ofscxretion. J Biol Chem 1987: 262: 16394-1 6402. Bostrram K, Boren J, Wettesten M, Sjnrt~rgA, Bondjers G, Wiklund 0. Carlsson P, Olofsson SO. Studies on the assembly of apoB-I00 containing lipoproteins in HepG2 cells. J Biol Chem 1988: 263: 44344442. Brooks AR, Blackhart BD, Haubolt K, L,evy-Wilson B. Characterization of tissue-specific enhancer elements in the second intron of the human apolipoprotein E; gene. J Biol Chem 1991 : 266: 7848-7859. Brooks AR, Levy-Wilson B. Hepatocyte nuclear factor 1 and C/EBP are essential for the activity of the human apolipoprotein B gene second-intron enhancer. Mol Cell Biol 1992: 12: 1134-1 148. Carlsson P, Bjursell G. Negative and positive promotor elements contribute to tissue specificity of apolipoprotein B expression. Gene 1989: 77: 1 13-1 21. Das HK, Leff T, Breslow JL. Cell type-specific expression of the human apoB gene is controlled by two cis-acting regulatory regions. J Biol Chem 1988: 263: I 1452- I 1458. Davidson NO, Drewek MJ, Gordon JI. Elovson J. Rat intestinal apolipoprotein B expression: evidence for integrated regulation by bile salt, fatty acid, and phospholipid flux. J Clin Invest 1988: 82: 300-308. Grundy S. Cholesterol and coronary heart disease. J Am Med ASSW 1986: 2 5 6 2849-2858. Hansen PS, Riidiger N. Tybjaerg-Hansen A. Faergeman 0,Gregersen N. Detection of the apoB-3500 mutation (glutamine for arginine) by gene amplification and cleavage with MspI. J Lipid Res 1991: 32: 1229-1233. Havel RJ, Kane JP. Structure and metabolism of plasma lipoproteins. In: Scriver C, Beaudet A, Sly WS, Valle D, eds. The metabolic basis of inherited disease, 6th ed. New York: McGraw-Hill 1989a: 1119-1 138. Havel RJ, Kane JP. Disorders of the biogenesis and secretion of lipoproteins containing the B apoliproproteins. In: Scriver C, Bedudet A, Sly WS, Valle D. eds. The metabolic basis of inherited disease, 6th ed. New York: bIcGraw-Hill, 1989b: 1139-1 164. Herbert P, Assmann G. Gotto AM, Frcdrickson DS.Familial lipoprotein deficiency: abetalipoproteiriemia, hypobetalipoproteinemia and Tangier disease. In: Stanbury JB, Wyngaarden JB, Fredrickson DS. Goldstein JL. Brown MS. eds. The metabolic basis of inherited disease, 5th ed. New York: McGraw-Hill, 1983: 589-621. H u n g LS, Breslow JL. A unique AT-rich hypervariable minisatellite 3’ to the apoB gene defines a high information restriction fragment length polymorphism. J 13iol Chem 1987: 262: 8952-8955. Kardassis D, Hadzopoulou-Cladaras M. Ramji DP, Cortese R, Zannis VI, Cladaras C. Characterization of the promoter elements required for hepatic and intestinal transcription of the human apoB gene: definition of the DNA-binding site of a tissue specific transcriptional factor. Mol Cell Biol 1990: 10: 2653-2659. Kardassis D, Zannis VI, Cladaras C. Organization of the regulatory elements and nuclear activities participating in the transcription of the human apolipoprotein B gene. J Biol Chem 1992: 267: 2622-2632. Knott TJ, Rall SC, lnnerarity TL, Jacobson SF, Urdea MS, Levy-Wilson B, Powell LM, Pease RJ, Eddy R, Nakai H,

Byers M, Priestly LM, Robertson E, Rall LB, Betsholtz C, Shows TB, Mahley RW, Scott J. Human apolipoprotein B: structure of carboxyl-terminal domains, sites of gene expression, and chromosomal localization. Science 1985: 230: 37-43. Knott TJ, Wallis SC, Powell LM, Pease RJ, Lusis AJ, Blackhart B, McCarthy BJ. Mahley RW, Levy-Wilson 8, Scott J. Complete cDNA and derived protein sequence of human apolipoprotein B-100. Nucleic Acids Res 1986: 1 4 7501-7503. Levy-Wilson B, Fortier C, Blackhart BD. McCarthy BJ. DNasel- and micrococcal nuclease-hypersensitivitysites in the human apolipoprotein B gene are tissue specific. Mol Cell Biol 1988: 8: 71-80. Levy-Wilson B. Soria L, Ludwig EH. Argyres M, Brooks AR. Blackhart BD, Friedl W, McCarthy BJ. A polymorphism in a region with enhancer activity in the second intron of the human apolipoprotein B gene. J Lipid Res 1991: 32: 137-145. Ludwig EH, Friedl W, McCarthy BJ. High-resolution analysis of a hypervariable region in the human apolipoprotein B gene. Am J Hum Genet 1989 45: 458-464. Ludwig EH, McCarthy BJ. Haplotype analysis of the human apolipoprotein B mutation associated with familial defective apolipoprotein B100. Am J Hum Genet 1990: 47: 712-720. Metzger S, Leff T, Breslow JL. Nuclear factors AF-I and C / EBP modulate apoB transcriptional activity in hepatic cells. Circulation 1989 80 (suppl. 11): 11-265. Pistulkovi H, Poledne R, Kaucka J, Skodova Z. Petrzilkovh Z, Pdclt M, Valenta Z. Grafnetter D, Pisa M. Cholesterolemia in school-age children and hypercholesterolemia aggregation in the family. Cor Visa 1991: 33: 139-149. Pullinger CR, North JD. Teng BB, Rifici Va, Ronhild de Brito AE. Scott J. The apolipoprotein B gene is constitutively expressed in HepG2 cells: regulation of secretion by oleic acid, albumin and insulin, and measurement of the m-RNA half-life. J Lipid Res 1989: 3 0 1065-1077. Rajput-Williams J, Knott TJ, Wallis SC, Sweetnam P. Yarnell J, Cox N. Bell GI, Miller NE, Scott J. Variation of apolipoprotein-B gene is associated with obesity, high blood cholesterol levels, and increased risk of coronary heart disease. Lancet 1988: ii: 1442-1446. Scott J. Regulation of the biosynthesis of apolipoprotein BlOO and apolipoprotein 848. Curr Opinion Lipidol 1990: I: 96103. Soria LF, Ludwig EH, Clarke HRG. Vega GL, Grundy SM, McCarthy BJ. Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100. Proc Natl Acad Sci USA 1989: 86: 587-591. Tybjzrg-Hansen A, Gallagher J, Vincent J, Houlston R, Talmud P, Dunning AM, Seed M, Hamsten A. Humphries S, Myant NB. Familial defective apolipoprotein B-100: detection in the United Kingdom and Scandinavia, and clinical characteristics of ten cases. Atherosclerosis 1990: 80: 235-242. Wang X,Schlapfer Y, Ma R, Biitler R, Elovson J, Schumaker VN. Appolipoprotein B: the Ag(a, Id) immunogenetic polymorphism coincides with a T-to-C substitution at nucleotide 1981, creating an AluI restriction site. Arteriosclerosis 1988: 8: 429435. Young SG,Hub1 ST.An ApaLI restriction site polymorphism is associated with the MB19 polymorphism in apolipoprotein B. J Lipid Res 1989: 3 0 443449.

223