J O U RN A L OF E N V I RO N ME N TA L S CIE N CE S 3 1 (2 0 1 5) 9 8– 1 0 3
Available online at www.sciencedirect.com
ScienceDirect www.journals.elsevier.com/journal-of-environmental-sciences
IKK inhibition prevents PM2.5-exacerbated cardiac injury in mice with type 2 diabetes Jinzhuo Zhao1,2 , Cuiqing Liu3 , Yuntao Bai2,3 , Tse-yao Wang2,3 , Haidong Kan1 , Qinghua Sun2,3,⁎ 1. Department of Environment Health, School of Public Health and the Key Laboratory of Public Health Safety, Fudan University, Shanghai 200032, China 2. Division of Environmental Health Sciences, College of Public Health, The Ohio State University, Columbus, OH, USA 3. Davis Heart and Lung Research Institute, The Ohio State University Wexner Medical Center, Columbus, OH, USA
AR TIC LE I N FO
ABS TR ACT
Article history:
Epidemiological studies have found that individuals with diabetes mellitus (DM) display an
Received 14 August 2014
increased susceptibility for adverse cardiovascular outcomes when exposed to air pollution.
Revised 11 October 2014
This study was conducted to explore the potential mechanism linking ambient fine
Accepted 24 October 2014
particles (PM2.5) and heart injury in a Type 2 DM (T2DM) animal model. The KKay mouse, an
Available online 25 March 2015
animal model of T2DM, was exposed to concentrated ambient PM2.5 or filtered air for 8 weeks via a versatile aerosol exposure and concentrator system. Simultaneously, an
Keywords:
inhibitor of IκB kinase-2 (IKK-â) (IMD-0354), which is a blocker of nuclear factor κB (NF-κB)
Fine particles
nuclear translocation, was administrated by intracerebroventricular injection (ICV) to
Cardiovascular diseases
regulate the NF-êB pathway. The results showed that ambient PM2.5 induced the increase
Diabetes mellitus
of, NF-êB, cyclooxygenase-2 (COX-2) and mitogen activated protein kinase (MAPK) expression
NFκB
in cardiac tissue, and that IMD-0354 could alleviate the inflammatory injury. The results suggested that the NF-êB pathway plays an important role in mediating the PM2.5-induced cardiovascular injury in the T2DM model. Inhibiting NFκB may be a therapeutic option in air-pollution-exacerbated cardiovascular injury in diabetes mellitus. © 2015 The Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences. Published by Elsevier B.V.
Introduction Air pollution has been shown to be directly associated with the increase of cardiopulmonary deaths in highly polluted urban settings (Simkhovich et al., 2007). It has been suggested that air pollution may contribute to the development of chronic conditions. Air pollution has become a major risk factor for acute cardiovascular events, hypertension and diabetes mellitus (Brunekreef and Holgate, 2002). Type 2 diabetes mellitus (T2DM) is recognized as one of the key risk
factors in the development of cardiovascular disease (CVD) (Wang et al., 2006). Previous study recognized that diabetics exposed to air pollution are more susceptible to the development of cardiac dysfunction, although the underlying mechanisms remain unclear (Schaffer et al., 1997; Sunyer et al., 2003). Individuals with DM are more prone to develop adverse cardiovascular outcomes, and the outcomes are related to acute air pollution exposure (Bateson and Schwartz, 2004; Dubowsky et al., 2006; Zanobetti and Schwartz, 2001). Diabetic-related heart disease has become an important risk factor threatening people's health (Shen et al., 2004).
⁎ Corresponding author. E-mail: [email protected] (Qinghua Sun).
http://dx.doi.org/10.1016/j.jes.2014.10.018 1001-0742/© 2015 The Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences. Published by Elsevier B.V.
J O U RN A L OF E N V I RO N ME N TA L S CI EN CE S 3 1 (2 0 1 5 ) 9 8– 1 0 3
Particulate matter, especially ≤ 2.5 μm in aerodynamic diameter (PM2.5), is one of the most important air pollutants. PM2.5 is of concern to human health as it can deposit in the lower airways and gas-exchanging portions of the lung, even potentially reaching the circulatory system (Nemmar et al., 2002). Exposure to PM2.5 has been consistently linked to cardiovascular morbidity and mortality (Franchini and Mannucci, 2012). The association between ambient PM2.5 and cardiovascular disease and DM has been explored in some epidemiological (Goldberg et al., 2001; O'Neill et al., 2007) and experimental (Xu et al., 2011; Yan et al., 2011) studies. However, it remains unclear whether exacerbation of cardiac injury is an adverse outcome of PM2.5 in DM. Inflammation is a key pathway leading to atherosclerosis and subsequent adverse cardiovascular events (Ballantyne and Entman, 2002). Inflammation may be one possible mechanism linking PM2.5 and cardiovascular disease (Franchini and Mannucci, 2012) and DM (Schneider et al., 2010). However, there is no clear mechanism that has been defined to explain the potential link between PM2.5 and cardiac injury in DM. Evidence has supported that NFκB activation is prominent in damaged kidneys or dysfunctional hearts, with up-regulation of p65 mRNA and increased NFκB binding activity (Gupta et al., 2005; Maulik et al., 1998). Previous studies also demonstrated that inflammatory response was associated with the exacerbation of insulin resistance and inflammatory response in mice exposed to ambient PM2.5 (Liu et al., 2014). Moreover, inactivation of IκB kinase or blocking of TNF-α can protect against defective thermogenesis, obesity and insulin resistance (Zhang et al., 2008). In this study, we suggested that inhalation of concentrated PM2.5 would result in the occurrence of cardiac inflammation in a genetically susceptible mouse model of T2DM. In addition, we suggested that NFκB may mediate the inflammatory response in PM2.5-induced cardiac injury. Meanwhile, NFκB could exacerbate cardiac injury through mediating the expression of cyclooxygenaze-2 (COX-2) and mitogen-activated protein kinases (MAPK).
99
(the mice were exposed to concentrated PM2.5 and treated i.c.v with DMSO); and PMT (the mice were exposed to concentrated PM2.5 and treated i.c.v with IMD-0354). Animal exposure was performed as previously described (Sun et al., 2009). The mice in the FAC and FAT groups inhaled the FA (the air was filtered of PM2.5 and the concentration of PM2.5 in the control contained virtually no PM2.5). In contrast, the mice in the PMC and PMT groups inhaled the concentrated PM2.5 (the exposure device could concentrate the ambient PM2.5, and the concentration of PM2.5 in the exposure groups was 10 times higher than ambient PM2.5). The detailed treatment methods were as follows: The mice were exposed to PM2.5 or FA for 6 hr/day, 5 day/week, 8 weeks in a near-road exposure system (“Ohio Air Pollution Exposure System for Interrogation of Systemic Effects” located at Polaris in Columbus). Simultaneously, the mice were treated i.c.v with IMD-0354 or DMSO for 6 hr/day, 5 day/week, 8 weeks.
1.3. Intracerebroventricular (ICV) drug infusion ICV surgery was performed on the mice for drug infusion. A stereotaxic apparatus was used to implant a cannula into the right lateral ventricle of mice anesthetized with 2% isoflurane in air. Cannula positions were + 0.02 posterior and − 0.95 lateral to Bregma, extending 2.75 mm below the skull (Plastics One, Roanoke, VA). The cannula was connected via tubing to an Alzet minipump (Model 1004, Durect, Cupertino, CA) that was implanted subcutaneously in the scapular region and delivered either vehicle (DMSO) or IMD-0354 (Sigma), both at a rate of 0.11 μL/hr. The IMD-0354-treated groups received a total of 600 ng of the inhibitor per day.
1.4. Sample collection At the end of the exposure, the cardiac tissue of mice was collected for further analysis. The heart tissue of mice was stored at − 80°C for real time PCR (RT-PCR) and Western blot detection.
1. Materials and methods
1.5. Real-time PCR
1.1. Animals and animal care
Real time-PCR was performed using RNA extracted from cardiac tissue of the mice. Total RNA from cardiac tissue was isolated with Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. cDNA was reversely transcribed using a High Capacity cDNA Transcription kit (Applied Biosystems, Carlsbad, California, USA). Gene expression for GAPDH, TNF-α, IL-6, COX-2, MAPK, IKK-β and NFκB was determined using inventoried primer and probe assays (Applied Biosystems, Foster City, CA) on an ABI 7500 Fast Real Time PCR System using Taqman® Universal PCR Master Mix. The universal two-step real-time PCR cycling conditions used were: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. The 2−△△CT method (Livak and Schmittgen, 2001) was used to normalize transcription to GAPDH mRNA and the mRNA relative expression was calculated. The sequences of all primers used are listed in Table 1.
Twenty four 7-week-old KKay mice were purchased from Jackson Laboratories (Bar Harbor, Me). The mice were housed in macrolon cages in an animal facility with constant temperature ((21 ± 1)°C) and relative humidity (60%) under a regular light/dark (12:12) cycle. Food and water were freely available. This project was approved by the Ohio State University Animal Care and Use Committee.
1.2. Ambient whole-body inhalational protocol The KKay mice were randomly divided into four groups (n = 6). The groups were named FAC (the mice were exposed to filtered air (FA). Simultaneously, mice were treated by intracerebroventricular injection (i.c.v) with DMSO); FAT (the mice were exposed to FA and treated i.c.v with IMD-0354); PMC
100
J O U RN A L OF E N V I RO N ME N TA L S CIE N CE S 3 1 (2 0 1 5) 9 8– 1 0 3
Table 1 – Primers used for real-time PCR. Primer
Forward oligonucleotides
Reverse oligonucleotides
GAPDH TNF-α IL-6 Cyclooxygenase-2 (COX-2) IκB kinase-2 (IKK-β) Nuclear factor κB (NFκB) Mitogen activated protein Kinases (MAPK)
5′-TGCATCCTGCACCACCAACTGCTT-3′ 5′-TTCCGAATTCACTGGAGCCTCGAA-3′ 5′-ATCCAGTTGCCTTCTTGGGACTGA-3′ 5′-CAGGAGAGAAGGAAATGGC-3′ 5′-AAGATCGCCTGTAGCAAAGTCCGA-3′ 5′-ATGATCCCTACGGAACTGGGCAAA-3′ 5′-GCTTTGACGCAGGTGCTAAG-3′
5′-3′ ACAGCCTTGGCAGCACCAGTGGAT 5′-TGCACCTCAGGGAAGAATCTGGAA-3′ 5′-TAAGCCTCCGACTTGTGAAGTGGT-3′ 5′-TGAGGAGAACAGATGGGATT-3′ 5′-TTCAGGTAAGCTGTCACAGGCACT-3′ 5′-TGGGCCATCTGTTGACAGTGGTAT-3′ 5′-TGTCCCCATAACCGGAGTAGG-3′
1.6. Western blot The total proteins of cardiac tissue were homogenized in lysis buffer (Thermo Scientific, Rockford, IL). Protein concentration was quantified using a bicinchoninic (BCA) protein assay kit (Pierce). Samples containing 30 μg of proteins were separated on an 8% to 12% SDS-PAGE gel and transferred to polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA). The membranes were immunoblotted with primary antibodies anti-Phosphor-NF-κB p65 antibody (1:1000, cell signaling), anti-NF-κB p65 antibody (1:2000, cell signaling), IKK-β antibody (1:1000, Upstate), p-p38 MAPK antibody (1:1000, cell signaling technology), p38 MAPK antibody (1:1000, cell signaling technology), anti-COX-2 antibody (1:1000, Abcam) and anti-GAPDH antibody (1:500, Biolegend)
The differences among the FAC, PMC, FAT and PMT groups were analyzed by one-way analysis of variance (ANOVA). The statistical software was SPSS 16.0. Probability value < 0.05 was considered significant.
0.008
*
Relative mRNA levels
0.0002
FAT
0.10 MAPK
PMC
COX-2
**
0.0004
FAC
*
IL-6
0.002
0.000
PMT
#
0.001
FAC
FAT
PMC
PMT
Relative mRNA levels
TNF-α
Relative mRNA levels
1.7. Statistical analysis
0.003
0.0006
0.0000
at 4°C overnight, and then incubated with a secondary HRP-conjugated antibody (1:5000, Kangchen Biotech) for 1 hr at room temperature. After incubation with the secondary antibody, the membranes were detected with enhanced chemiluminescence (Super Signal West Pico; Thermo Scientific), followed by exposure to X-ray film. The protein bands on the X-ray film were scanned, and band density was calculated by Quantity One software (Bio-Rad, USA).
0.006
# 0.004
0.002
0.000
0.0010
*
FAC
FAT
NFκB
0.04
0.02
0.00
FAC
FAT
PMC
PMT
*
0.0008
0.0006
0.0004
## 0.0002
0.0000
FAC
FAT
PMC
PMT
Relative mRNA levels
#
Relative mRNA levels
Relative mRNA levels
**
0.06
PMT
0.06 IKK-β
0.08
PMC
0.04
#
0.02
0.00
FAC
FAT
PMC
PMT
Fig. 1 – mRNA expressions of inflammatory cytokines in the myocardium of KKay mice after exposure to PM2.5. Tumor necrosis factor (TNF-α), interleukin-6 (IL-6), cyclooxygenase-2 (COX-2), mitogen activated protein kinases (MAPK), IκB kinase-2 (IKK-β) and nuclear factor κB (NFκB) were determined by real-time RT-PCR. *p < 0.05, and **p < 0.01 represent PMC compared to FAC, or PMT compared to FAT; #p < 0.05, and ##p < 0.01 represent FAT compared to FAC, or PMT compared to PMC (n = 6). FAC, FAT, PMC, and PMT refer to Section 1.2.
101
J O U RN A L OF E N V I RO N ME N TA L S CI EN CE S 3 1 (2 0 1 5 ) 9 8– 1 0 3
As shown in Fig. 1, the mRNA expressions of inflammatory cytokines and NFκB signaling pathway-related cytokines were determined. Compared to the FAC group, the PMC group displayed higher TNF-α, IL-6, COX-2, IKK-β, MAPK and NFκB expression. However, there was no difference of these genes between FAT and PMT, suggesting that PM2.5 induced a significant increase in the genes' expression and that the increase could be influenced by IMD-0354. There were no differences in the genes' mRNA expression between the FAC and FAT groups. However, the mRNA expression for all the genes was lower in PMT than those in PMC, with the exception of TNF-α. This indicated that IMD-0354 treatment induced a decrease in IL-6, COX-2, IKK-β, MAPK and NFκB mRNA expression, which was PM2.5 dependent.
signaling pathway-related cytokines in the heart tissue of mice (Fig. 2). The ratios of Phosphor-NF-κB to total NF-κBp65, Phosphor-p38 to p38 were calculated. The relative protein expression of COX-2 and IKK-β was also calculated. Significantly higher protein expression of IKK-β, NFκB p65, p38 MAPK and COX-2 was found in the PMC group when compared with the FAC group (p < 0.01), suggesting that ambient PM2.5 exposure could induce the increase of these proteins. However, such differences in expression did not appear between the PMT and FAT group. In order to clarify the effects of IMD-0354, the protein expression was compared between the FAT and FAC, PMT and PMC pairs as well. After treatment with IMD-0354, IKK-β, NFκB p65 and COX-2 were significantly decreased in the mice of the PMT group when compared to those in the PMC group. Compared to the protein expression in the FAC group, the protein expression in the FAT group had no statistically significant differences in terms of NFκBp65, MAPK and COX-2, excluding IKK-β. Similar to the mRNA results, the effects of IMD-0354 displayed a PM2.5-dependent manner, as well.
2.2. Protein expression of inflammatory cytokines in myocardium
3. Discussion
The western blot method was carried out to determine the protein expression of inflammatory cytokines and NFκB
Particulate air pollution has been associated with several adverse cardiovascular health outcomes. People with diabetes
2.1. mRNA expressions of inflammatory cytokines in myocardium
0.8
p-NF κB P65
IKK-β/GAPDH
GAPDH
0.8
**
IKK-β
IKK-β
#
0.6 * 0.4
0.2
p-NF κB/total NF κB
2. Results
NF κB
** #
0.6
0.4
0.2
Total NF κB
0.0
0.0
FAC FAT PMC PMT
0.6 MARK
**
COX-2
p-p38 MARK
GAPDH
COX-2/GAPDH
COX-2
**
p-p38/total p38
Total p38 MARK
FAC FAT PMC PMT
1.5
0.4
0.2
0.0
FAC FAT PMC PMT
#
1.0
0.5
0.0
FAC FAT PMC PMT
Fig. 2 – Protein expression of IκB kinase-2 (IKK-β), total nuclear factor κB (NFκB), p-NF-κB P65, p-p38 mitogen activated protein kinases (MAPK), total p38 MAPK, cyclooxygenase-2 (COX-2) and GAPDH in the myocardium of KKay mice after exposure to PM2.5. The protein band of IKK-β, total NFκB, p-NFκB P65, p-p38 MAPK, total p38 MAPK, COX-2 and GAPDH showed in the left panel. From left to right, the band represents FAC, FAT, PMC and PMT group, respectively. The bar graphs in the right panel represent the relative protein expression of IKK-β, NF-κB, MAPK and COX-2. *p < 0.05, and **p < 0.01 represent PMC compared to FAC, or PMT compared to FAT; #p < 0.05, and ##p < 0.01 represent FAT compared to FAC, or PMT compared to PMC (n = 6). FAC, FAT, PMC, and PMT refer to Section 1.2.
102
J O U RN A L OF E N V I RO N ME N TA L S CIE N CE S 3 1 (2 0 1 5) 9 8– 1 0 3
may be especially susceptible to particulate pollution. Our previous study indicated that longer duration exposure to PM2.5 elevated the inflammatory response. Therefore, we suggested that the potential pathway linking the exacerbation of cardiac injury and PM2.5 was associated with the inflammatory response. Similarly, other epidemiological studies observed inflammatory markers in people with T2DM, suggesting that the association was particularly strong between PM2.5 exposure and inflammatory response (O'Neill et al., 2007). However, it is not clear what triggered the inflammation during the PM2.5-induced cardiac injury. It has been reported that enhanced NFκB activity is an important factor involved in the development of cardiovascular diseases (Guijarro and Egido, 2001). Additionally, a few studies have explored the function of NFκB in diabetes or metabolic syndrome through use of a NFκB inhibitor (Hulsmans et al., 2012; Kassan et al., 2015). Therefore, NFκB is an important inflammatory factor mediating cardiovascular and metabolic diseases, although it is not a characteristic biomarker in these diseases. It is well known that NFκB can trigger the production of inflammatory cytokines such as IL-6 and TNF-α, and the latter are involved in the occurrence of inflammatory response. In this study, the inflammatory cytokines IL-6 and TNF-α were significantly increased in the heart of mice with T2DM after exposure to PM2.5. In order to explore the function of NFκB in the inflammatory mechanism linking PM2.5 and cardiac injury, the IκB kinase inhibitor IMD-0354 was used to observe the changes of NFκB-related cytokines in PM2.5-exacerbated cardiac injury. The results showed that exposure to PM2.5 induced up-regulation of TNF-α, IL-6, COX-2 and MAPK. Importantly, the results demonstrated that NFκB played a key role in the cardiac inflammatory response through mediating TNF-α, IL-6 and COX-2. IMD-0354 could ameliorate PM2.5-induced myocardial inflammation and had cardioprotective properties. In addition, the effects of IMD-0354 were PM2.5-dependent, as IMD-0354 did not further improve these parameters in the FA group. The activated MAPK could promote the NFκB signal pathway (Liu and Chen, 2011). Conversely, the activated IKK could also regulate the MAPK pathway (Gantke et al., 2012), then lead to a positive feedback cycle. When NFκB signaling pathways were activated, the IκB protein was phosphorylated and NFκB entered into the nucleus to modulate target gene expression. Moreover, COX-2 is the enzyme largely responsible for causing inflammation. In this study, there were significant differences of phosphor-NFκBp65, phosphor-p38MAPK and COX-2 in the cardiac tissue of mice between the FAC and PMC groups, but not between the FAT and PMT groups, suggesting that IMD-0354 could influence the effects of PM2.5 on relative protein expression. After treatment with IMD-0354, the expression of IKK-β, phosphor-NFκB p65 and COX-2 was decreased in the PMT group when compared to the PMC group, but this was not found between FAT and FAC. Therefore, IMD-0354 could inhibit the PM2.5-induced cardiac inflammatory response. In this study, IMD-0354 treatment decreased the expression of MAPK in PM2.5-treated mice, although there was no statistical significance, which revealed that PM2.5-induced activation of the MAPK pathway is independent of the activation of the NFκB pathway. Consequently, PM2.5 could
up-regulate the expression of NFκB, MAPK and COX-2 in the heart of mice, and IMD-0354 possibly alleviated cardiac inflammation through inhibiting NFκB-related cytokine expression. Similarly, a previous study reported that inhibition of the activation of NF-κB could induce the prevention of the expression of NFκB-dependent genes and COX-2 (McDonald et al., 2001). Therefore, it could be proposed that IMD-0354 might down-regulate the expression of COX-2 via mediating the expression of NFκB. Similarly, some studies reported that COX-2 induction is primarily mediated through the activation of the NFκB pathway (Charalambous et al., 2009; Crofford et al., 1997), which strongly supports our results. This study indicated that PM2.5 may exacerbate cardiac inflammatory injury in the susceptible mouse model of T2DM and that the activation of the NF-κB signal pathway played an important role during the process. The NF-κB-mediated inflammatory response in PM2.5-induced cardiac injury was associated with its effects on inflammatory cytokines IL-6, TNF-α and COX-2. Individuals with T2DM may be more susceptible to PM2.5 exposure and have increased susceptibility to cardiovascular diseases. An inhibitor of NFκB may be a potential therapeutic agent for preventing PM2.5-induced cardiovascular injury in T2DM.
4. Conclusions This study explores the potential mechanism linking ambient PM2.5 and heart injury in a T2DM animal model. The results demonstrate that PM2.5 induces the increase of NF-κB, COX-2 and MAPK in the myocardium and that IMD-0354 could alleviate the cardiac inflammatory injury. The results suggest that the NF-κB pathway is important in mediating cardiovascular injury due to PM2.5 exposure in T2DM. Inhibiting NFκB may be a therapeutic option in air pollution-exacerbated cardiovascular injury in diabetes mellitus.
Acknowledgments This work was supported by National Institutes of Health (NIH) grants RO1ES018900.
REFERENCES Ballantyne, C.M., Entman, M.L., 2002. Soluble adhesion molecules and the search for biomarkers for atherosclerosis. Circulation 106 (7), 766–767. Bateson, T.F., Schwartz, J., 2004. Who is sensitive to the effects of particulate air pollution on mortality? A case-crossover analysis of effect modifiers. Epidemiology 15 (2), 143–149. Brunekreef, B., Holgate, S.T., 2002. Air pollution and health. Lancet 360 (9341), 1233–1242. Charalambous, M.P., Lightfoot, T., Speirs, V., Horgan, K., Gooderham, N.J., 2009. Expression of COX-2, NF-κB-p65, NF-κB-p50 and IKKα in malignant and adjacent normal human colorectal tissue. Brit. J. Cancer 101 (1), 106–115. Crofford, L.J., Tan, B., McCarthy, C.J., Hla, T., 1997. Involvement of nuclear factor kappa B in the regulation of cyclooxygenase-2 expression by interleukin-1 in rheumatoid synoviocytes. Arthritis Rheum. 40 (2), 226–236.
J O U RN A L OF E N V I RO N ME N TA L S CI EN CE S 3 1 (2 0 1 5 ) 9 8– 1 0 3
Dubowsky, S.D., Suh, H., Schwartz, J., Coull, B.A., Gold, D.R., 2006. Diabetes, obesity, and hypertension may enhance associations between air pollution and markers of systemic inflammation. Environ. Health Perspect. 114 (7), 992–998. Franchini, M., Mannucci, P.M., 2012. Air pollution and cardiovascular disease. Thromb. Res. 129 (3), 230–234. Gantke, T., Sriskantharajah, S., Sadowski, M., Ley, S.C., 2012. IκB kinase regulation of the TPL-2/ERK MAPK pathway. Immunol. Rev. 246 (1), 168–182. Goldberg, M.S., Burnett, R.T., Bailar, J.R., Brook, J., Bonvalot, Y., Tamblyn, R., et al., 2001. The association between daily mortality and ambient air particle pollution in Montreal, Quebec. 2. Cause-specific mortality. Environ. Res. 86 (1), 26–36. Guijarro, C., Egido, J., 2001. Transcription factor-κB (NF-κB) and renal disease. Kidney Int. 59 (2), 415–424. Gupta, S., Young, D., Sen, S., 2005. Inhibition of NF-kappaB induces regression of cardiac hypertrophy, independent of blood pressure control, in spontaneously hypertensive rats. Am. J. Physiol. Heart Circ. Physiol. 289 (1), H20–H29. Hulsmans, M., Geeraert, B., De Keyzer, D., Mertens, A., Lannoo, M., Vanaudenaerde, B., et al., 2012. Interleukin-1 receptor-associated kinase-3 is a key inhibitor of inflammation in obesity and metabolic syndrome. PLoS ONE 7 (1), e30414. Kassan, M., Choi, S.K., Galan, M., Trebak, M., Belmadani, S., Matrougui, K., 2015. Nuclear factor kappa B inhibition improves conductance artery function in type 2 diabetic mice. Diabetes Metab. Res. Rev. 31 (1), 39–49. Liu, S.Q., Chen, Z.J., 2011. Expanding role of ubiquitination in NF-κB signaling. Cell Res. 21 (1), 6–21. Liu, C., Xu, X., Bai, Y., Wang, T.Y., Rao, X., Wang, A., et al., 2014. Air pollution-mediated susceptibility to inflammation and insulin resistance: influence of CCR2 pathways in mice. Environ. Health Perspect. 122 (1), 17–26. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25 (4), 402–408. Maulik, N., Sato, M., Price, B.D., Das, D.K., 1998. An essential role of NFκB in tyrosine kinase signaling of p38 MAP kinase regulation of myocardial adaptation to ischemia. FEBS Lett. 429 (3), 365–369. McDonald, M.C., Mota-Filipe, H., Paul, A., Cuzzocrea, S., Abdelrahman, M., Harwood, S., et al., 2001. Calpain inhibitor I reduces the activation of nuclear factor-κB and organ injury/dysfunction in hemorrhagic shock. FASEB J. 15 (1), 171–186. Nemmar, A., Hoet, P.H., Vanquickenborne, B., Dinsdale, D., Thomeer, M., Hoylaerts, M.F., et al., 2002. Passage of inhaled particles into the blood circulation in humans. Circulation 105 (4), 411–414.
103
O'Neill, M.S., Veves, A., Sarnat, J.A., Zanobetti, A., Gold, D.R., Economides, P.A., et al., 2007. Air pollution and inflammation in type 2 diabetes: a mechanism for susceptibility. Occup. Environ. Med. 64 (6), 373–379. Schaffer, S.W., Ballard, C., Mozaffari, M.S., 1997. Is there a link between impaired glucose metabolism and protein kinase C activity in the diabetic heart. In: Singal, P.K., Panagia, V., Pierce, G.N. (Eds.), The Cellular Basis of Cardiovascular Function in Health and Disease. 22. Springer, US, pp. 219–225. Schneider, A., Neas, L.M., Graff, D.W., Herbst, M.C., Cascio, W.E., Schmitt, M.T., et al., 2010. Association of cardiac and vascular changes with ambient PM2.5 in diabetic individuals. Part. Fibre Toxicol. 7, 14. Shen, X., Zheng, S.R., Thongboonkerd, V., Xu, M., Pierce Jr., W.M., Klein, J.B., et al., 2004. Cardiac mitochondrial damage and biogenesis in a chronic model of type 1 diabetes. Am. J. Physiol. Endocrinol. Metab. 287 (5), E896–E905. Simkhovich, B.Z., Marjoram, P., Kleinman, M.T., Kloner, R.A., 2007. Direct and acute cardiotoxicity of ultrafine particles in young adult and old rat hearts. Basic Res. Cardiol. 102 (6), 467–475. Sun, Q., Yue, P., Deiuliis, J.A., Lumeng, C.N., Kampfrath, T., Mikolaj, M.B., Cai, Y., et al., 2009. Ambient air pollution exaggerates adipose inflammation and insulin resistance in a mouse model of diet-induced obesity. Circulation 119, 538–546. Sunyer, J., Ballester, F., Tertre, A.L., Atkinson, R., Ayres, J.G., Forastiere, F., et al., 2003. The association of daily sulfur dioxide air pollution levels with hospital admissions for cardiovascular diseases in Europe (The Aphea-II study). Eur. Heart J. 24 (8), 752–760. Wang, J.X., Song, Y., Wang, Q.W., Kralik, P.M., Epstein, P.N., 2006. Causes and characteristics of diabetic cardiomyopathy. Rev. Diabet. Stud. 3 (3), 108–117. Xu, X.H., Liu, C.Q., Xu, Z.B., Tzan, K., Zhong, M.H., Wang, A.X., et al., 2011. Long-term exposure to ambient fine particulate pollution induces insulin resistance and mitochondrial alteration in adipose tissue. Toxicol. Sci. 124 (1), 88–98. Yan, Y.H., Chou, C.C., Lee, C.T., Liu, J.Y., Cheng, T.J., 2011. Enhanced insulin resistance in diet-induced obese rats exposed to fine particles by instillation. Inhal. Toxicol. 23 (9), 507–519. Zanobetti, A., Schwartz, J., 2001. Are diabetics more susceptible to the health effects of airborne particles? Am. J. Respir. Crit. Care Med. 164 (5), 831–833. Zhang, X., Zhang, G., Zhang, H., Karin, M., Bai, H., Cai, D., 2008. Hypothalamic IKKbeta/NF-kappaB and ER stress link overnutrition to energy imbalance and obesity. Cell 135 (1), 61–73.
Available online at www.sciencedirect.com
ScienceDirect www.journals.elsevier.com/journal-of-environmental-sciences
IKK inhibition prevents PM2.5-exacerbated cardiac injury in mice with type 2 diabetes Jinzhuo Zhao1,2 , Cuiqing Liu3 , Yuntao Bai2,3 , Tse-yao Wang2,3 , Haidong Kan1 , Qinghua Sun2,3,⁎ 1. Department of Environment Health, School of Public Health and the Key Laboratory of Public Health Safety, Fudan University, Shanghai 200032, China 2. Division of Environmental Health Sciences, College of Public Health, The Ohio State University, Columbus, OH, USA 3. Davis Heart and Lung Research Institute, The Ohio State University Wexner Medical Center, Columbus, OH, USA
AR TIC LE I N FO
ABS TR ACT
Article history:
Epidemiological studies have found that individuals with diabetes mellitus (DM) display an
Received 14 August 2014
increased susceptibility for adverse cardiovascular outcomes when exposed to air pollution.
Revised 11 October 2014
This study was conducted to explore the potential mechanism linking ambient fine
Accepted 24 October 2014
particles (PM2.5) and heart injury in a Type 2 DM (T2DM) animal model. The KKay mouse, an
Available online 25 March 2015
animal model of T2DM, was exposed to concentrated ambient PM2.5 or filtered air for 8 weeks via a versatile aerosol exposure and concentrator system. Simultaneously, an
Keywords:
inhibitor of IκB kinase-2 (IKK-â) (IMD-0354), which is a blocker of nuclear factor κB (NF-κB)
Fine particles
nuclear translocation, was administrated by intracerebroventricular injection (ICV) to
Cardiovascular diseases
regulate the NF-êB pathway. The results showed that ambient PM2.5 induced the increase
Diabetes mellitus
of, NF-êB, cyclooxygenase-2 (COX-2) and mitogen activated protein kinase (MAPK) expression
NFκB
in cardiac tissue, and that IMD-0354 could alleviate the inflammatory injury. The results suggested that the NF-êB pathway plays an important role in mediating the PM2.5-induced cardiovascular injury in the T2DM model. Inhibiting NFκB may be a therapeutic option in air-pollution-exacerbated cardiovascular injury in diabetes mellitus. © 2015 The Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences. Published by Elsevier B.V.
Introduction Air pollution has been shown to be directly associated with the increase of cardiopulmonary deaths in highly polluted urban settings (Simkhovich et al., 2007). It has been suggested that air pollution may contribute to the development of chronic conditions. Air pollution has become a major risk factor for acute cardiovascular events, hypertension and diabetes mellitus (Brunekreef and Holgate, 2002). Type 2 diabetes mellitus (T2DM) is recognized as one of the key risk
factors in the development of cardiovascular disease (CVD) (Wang et al., 2006). Previous study recognized that diabetics exposed to air pollution are more susceptible to the development of cardiac dysfunction, although the underlying mechanisms remain unclear (Schaffer et al., 1997; Sunyer et al., 2003). Individuals with DM are more prone to develop adverse cardiovascular outcomes, and the outcomes are related to acute air pollution exposure (Bateson and Schwartz, 2004; Dubowsky et al., 2006; Zanobetti and Schwartz, 2001). Diabetic-related heart disease has become an important risk factor threatening people's health (Shen et al., 2004).
⁎ Corresponding author. E-mail: [email protected] (Qinghua Sun).
http://dx.doi.org/10.1016/j.jes.2014.10.018 1001-0742/© 2015 The Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences. Published by Elsevier B.V.
J O U RN A L OF E N V I RO N ME N TA L S CI EN CE S 3 1 (2 0 1 5 ) 9 8– 1 0 3
Particulate matter, especially ≤ 2.5 μm in aerodynamic diameter (PM2.5), is one of the most important air pollutants. PM2.5 is of concern to human health as it can deposit in the lower airways and gas-exchanging portions of the lung, even potentially reaching the circulatory system (Nemmar et al., 2002). Exposure to PM2.5 has been consistently linked to cardiovascular morbidity and mortality (Franchini and Mannucci, 2012). The association between ambient PM2.5 and cardiovascular disease and DM has been explored in some epidemiological (Goldberg et al., 2001; O'Neill et al., 2007) and experimental (Xu et al., 2011; Yan et al., 2011) studies. However, it remains unclear whether exacerbation of cardiac injury is an adverse outcome of PM2.5 in DM. Inflammation is a key pathway leading to atherosclerosis and subsequent adverse cardiovascular events (Ballantyne and Entman, 2002). Inflammation may be one possible mechanism linking PM2.5 and cardiovascular disease (Franchini and Mannucci, 2012) and DM (Schneider et al., 2010). However, there is no clear mechanism that has been defined to explain the potential link between PM2.5 and cardiac injury in DM. Evidence has supported that NFκB activation is prominent in damaged kidneys or dysfunctional hearts, with up-regulation of p65 mRNA and increased NFκB binding activity (Gupta et al., 2005; Maulik et al., 1998). Previous studies also demonstrated that inflammatory response was associated with the exacerbation of insulin resistance and inflammatory response in mice exposed to ambient PM2.5 (Liu et al., 2014). Moreover, inactivation of IκB kinase or blocking of TNF-α can protect against defective thermogenesis, obesity and insulin resistance (Zhang et al., 2008). In this study, we suggested that inhalation of concentrated PM2.5 would result in the occurrence of cardiac inflammation in a genetically susceptible mouse model of T2DM. In addition, we suggested that NFκB may mediate the inflammatory response in PM2.5-induced cardiac injury. Meanwhile, NFκB could exacerbate cardiac injury through mediating the expression of cyclooxygenaze-2 (COX-2) and mitogen-activated protein kinases (MAPK).
99
(the mice were exposed to concentrated PM2.5 and treated i.c.v with DMSO); and PMT (the mice were exposed to concentrated PM2.5 and treated i.c.v with IMD-0354). Animal exposure was performed as previously described (Sun et al., 2009). The mice in the FAC and FAT groups inhaled the FA (the air was filtered of PM2.5 and the concentration of PM2.5 in the control contained virtually no PM2.5). In contrast, the mice in the PMC and PMT groups inhaled the concentrated PM2.5 (the exposure device could concentrate the ambient PM2.5, and the concentration of PM2.5 in the exposure groups was 10 times higher than ambient PM2.5). The detailed treatment methods were as follows: The mice were exposed to PM2.5 or FA for 6 hr/day, 5 day/week, 8 weeks in a near-road exposure system (“Ohio Air Pollution Exposure System for Interrogation of Systemic Effects” located at Polaris in Columbus). Simultaneously, the mice were treated i.c.v with IMD-0354 or DMSO for 6 hr/day, 5 day/week, 8 weeks.
1.3. Intracerebroventricular (ICV) drug infusion ICV surgery was performed on the mice for drug infusion. A stereotaxic apparatus was used to implant a cannula into the right lateral ventricle of mice anesthetized with 2% isoflurane in air. Cannula positions were + 0.02 posterior and − 0.95 lateral to Bregma, extending 2.75 mm below the skull (Plastics One, Roanoke, VA). The cannula was connected via tubing to an Alzet minipump (Model 1004, Durect, Cupertino, CA) that was implanted subcutaneously in the scapular region and delivered either vehicle (DMSO) or IMD-0354 (Sigma), both at a rate of 0.11 μL/hr. The IMD-0354-treated groups received a total of 600 ng of the inhibitor per day.
1.4. Sample collection At the end of the exposure, the cardiac tissue of mice was collected for further analysis. The heart tissue of mice was stored at − 80°C for real time PCR (RT-PCR) and Western blot detection.
1. Materials and methods
1.5. Real-time PCR
1.1. Animals and animal care
Real time-PCR was performed using RNA extracted from cardiac tissue of the mice. Total RNA from cardiac tissue was isolated with Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. cDNA was reversely transcribed using a High Capacity cDNA Transcription kit (Applied Biosystems, Carlsbad, California, USA). Gene expression for GAPDH, TNF-α, IL-6, COX-2, MAPK, IKK-β and NFκB was determined using inventoried primer and probe assays (Applied Biosystems, Foster City, CA) on an ABI 7500 Fast Real Time PCR System using Taqman® Universal PCR Master Mix. The universal two-step real-time PCR cycling conditions used were: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. The 2−△△CT method (Livak and Schmittgen, 2001) was used to normalize transcription to GAPDH mRNA and the mRNA relative expression was calculated. The sequences of all primers used are listed in Table 1.
Twenty four 7-week-old KKay mice were purchased from Jackson Laboratories (Bar Harbor, Me). The mice were housed in macrolon cages in an animal facility with constant temperature ((21 ± 1)°C) and relative humidity (60%) under a regular light/dark (12:12) cycle. Food and water were freely available. This project was approved by the Ohio State University Animal Care and Use Committee.
1.2. Ambient whole-body inhalational protocol The KKay mice were randomly divided into four groups (n = 6). The groups were named FAC (the mice were exposed to filtered air (FA). Simultaneously, mice were treated by intracerebroventricular injection (i.c.v) with DMSO); FAT (the mice were exposed to FA and treated i.c.v with IMD-0354); PMC
100
J O U RN A L OF E N V I RO N ME N TA L S CIE N CE S 3 1 (2 0 1 5) 9 8– 1 0 3
Table 1 – Primers used for real-time PCR. Primer
Forward oligonucleotides
Reverse oligonucleotides
GAPDH TNF-α IL-6 Cyclooxygenase-2 (COX-2) IκB kinase-2 (IKK-β) Nuclear factor κB (NFκB) Mitogen activated protein Kinases (MAPK)
5′-TGCATCCTGCACCACCAACTGCTT-3′ 5′-TTCCGAATTCACTGGAGCCTCGAA-3′ 5′-ATCCAGTTGCCTTCTTGGGACTGA-3′ 5′-CAGGAGAGAAGGAAATGGC-3′ 5′-AAGATCGCCTGTAGCAAAGTCCGA-3′ 5′-ATGATCCCTACGGAACTGGGCAAA-3′ 5′-GCTTTGACGCAGGTGCTAAG-3′
5′-3′ ACAGCCTTGGCAGCACCAGTGGAT 5′-TGCACCTCAGGGAAGAATCTGGAA-3′ 5′-TAAGCCTCCGACTTGTGAAGTGGT-3′ 5′-TGAGGAGAACAGATGGGATT-3′ 5′-TTCAGGTAAGCTGTCACAGGCACT-3′ 5′-TGGGCCATCTGTTGACAGTGGTAT-3′ 5′-TGTCCCCATAACCGGAGTAGG-3′
1.6. Western blot The total proteins of cardiac tissue were homogenized in lysis buffer (Thermo Scientific, Rockford, IL). Protein concentration was quantified using a bicinchoninic (BCA) protein assay kit (Pierce). Samples containing 30 μg of proteins were separated on an 8% to 12% SDS-PAGE gel and transferred to polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA). The membranes were immunoblotted with primary antibodies anti-Phosphor-NF-κB p65 antibody (1:1000, cell signaling), anti-NF-κB p65 antibody (1:2000, cell signaling), IKK-β antibody (1:1000, Upstate), p-p38 MAPK antibody (1:1000, cell signaling technology), p38 MAPK antibody (1:1000, cell signaling technology), anti-COX-2 antibody (1:1000, Abcam) and anti-GAPDH antibody (1:500, Biolegend)
The differences among the FAC, PMC, FAT and PMT groups were analyzed by one-way analysis of variance (ANOVA). The statistical software was SPSS 16.0. Probability value < 0.05 was considered significant.
0.008
*
Relative mRNA levels
0.0002
FAT
0.10 MAPK
PMC
COX-2
**
0.0004
FAC
*
IL-6
0.002
0.000
PMT
#
0.001
FAC
FAT
PMC
PMT
Relative mRNA levels
TNF-α
Relative mRNA levels
1.7. Statistical analysis
0.003
0.0006
0.0000
at 4°C overnight, and then incubated with a secondary HRP-conjugated antibody (1:5000, Kangchen Biotech) for 1 hr at room temperature. After incubation with the secondary antibody, the membranes were detected with enhanced chemiluminescence (Super Signal West Pico; Thermo Scientific), followed by exposure to X-ray film. The protein bands on the X-ray film were scanned, and band density was calculated by Quantity One software (Bio-Rad, USA).
0.006
# 0.004
0.002
0.000
0.0010
*
FAC
FAT
NFκB
0.04
0.02
0.00
FAC
FAT
PMC
PMT
*
0.0008
0.0006
0.0004
## 0.0002
0.0000
FAC
FAT
PMC
PMT
Relative mRNA levels
#
Relative mRNA levels
Relative mRNA levels
**
0.06
PMT
0.06 IKK-β
0.08
PMC
0.04
#
0.02
0.00
FAC
FAT
PMC
PMT
Fig. 1 – mRNA expressions of inflammatory cytokines in the myocardium of KKay mice after exposure to PM2.5. Tumor necrosis factor (TNF-α), interleukin-6 (IL-6), cyclooxygenase-2 (COX-2), mitogen activated protein kinases (MAPK), IκB kinase-2 (IKK-β) and nuclear factor κB (NFκB) were determined by real-time RT-PCR. *p < 0.05, and **p < 0.01 represent PMC compared to FAC, or PMT compared to FAT; #p < 0.05, and ##p < 0.01 represent FAT compared to FAC, or PMT compared to PMC (n = 6). FAC, FAT, PMC, and PMT refer to Section 1.2.
101
J O U RN A L OF E N V I RO N ME N TA L S CI EN CE S 3 1 (2 0 1 5 ) 9 8– 1 0 3
As shown in Fig. 1, the mRNA expressions of inflammatory cytokines and NFκB signaling pathway-related cytokines were determined. Compared to the FAC group, the PMC group displayed higher TNF-α, IL-6, COX-2, IKK-β, MAPK and NFκB expression. However, there was no difference of these genes between FAT and PMT, suggesting that PM2.5 induced a significant increase in the genes' expression and that the increase could be influenced by IMD-0354. There were no differences in the genes' mRNA expression between the FAC and FAT groups. However, the mRNA expression for all the genes was lower in PMT than those in PMC, with the exception of TNF-α. This indicated that IMD-0354 treatment induced a decrease in IL-6, COX-2, IKK-β, MAPK and NFκB mRNA expression, which was PM2.5 dependent.
signaling pathway-related cytokines in the heart tissue of mice (Fig. 2). The ratios of Phosphor-NF-κB to total NF-κBp65, Phosphor-p38 to p38 were calculated. The relative protein expression of COX-2 and IKK-β was also calculated. Significantly higher protein expression of IKK-β, NFκB p65, p38 MAPK and COX-2 was found in the PMC group when compared with the FAC group (p < 0.01), suggesting that ambient PM2.5 exposure could induce the increase of these proteins. However, such differences in expression did not appear between the PMT and FAT group. In order to clarify the effects of IMD-0354, the protein expression was compared between the FAT and FAC, PMT and PMC pairs as well. After treatment with IMD-0354, IKK-β, NFκB p65 and COX-2 were significantly decreased in the mice of the PMT group when compared to those in the PMC group. Compared to the protein expression in the FAC group, the protein expression in the FAT group had no statistically significant differences in terms of NFκBp65, MAPK and COX-2, excluding IKK-β. Similar to the mRNA results, the effects of IMD-0354 displayed a PM2.5-dependent manner, as well.
2.2. Protein expression of inflammatory cytokines in myocardium
3. Discussion
The western blot method was carried out to determine the protein expression of inflammatory cytokines and NFκB
Particulate air pollution has been associated with several adverse cardiovascular health outcomes. People with diabetes
2.1. mRNA expressions of inflammatory cytokines in myocardium
0.8
p-NF κB P65
IKK-β/GAPDH
GAPDH
0.8
**
IKK-β
IKK-β
#
0.6 * 0.4
0.2
p-NF κB/total NF κB
2. Results
NF κB
** #
0.6
0.4
0.2
Total NF κB
0.0
0.0
FAC FAT PMC PMT
0.6 MARK
**
COX-2
p-p38 MARK
GAPDH
COX-2/GAPDH
COX-2
**
p-p38/total p38
Total p38 MARK
FAC FAT PMC PMT
1.5
0.4
0.2
0.0
FAC FAT PMC PMT
#
1.0
0.5
0.0
FAC FAT PMC PMT
Fig. 2 – Protein expression of IκB kinase-2 (IKK-β), total nuclear factor κB (NFκB), p-NF-κB P65, p-p38 mitogen activated protein kinases (MAPK), total p38 MAPK, cyclooxygenase-2 (COX-2) and GAPDH in the myocardium of KKay mice after exposure to PM2.5. The protein band of IKK-β, total NFκB, p-NFκB P65, p-p38 MAPK, total p38 MAPK, COX-2 and GAPDH showed in the left panel. From left to right, the band represents FAC, FAT, PMC and PMT group, respectively. The bar graphs in the right panel represent the relative protein expression of IKK-β, NF-κB, MAPK and COX-2. *p < 0.05, and **p < 0.01 represent PMC compared to FAC, or PMT compared to FAT; #p < 0.05, and ##p < 0.01 represent FAT compared to FAC, or PMT compared to PMC (n = 6). FAC, FAT, PMC, and PMT refer to Section 1.2.
102
J O U RN A L OF E N V I RO N ME N TA L S CIE N CE S 3 1 (2 0 1 5) 9 8– 1 0 3
may be especially susceptible to particulate pollution. Our previous study indicated that longer duration exposure to PM2.5 elevated the inflammatory response. Therefore, we suggested that the potential pathway linking the exacerbation of cardiac injury and PM2.5 was associated with the inflammatory response. Similarly, other epidemiological studies observed inflammatory markers in people with T2DM, suggesting that the association was particularly strong between PM2.5 exposure and inflammatory response (O'Neill et al., 2007). However, it is not clear what triggered the inflammation during the PM2.5-induced cardiac injury. It has been reported that enhanced NFκB activity is an important factor involved in the development of cardiovascular diseases (Guijarro and Egido, 2001). Additionally, a few studies have explored the function of NFκB in diabetes or metabolic syndrome through use of a NFκB inhibitor (Hulsmans et al., 2012; Kassan et al., 2015). Therefore, NFκB is an important inflammatory factor mediating cardiovascular and metabolic diseases, although it is not a characteristic biomarker in these diseases. It is well known that NFκB can trigger the production of inflammatory cytokines such as IL-6 and TNF-α, and the latter are involved in the occurrence of inflammatory response. In this study, the inflammatory cytokines IL-6 and TNF-α were significantly increased in the heart of mice with T2DM after exposure to PM2.5. In order to explore the function of NFκB in the inflammatory mechanism linking PM2.5 and cardiac injury, the IκB kinase inhibitor IMD-0354 was used to observe the changes of NFκB-related cytokines in PM2.5-exacerbated cardiac injury. The results showed that exposure to PM2.5 induced up-regulation of TNF-α, IL-6, COX-2 and MAPK. Importantly, the results demonstrated that NFκB played a key role in the cardiac inflammatory response through mediating TNF-α, IL-6 and COX-2. IMD-0354 could ameliorate PM2.5-induced myocardial inflammation and had cardioprotective properties. In addition, the effects of IMD-0354 were PM2.5-dependent, as IMD-0354 did not further improve these parameters in the FA group. The activated MAPK could promote the NFκB signal pathway (Liu and Chen, 2011). Conversely, the activated IKK could also regulate the MAPK pathway (Gantke et al., 2012), then lead to a positive feedback cycle. When NFκB signaling pathways were activated, the IκB protein was phosphorylated and NFκB entered into the nucleus to modulate target gene expression. Moreover, COX-2 is the enzyme largely responsible for causing inflammation. In this study, there were significant differences of phosphor-NFκBp65, phosphor-p38MAPK and COX-2 in the cardiac tissue of mice between the FAC and PMC groups, but not between the FAT and PMT groups, suggesting that IMD-0354 could influence the effects of PM2.5 on relative protein expression. After treatment with IMD-0354, the expression of IKK-β, phosphor-NFκB p65 and COX-2 was decreased in the PMT group when compared to the PMC group, but this was not found between FAT and FAC. Therefore, IMD-0354 could inhibit the PM2.5-induced cardiac inflammatory response. In this study, IMD-0354 treatment decreased the expression of MAPK in PM2.5-treated mice, although there was no statistical significance, which revealed that PM2.5-induced activation of the MAPK pathway is independent of the activation of the NFκB pathway. Consequently, PM2.5 could
up-regulate the expression of NFκB, MAPK and COX-2 in the heart of mice, and IMD-0354 possibly alleviated cardiac inflammation through inhibiting NFκB-related cytokine expression. Similarly, a previous study reported that inhibition of the activation of NF-κB could induce the prevention of the expression of NFκB-dependent genes and COX-2 (McDonald et al., 2001). Therefore, it could be proposed that IMD-0354 might down-regulate the expression of COX-2 via mediating the expression of NFκB. Similarly, some studies reported that COX-2 induction is primarily mediated through the activation of the NFκB pathway (Charalambous et al., 2009; Crofford et al., 1997), which strongly supports our results. This study indicated that PM2.5 may exacerbate cardiac inflammatory injury in the susceptible mouse model of T2DM and that the activation of the NF-κB signal pathway played an important role during the process. The NF-κB-mediated inflammatory response in PM2.5-induced cardiac injury was associated with its effects on inflammatory cytokines IL-6, TNF-α and COX-2. Individuals with T2DM may be more susceptible to PM2.5 exposure and have increased susceptibility to cardiovascular diseases. An inhibitor of NFκB may be a potential therapeutic agent for preventing PM2.5-induced cardiovascular injury in T2DM.
4. Conclusions This study explores the potential mechanism linking ambient PM2.5 and heart injury in a T2DM animal model. The results demonstrate that PM2.5 induces the increase of NF-κB, COX-2 and MAPK in the myocardium and that IMD-0354 could alleviate the cardiac inflammatory injury. The results suggest that the NF-κB pathway is important in mediating cardiovascular injury due to PM2.5 exposure in T2DM. Inhibiting NFκB may be a therapeutic option in air pollution-exacerbated cardiovascular injury in diabetes mellitus.
Acknowledgments This work was supported by National Institutes of Health (NIH) grants RO1ES018900.
REFERENCES Ballantyne, C.M., Entman, M.L., 2002. Soluble adhesion molecules and the search for biomarkers for atherosclerosis. Circulation 106 (7), 766–767. Bateson, T.F., Schwartz, J., 2004. Who is sensitive to the effects of particulate air pollution on mortality? A case-crossover analysis of effect modifiers. Epidemiology 15 (2), 143–149. Brunekreef, B., Holgate, S.T., 2002. Air pollution and health. Lancet 360 (9341), 1233–1242. Charalambous, M.P., Lightfoot, T., Speirs, V., Horgan, K., Gooderham, N.J., 2009. Expression of COX-2, NF-κB-p65, NF-κB-p50 and IKKα in malignant and adjacent normal human colorectal tissue. Brit. J. Cancer 101 (1), 106–115. Crofford, L.J., Tan, B., McCarthy, C.J., Hla, T., 1997. Involvement of nuclear factor kappa B in the regulation of cyclooxygenase-2 expression by interleukin-1 in rheumatoid synoviocytes. Arthritis Rheum. 40 (2), 226–236.
J O U RN A L OF E N V I RO N ME N TA L S CI EN CE S 3 1 (2 0 1 5 ) 9 8– 1 0 3
Dubowsky, S.D., Suh, H., Schwartz, J., Coull, B.A., Gold, D.R., 2006. Diabetes, obesity, and hypertension may enhance associations between air pollution and markers of systemic inflammation. Environ. Health Perspect. 114 (7), 992–998. Franchini, M., Mannucci, P.M., 2012. Air pollution and cardiovascular disease. Thromb. Res. 129 (3), 230–234. Gantke, T., Sriskantharajah, S., Sadowski, M., Ley, S.C., 2012. IκB kinase regulation of the TPL-2/ERK MAPK pathway. Immunol. Rev. 246 (1), 168–182. Goldberg, M.S., Burnett, R.T., Bailar, J.R., Brook, J., Bonvalot, Y., Tamblyn, R., et al., 2001. The association between daily mortality and ambient air particle pollution in Montreal, Quebec. 2. Cause-specific mortality. Environ. Res. 86 (1), 26–36. Guijarro, C., Egido, J., 2001. Transcription factor-κB (NF-κB) and renal disease. Kidney Int. 59 (2), 415–424. Gupta, S., Young, D., Sen, S., 2005. Inhibition of NF-kappaB induces regression of cardiac hypertrophy, independent of blood pressure control, in spontaneously hypertensive rats. Am. J. Physiol. Heart Circ. Physiol. 289 (1), H20–H29. Hulsmans, M., Geeraert, B., De Keyzer, D., Mertens, A., Lannoo, M., Vanaudenaerde, B., et al., 2012. Interleukin-1 receptor-associated kinase-3 is a key inhibitor of inflammation in obesity and metabolic syndrome. PLoS ONE 7 (1), e30414. Kassan, M., Choi, S.K., Galan, M., Trebak, M., Belmadani, S., Matrougui, K., 2015. Nuclear factor kappa B inhibition improves conductance artery function in type 2 diabetic mice. Diabetes Metab. Res. Rev. 31 (1), 39–49. Liu, S.Q., Chen, Z.J., 2011. Expanding role of ubiquitination in NF-κB signaling. Cell Res. 21 (1), 6–21. Liu, C., Xu, X., Bai, Y., Wang, T.Y., Rao, X., Wang, A., et al., 2014. Air pollution-mediated susceptibility to inflammation and insulin resistance: influence of CCR2 pathways in mice. Environ. Health Perspect. 122 (1), 17–26. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25 (4), 402–408. Maulik, N., Sato, M., Price, B.D., Das, D.K., 1998. An essential role of NFκB in tyrosine kinase signaling of p38 MAP kinase regulation of myocardial adaptation to ischemia. FEBS Lett. 429 (3), 365–369. McDonald, M.C., Mota-Filipe, H., Paul, A., Cuzzocrea, S., Abdelrahman, M., Harwood, S., et al., 2001. Calpain inhibitor I reduces the activation of nuclear factor-κB and organ injury/dysfunction in hemorrhagic shock. FASEB J. 15 (1), 171–186. Nemmar, A., Hoet, P.H., Vanquickenborne, B., Dinsdale, D., Thomeer, M., Hoylaerts, M.F., et al., 2002. Passage of inhaled particles into the blood circulation in humans. Circulation 105 (4), 411–414.
103
O'Neill, M.S., Veves, A., Sarnat, J.A., Zanobetti, A., Gold, D.R., Economides, P.A., et al., 2007. Air pollution and inflammation in type 2 diabetes: a mechanism for susceptibility. Occup. Environ. Med. 64 (6), 373–379. Schaffer, S.W., Ballard, C., Mozaffari, M.S., 1997. Is there a link between impaired glucose metabolism and protein kinase C activity in the diabetic heart. In: Singal, P.K., Panagia, V., Pierce, G.N. (Eds.), The Cellular Basis of Cardiovascular Function in Health and Disease. 22. Springer, US, pp. 219–225. Schneider, A., Neas, L.M., Graff, D.W., Herbst, M.C., Cascio, W.E., Schmitt, M.T., et al., 2010. Association of cardiac and vascular changes with ambient PM2.5 in diabetic individuals. Part. Fibre Toxicol. 7, 14. Shen, X., Zheng, S.R., Thongboonkerd, V., Xu, M., Pierce Jr., W.M., Klein, J.B., et al., 2004. Cardiac mitochondrial damage and biogenesis in a chronic model of type 1 diabetes. Am. J. Physiol. Endocrinol. Metab. 287 (5), E896–E905. Simkhovich, B.Z., Marjoram, P., Kleinman, M.T., Kloner, R.A., 2007. Direct and acute cardiotoxicity of ultrafine particles in young adult and old rat hearts. Basic Res. Cardiol. 102 (6), 467–475. Sun, Q., Yue, P., Deiuliis, J.A., Lumeng, C.N., Kampfrath, T., Mikolaj, M.B., Cai, Y., et al., 2009. Ambient air pollution exaggerates adipose inflammation and insulin resistance in a mouse model of diet-induced obesity. Circulation 119, 538–546. Sunyer, J., Ballester, F., Tertre, A.L., Atkinson, R., Ayres, J.G., Forastiere, F., et al., 2003. The association of daily sulfur dioxide air pollution levels with hospital admissions for cardiovascular diseases in Europe (The Aphea-II study). Eur. Heart J. 24 (8), 752–760. Wang, J.X., Song, Y., Wang, Q.W., Kralik, P.M., Epstein, P.N., 2006. Causes and characteristics of diabetic cardiomyopathy. Rev. Diabet. Stud. 3 (3), 108–117. Xu, X.H., Liu, C.Q., Xu, Z.B., Tzan, K., Zhong, M.H., Wang, A.X., et al., 2011. Long-term exposure to ambient fine particulate pollution induces insulin resistance and mitochondrial alteration in adipose tissue. Toxicol. Sci. 124 (1), 88–98. Yan, Y.H., Chou, C.C., Lee, C.T., Liu, J.Y., Cheng, T.J., 2011. Enhanced insulin resistance in diet-induced obese rats exposed to fine particles by instillation. Inhal. Toxicol. 23 (9), 507–519. Zanobetti, A., Schwartz, J., 2001. Are diabetics more susceptible to the health effects of airborne particles? Am. J. Respir. Crit. Care Med. 164 (5), 831–833. Zhang, X., Zhang, G., Zhang, H., Karin, M., Bai, H., Cai, D., 2008. Hypothalamic IKKbeta/NF-kappaB and ER stress link overnutrition to energy imbalance and obesity. Cell 135 (1), 61–73.
