Article
Immunologic study and optimization of Salmonella delivery strains expressing adhesin and toxin antigens for protection against progressive atrophic rhinitis in a murine model Jin Hur, Hoyeon Byeon, John Hwa Lee
Abstract Mice were intranasally inoculated at various times to optimize the vaccination strategy with a new live candidate vaccine expressing the antigens CP39, FimA, PtfA, and ToxA of Pasteurella multocida and F1P2 of Bordetella bronchiseptica in an attenuated live Salmonella system to protect against progressive atrophic rhinitis (PAR). Sixty BALB/c mice were divided equally into 4 groups. The group A mice were vaccinated only at 12 wk of age, the group B mice received a primary vaccination at 9 wk of age and a booster at 12 wk of age, the group C mice received a primary vaccination at 6 wk of age and boosters at 9 and 12 wk of age, and the group D mice were inoculated intranasally with sterile phosphate-buffered saline as a control. The humoral and mucosal immune responses of groups A, B, and C increased significantly compared with those of the control group. Expression of the cytokines interleukin-4 and interferon-g in splenocytes also increased significantly. In addition, the group B mice exhibited significantly fewer gross lesions in lung tissue compared with the other vaccinated groups after challenge with a virulent P. multocida strain. These results indicate that a strategy of double intranasal vaccination can optimize protection against PAR.
Résumé Des souris furent inoculées par voie intra-nasale à différents temps pour optimiser la stratégie de vaccination avec un nouveau vaccin candidat vivant exprimant les antigènes CP39, FimA, PtfA, et ToxA de Pasteurella multocida et F1P2 de Bordetella bronchiseptica dans un système vivant atténué de Salmonella afin de protéger contre la rhinite atrophique progressive (PAR). Soixante souris BALB/c ont été divisées également en quatre groupes. Les souris du groupe A furent vaccinées seulement à 12 semaines d’âge, les souris du groupe B ont reçu une première vaccination à 9 sem d’âge et un rappel à 12 sem d’âge, les souris du groupe C ont reçu une première vaccination à 6 sem d’âge et des rappels à 9 et 12 sem d’âge, et les souris du groupe D (groupe témoin négatif) furent inoculées par voie intra-nasale avec uniquement de la saline tamponnée stérile. Les réponses immunes humorales et mucosales des groupes A, B et C augmentèrent de manière significative comparativement à celles du groupe témoin. L’expression des cytokines interleukine-4 et interféron-g dans les splénocytes augmenta également de manière significative. De plus, les souris du groupe B avaient significativement moins de lésions macroscopiques dans le tissu pulmonaire comparativement aux autres animaux des groupes vaccinés suite à une infection avec une souche virulente de P. multocida. Ces résultats indiquent qu’une stratégie de double vaccination intra-nasale peut optimiser la protection envers PAR. (Traduit par Docteur Serge Messier)
Introduction Pneumonic pasteurellosis, a swine respiratory disease, may be caused by toxigenic and nontoxigenic strains of types A and D Pasteurella multocida, which is the most frequent secondary pathogen in pigs and is responsible for significant losses on large pig farms (1). This organism is considered incapable of infecting the lung unless some predisposing damage has occurred (2). Primary infections with bacteria, including Bordetella bronchiseptica, predispose pigs to P. multocida pneumonia (3). Progressive atrophic rhinitis (PAR) is a highly prevalent, contagious swine respiratory disease that is also responsible for significant economic losses in the swine industry (4). Alone or in combination with B. bronchiseptica, P. multocida has been identified as one of the primary opportunistic pathogens that cause PAR (5). This disease is characterized by turbinate atrophy, facial distortion, nasal hemorrhage, and subsequent growth retardation.
Toxigenic strains of P. multocida produce a heat-labile exotoxin (PMT) that is responsible for the turbinate atrophy and growth retardation in animals with PAR (6). The pathogenicity of P. multocida is associated with virulence factors (7) that include diverse adhesins, toxins, siderophores, sialidases, and outer membrane proteins (OMPs) (8), which are ideal vaccine targets for preventing P. multocida infection (7). The PMT is highly immunogenic (7). The capsule-associated adhesin CP39 is a cross-protective antigen among P. multocida strains (7). The fimA gene encodes the FimA subunit protein of fimbriae, a potent target for host immunity (9). The fimbrial subunit protein PtfA, a prevalent virulence factor in P. multocida independent of the strain’s capsule serotype (8), exhibits considerable protection (10). The F1P2 antigen of B. bronchiseptica consists of an important immunodominant protective type I domain (F1) of filamentous hemagglutinin and a highly immunogenic region II domain (P2) of pertactin that serves
Veterinary Public Health, College of Veterinary Medicine, Chonbuk National University, Jeonju 561-756, Republic of Korea. Address all correspondence to Dr. John Hwa Lee; telephone: +82-63-270-2553; fax: +82-63-270-3780; e-mail: [email protected] Received November 18, 2013. Accepted February 18, 2014. 2014;78:297–303
The Canadian Journal of Veterinary Research
297
Table I. Bacterial strains and plasmids used for this study Strain/plasmid Description Source Escherichia coli JOL1136 BL21 with pET-CP39 This study JOL1234 BL21 with pET-FimA This study JOL1214 Top10 with pQE-PtfA This study JOL1135 BL21 with pET-ToxA This study JOL991 BL21 with pET-F1P2 This study Salmonella Typhimurium JOL1240 JOL912 with pBP244-CP39 This study JOL1251 JOL912 with pBP244-FimA This study JOL1247 JOL912 with pBP244-PtfA This study JOL1244 JOL912 with pBP244-ToxA This study JOL1074 JOL912 with pBP244-F1P2 This study Pasteurella multocida JOL976 P. multocida serotype A, wild type (PmA037) Lab stock JOL977 P. multocida (PDNT) serotype D, wild type Lab stock Bordetella bronchiseptica JOL978 B. bronchiseptica wild type Lab stock Plasmids pQE31 IPTG-inducible expression vector; Amr Qiagen pET28a IPTG-inducible expression vector; Kmr Novagen pBP244 pYA3493 derivative containing lepB, secA, and secB genes (12) IPTG — isopropyl b-D-1-thiogalactopyranoside. as a protective antigen against porcine bordetellosis in swine (11). The objective of this study was to optimize a vaccination strategy for a new vaccine candidate expressing CP39, FimA, PtfA, and ToxA of P. multocida and F1P2 of B. bronchiseptica in an attenuated live Salmonella system for protecting mice against pneumonic pasteurellosis and PAR.
Materials and methods Bacterial strains, plasmids, and growth conditions All the bacterial strains and plasmids used in this study are listed in Table I; JOL976 was the source of the gene encoding the FimA antigen, JOL977 was the source of the gene encoding the antigens of CP39, PtfA, and ToxA, and JOL978 was the source of the F1P2 antigen. The JOL977 was inoculated in mice and subsequently isolated from internal organs. In this way, the strain was passaged 3 times to increase the virulence of JOL977. After 3 passages the strain was renamed JOL1080 and was used as the virulent challenge strain. All strains were kindly supplied by the National Veterinary Research and Quarantine Service (Seoul, Korea). The attenuated Salmonella Typhimurium (Dlon DcpxR Dasd) mutant strain JOL912 (12) was used as a host for delivery of individual antigens. The pBP244 plasmid (12) was used as a vector for the expression and secretion of heterologous antigens in the delivery host (13).
Cloning of the genes for individual recombinant antigens According to the previously described method the CP39, FimA, PtfA, ToxA, and F1P2 proteins were prepared from JOL1136, JOL1234,
298
The Canadian Journal of Veterinary Research
Table II. Primers for polymerase chain reaction used in this study and their product sizes Primer Sequencea Size (bp) CP39-F CCGCGAATTCGCAACAGTTTACAATCAAGACCG 942 CP39-R CCGCAAGCTTTTAGAAGTGTACGCGTAAACC FimA-F CCGCGAATTCGATGGGGTAACAGACACT 972 FimA-R CCGCAAGCTTTTACTTGCTTAAGCAAGC ToxA-F CCGCGGATCCAAACATTTTTTTAACTCAGAT 591 ToxA-R CCGCAAGCTTATAAAGCTGAGCATATTTTT PtfA-F CCGCGAATTCGCCATTTTCTTTTCG 435 PtfA-R CCGCAAGCTTTGCGCAAAATCCTGCTGG F1-F TTTAAGAATTCCTGACTGCCCTGGACAAT 465 F1-R TTTAAGTCGACTCGCAGATCCGCGGCAAA a Underlining indicates the sites acted on by the restriction enzymes. bp — base pairs; F — forward; R — reverse. JOL1214, JOL1135, and JOL991, respectively (Table I), for enzymelinked immunosorbent assay (ELISA) and splenocyte stimulation in quantitative real-time polymerase chain reaction (RT-PCR) (12). Briefly, the genes for the proteins were amplified by PCR with the use of specific primer sets (Table II). The PCR fragments of each gene were digested with restriction enzymes and subsequently cloned into pQE31 (Qiagen, Valencia, California, USA) or pET28a (Novagen, Darmstadt, Germany). These plasmids were then transformed into Escherichia coli TOP10 or E. coli BL21 in order to create JOL1136, JOL1234, JOL1214, JOL1135, and JOL991 strains. The recombinant CP39, FimA, PtfA, ToxA, and F1P2 antigens were then prepared from JOL1136, JOL1234, JOL1214, JOL1135, and JOL991, respectively, by an affinity purification process with nickel–nitrilotriacetic acid–agarose
2000;64:0–00
Figure 1. Serum IgG and vaginal mucosal IgA antibody titers against FimA, CP39, PtfA, ToxA, and F1P2 antigens in mice intranasally inoculated with the vaccine candidate (groups A to C) or phosphate-buffered saline as a control (group D). Refer to Table III for the specific vaccination conditions of the groups. Data are means for all mice in each group; error bars indicate standard deviation. Arrowheads indicate primary and booster vaccinations at 6, 9, and 12 wk of age. Lower-case letters indicate a significant difference (P # 0.05) between the control group and the vaccinated groups (a — group A; b — group B; c — group C).
(Qiagen). The identities of the purified antigens were confirmed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis. All purified antigens were stored at 270°C until used.
saline (PBS) to approximately 1 3 107 colony-forming units (CFUs) per milliliter. Mice were vaccinated with the live vaccine on the day of preparation.
Preparation of the vaccine formulation
Vaccination, clinical changes, and sample collection
The genes for the CP39, FimA, PtfA, ToxA, and F1P2 antigens were prepared from the JOL1136, JOL1234, JOL1214, JOL1135, and JOL991 strains, respectively, after the expression of each protein had been confirmed. Each gene was then inserted in pBP244 for construction of the vaccine strains. Subsequently the plasmids were electroporated into JOL912 and the results designated as JOL1240 for CP39, JOL1251 for FimA, JOL1247 for PtfA, JOL1244 for ToxA, and JOL1074 for F1P2. The live vaccine formulations were prepared as described previously (12). Briefly, the bacterial vaccine candidates were grown individually in lysogeny broth. After centrifugation at 3400 3 g for 20 min the pellets were resuspended in sterile phosphate-buffered
2000;64:0–00
Sixty 5-week-old female BALB/c mice were divided equally into 4 groups. The animal experiments were conducted under ethics approval (CBU 2011-0017) from the Chonbuk National University Animal Ethics Committee in accordance with the guidelines of the Korean Council on Animal Care. All the mice were intranasally inoculated with approximately 1 3 105 CFU in 10 mL of an equalvolume mixture of the 5 live vaccine candidates (approximately 0.2 3 105 CFU of each strain) instilled into each nostril, for a total of 20 mL. The group A mice received a single vaccination at 12 wk of age. The group B mice received a primary vaccination at 9 wk of age
The Canadian Journal of Veterinary Research
299
presence of 4 mg/mL of PtfA or F1P2 antigen. The expression of interleukin (IL)-4 and interferon (IFN)-g mRNA was quantified with the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, California, USA) and the following cycle profile: 1 cycle at 95°C for 15 min and 40 cycles at 94°C for 15 s, 55°C for 30 s, and 72°C for 30 s. Commercial primer kits (Qiagen, Hilden, Germany) — QT00160678 for IL-4, QT01038821 for IFN-g, and QT01658692 for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) — were used to amplify IL-4, IFN-g, and GAPDH.
Challenge experiments
Figure 2. Relative levels of interferon-gamma (INF-g) and interleukin-4 (IL-4) mRNA induced by PtfA and F1P2 in the splenocytes of the 16-week-old mice, as determined by real-time polymerase chain reaction. Asterisks indicate a significant difference (P , 0.05) between the control group and the vaccinated groups.
and a booster at 12 wk of age. The group C mice received a primary vaccination at 6 wk of age and boosters at 9 and 12 wk of age. The group D mice were intranasally inoculated with 10 mL of sterile PBS as a control. The mice were monitored daily for depression, abnormal behavior, and death from day 1 after vaccination until the end of the study. Blood and vaginal wash samples were collected from all mice at 6, 8, 10, 12, 14, and 16 wk of age. All samples were prepared and stored as previously described (12).
Immune-response measurement by ELISA A modified ELISA was used to determine individual titers of protein-specific IgG antibody in the serum samples and mucosal IgA titers in the vaginal wash samples in a manner similar to that of a previous study (12). Briefly, 96-well, flat-bottomed ELISA plates (Microlon; Greiner Bio-One, Frickenhausen, Germany) were coated with each purified antigen (500 ng per well) and incubated overnight at 4°C. The serum was diluted 1:200 in PBS, and the vaginal wash samples were diluted 1:3 in PBS. The plates were treated with horseradish peroxidase-conjugated goat IgG or IgA antibody against mouse antigen (Southern Biotechnology Associates, Birmingham, Alabama, USA). Enzymatic reactions were produced through the addition of a substrate containing o-phenylenediamine (SigmaAldrich, St. Louis, Missouri, USA) and were measured with an automated ELISA spectrophotometer (TECAN, Salzburg, Austria) at 492 nm. A standard curve was generated to represent the relationship between the concentrations of the standards and their absorbance, as previously described (14), and the concentration of antibodies in each sample was determined by means of this curve.
Quantitative RT-PCR Spleens from 5 mice per group were aseptically collected at 16 wk of age, as previously described with a slight modification (15). Briefly, the splenocytes (5 3 106 cells per well) were cultured in 24-well tissue culture plates at 37°C with 5% CO2 for 72 h in the 300
The Canadian Journal of Veterinary Research
The wild-type P. multocida type D challenge strain JOL1080 was prepared as previously described (5). Briefly, the strain was grown on chocolate agar at 37°C for 16 h, resuspended in sterile PBS, and diluted to approximately 5 3 107 CFU in 20 mL. Ten mice per group were intranasally challenged with this strain at 16 wk of age. On day 2 after challenge, lung samples from euthanized mice (n = 5 per group) were immediately fixed in 10% neutral phosphate-buffered formalin and embedded in paraffin. The sections were stained with hematoxylin and eosin and examined under a light microscope (BX-51; Olympus Corporation, Tokyo, Japan). Photomicrographs were taken with digital imaging software (analysis TS; Olympus Corporation). The challenged mice were monitored daily for abnormal behavior and death for 14 d.
Statistical analysis Results were expressed as mean 6 standard deviation. The Mann– Whitney U-test (SPSS 16.0 program; SPSS, Chicago, Illinois, USA) was used to determine significant differences in the antibody titers of the serum and vaginal samples between the vaccinated and control groups. A P-value # 0.05 was considered significant.
Results The mice in groups A, B, and C were depressed for 2 d after intranasal inoculation but recovered at day 3 after vaccination. No other clinical signs were observed in any of the mice. Antibody responses to each antigen in the serum and vaginal samples from the mice are presented in Figure 1. In groups A to C the serum IgG titers increased significantly compared with those of control group D from 2 wk after the primary vaccination (except for FimA at 2 wk) until the end of the study (P # 0.05). The serum IgG titers of group B were significantly higher than those of group A from 1 wk after the primary vaccination until the end of the study (P # 0.05). The serum IgG titers of group C were significantly higher than those of group A from 4 wk after the primary vaccination. In addition, the vaginal IgA titers against the individual antigens were significantly higher in groups B and C than in group D from 2 wk after the last vaccination until the end of the study (P # 0.05). However, the mucosal IgA titers against all antigens were significantly higher in group A than in group D only at 4 wk after the last vaccination (P # 0.05). The levels of IL-4 and IFN-g mRNA induced by PtfA and F1P2 in the splenocytes of the 16-week-old mice, as measured by RT-PCR, were significantly higher in groups B and C than in group D (P # 0.05), whereas the levels in group A were only slightly increased
2000;64:0–00
20 mm
20 mm
20 mm
20 mm
Figure 3. Representative histologic appearance of formalin-fixed, paraffin-embedded sections of lung tissue from the mice in groups A to D after challenge with a wild-type Pasteurella multocida. Arrows indicate alveolar macrophages and lymphocytes. Hematoxylin and eosin; 3200.
Table III. Vaccination conditions and frequency of clinical signs of pneumonic pasteurellosis after challenge at 16 wk of age in the 4 groups of mice
the control mice showed severe congestion and accumulation of alveolar macrophages and lymphocytes, and most of the alveolar sacs were abnormal.
Age (wk) at inoculation; Number of mice inoculant with clinical signs Group 6 9 12 after challenge A VC 1/5 B VC VC 0/5 C VC VC VC 3/5 D PBS PBS PBS 5/5 VC — vaccine candidate; PBS — phosphate-buffered saline.
Discussion
compared with those in the control group except for those of IFN-g mRNA induced by PtfA (Figure 2). As shown in Table III and Figure 3, all the group B mice showed few or no histopathological changes in the lungs after challenge. Accumulation of alveolar macrophages and lymphocytes and abnormal alveolar sacs were found in the lungs of 1 mouse from group A and 3 mice from group C after challenge. However, the lungs of all
2000;64:0–00
Toxins and OMPs of various pathogenic bacteria have been recognized as immunodominant antigens (16). Recent studies have shown that the P. multocida toxin and several OMPs play an important role in immunogenicity and resistance to infection (17,18). In particular, adhesion factors are important among OMPs, as they allow colonization of bacteria in host cells (17). Adhesion of B. bronchiseptica to cilia is mediated by filamentous hemagglutinin, pertactin, and fimbriae (17). Usually PAR is clinically controlled by combined vaccination with B. bronchiseptica and P. multocida. The vaccines consist mainly of toxoid and/or somatic antigens of both bacteria. Although most vaccines that consist of killed bacteria induce high serum antibody titers, they do not always confer effective protection against infection (19). Vaccination has unquestionable beneficial effects; however, current vaccines do not efficiently eliminate the bacteria (17,19). Recombinant live Salmonella strains have been used as mucosal
The Canadian Journal of Veterinary Research
301
vaccine vectors to deliver pathogen-specific protective antigens to induce mucosal and systemic immune responses against both vector and foreign antigens (11,12). Vaccination with Salmonella vectors has been broadly used because it represents the natural infection route, and intranasal vaccination of mice with recombinant Salmonella is particularly efficient at inducing an antibody response in the respiratory tract (20,21). In this study the gene for FimA was amplified from P. multocida type A, and genes encoding CP39, PtfA, and ToxA were amplified from P. multocida type D. In addition, the gene for F1P2 antigen was prepared from B. bronchiseptica for protecting against PAR caused by P. multocida serotype D and B. bronchiseptica (5) and against pneumonic pasteurellosis caused by P. multocida serotype A (1). Live attenuated S. Typhimurium strains expressing CP39, FimA, PtfA, ToxA, and F1P2 were constructed as vaccine candidates. Booster vaccination may be important because a faster and stronger immune response is induced after re-exposure to the same antigen (22). Kharb and Charan (23) reported that boosting immunity via the mucosal route in mice prevaccinated with OMPs improves protection against P. multocida. The mice in this study were intranasally vaccinated at various inoculation times to optimize the vaccination strategy. In groups B (double administration) and C (triple administration) the serum IgG and vaginal IgA titers of antibody against individual antigens increased significantly compared with those of the control group from week 2 after the primary vaccination until the end of the study. In particular, the serum IgG titers of groups B and C were higher than those of group A (single administration). In addition, the levels of IL-4 and IFN-g mRNA in groups B and C were significantly higher than those in the control group, whereas the levels of IL-4 induced by PtfA and F1P2 and the levels of IFN-g induced by F1P2 in group A increased only slightly compared with those in the control group. After challenge, fewer or no histopathological changes were found in the lungs of all the group B mice, whereas the lungs of all the control mice showed severe congestion and accumulation of alveolar macrophages and lymphocytes and abnormal alveolar sacs. The lungs of 1 mouse in group A and 3 mice in group C were similar to those of the control mice. Although the serum IgG and vaginal IgA immune responses were greater in the mice given triple vaccination compared with those given a single or no vaccination, the vaccinated animals were not efficiently protected against pneumonic pasteurellosis and PAR. Optimal levels of serum IgG and mucosal IgA against the principal adhesins and toxin of B. bronchiseptica and P. multocida are important to protect against pneumonic pasteurellosis and PAR (15,19). The stronger protective immune responses can be induced through a booster (23). Our study showed that the mice receiving double or triple vaccination had higher protective levels of serum IgG, mucosal IgA, and cell-mediated immune responses than did the mice receiving a single vaccination. In addition, the double-vaccination group was completely protected against the challenge, whereas the protective efficacy of single and triple vaccination was lower. Thus, these results show that vaccination to protect against pneumonic pasteurellosis and PAR may be achieved through double intranasal inoculation with a candidate vaccine to optimally induce systemic and mucosal immunity.
302
The Canadian Journal of Veterinary Research
Acknowledgments This study was supported by the Technology Development Program for Agriculture and Forestry, Ministry for Food, Agriculture, Forestry and Fisheries, Republic of Korea.
References 1. Von Altrock A. [Occurrence of bacterial infectious agents in pathologically/anatomically altered lungs of pigs and compilation of resistance spectra.] Berl Munch Tierarztl Wochenschr 1998;111:164–172. 2. Ciprián A, Cruz TA, de la Garza M. Mycoplasma hyopneumoniae: Interaction with other agents in pigs, and evaluation of immunogens. Arch Med Res 1994;25:235–239. 3. Brockmeier SL, Palmer MV, Bolin SR, Rimler RB. Effects of intranasal inoculation with Bordetella bronchiseptica, porcine reproductive and respiratory syndrome virus, or a combination of both organisms on subsequent infection with Pasteurella multocida in pigs. Am J Vet Res 2001;62:521–525. 4. Dziva F, Muhairwa AP, Bisgaard M, Christensen H. Diagnostic and typing options for investigating diseases associated with Pasteurella multocida. Vet Microbiol 2008;128:1–22. 5. Sakano T, Okada M, Taneda A, Mukai T, Sato S. Effect of Bordetella bronchiseptica and serotype D Pasteurella multocida bacterin–toxoid on the occurrence of atrophic rhinitis after experimental infection with B. bronchiseptica and toxigenic type A P. multocida. J Vet Med Sci 1997;59:55–57. 6. Horiguchi Y. Swine atrophic rhinitis caused by Pasteurella multocida toxin and Bordetella dermonecrotic toxin. Curr Top Microbiol Immunol 2012;361:113–129. 7. Harper M, Boyce JD, Adler B. Pasteurella multocida pathogenesis: 125 years after Pasteur. FEMS Microbiol Lett 2006;265:1–10. 8. Ewers C, Lübke-Becker A, Bethe A, Kiebling S, Filter M, Wieler LH. Virulence genotype of Pasteurella multocida strains isolated from different hosts with various disease status. Vet Microbiol 2006;114:304–317. 9. Tang X, Zhao Z, Hu J, et al. Isolation, antimicrobial resistance, and virulence genes of Pasteurella multocida strains from swine in China. J Clin Microbiol 2009;47:951–958. 10. Adler B, Bulach D, Chung J, et al. Candidate vaccine antigens and genes in Pasteurella multocida. J Biotechnol 1999;73:83–90. 11. Zhao Z, Xue Y, Wu B, et al. Subcutaneous vaccination with attenuated Salmonella enterica serovar Choleraesuis C500 expressing recombinant filamentous hemagglutinin and pertactin antigens protects mice against fatal infections with both S. enterica serovar Choleraesuis and Bordetella bronchiseptica. Infect Immun 2008;76:2157–2163. Epub 2008 Feb 11. 12. Hur J, Lee JH. Immune responses to new vaccine candidates constructed by a live attenuated Salmonella Typhimurium delivery system expressing Escherichia coli F4, F5, F6, F41 and intimin adhesin antigens in a murine model. J Vet Med Sci 2011;73:1265– 1273. Epub 2011 May 30. 13. Kim SW, Kim YH, Yoo AY, et al. Development of a protein secretion system with the application of Sec-dependent protein secretion components. J Microbiol Biotechnol 2007;17:1316–1323.
2000;64:0–00
14. Yoon HA, Aleyas AG, George JA, et al. Correlation between the nature of immunity induced by different immunogens and the establishment of latent infection by wild-type pseudorabies virus. Res Vet Sci 2007;83:73–81. 15. Oliveria AF, Ruas LP, Cardoso SA, Soares SG, Roque-Barreira MC. Vaccination of mice with Salmonella expressing VapA: Mucosal and systemic Th1 responses provide protection against Rhodococcus equi infection. PLoS ONE 2010;5:1–12. 16. Gong Q, Qu N, Niu M, et al. Immune responses and protective efficacy of a novel DNA vaccine encoding outer membrane protein of avian Pasteurella multocida. Vet Immunol Immunopathol 2013;152:317–324. 17. Haesebrouck F, Pasmans F, Chiers K, Maes D, Ducatelle R, Decostere A. Efficacy of vaccines against bacterial diseases in swine: What can we expect? Vet Microbiol 2004;100:255–268. 18. Tan HY, Nagoor NH, Sekaran DD. Cloning, expression and protective capacity of 37 kDa outer membrane protein gene (ompH) of Pasteurella multocida serotype B:2. Trop Biomed 2010;27:430–441.
2000;64:0–00
19. Zhao Z, Xue Y, Tang X, et al. Immunogenicity of recombinant protective antigen and efficacy against intranasal challenge with Bordetella bronchiseptica. Vaccine 2009;27:2523–2528. 20. Nardelli-Haefliger D, Benyacoub J, Lemoine R, et al. Nasal vaccination with attenuated Salmonella typhimurium strains expressing the hepatitis B nucleotide: Dose response analysis. Vaccine 2001;19:2854–2861. 21. Roche JK, Rojo AL, Costa LB, et al. Intranasal vaccination in mice with an attenuated Salmonella enterica serovar 908htr A expressing Cp15 of Cryptosporidium: Impact of malnutrition with preservation of cytokine secretion. Vaccine 2013;31:912–918. 22. Dutton RW, Bradley LM, Swain SL. T cell memory. Annu Rev Immunol 1998;16:201–223. 23. Kharb S, Charan S. Mucosal immunization provides better protection than subcutaneous immunization against Pasteurella multocida (B:2) in mice prevaccinated with the outer membrane proteins. Vet Res Commun 2011;35:457–461.
The Canadian Journal of Veterinary Research
303
Immunologic study and optimization of Salmonella delivery strains expressing adhesin and toxin antigens for protection against progressive atrophic rhinitis in a murine model Jin Hur, Hoyeon Byeon, John Hwa Lee
Abstract Mice were intranasally inoculated at various times to optimize the vaccination strategy with a new live candidate vaccine expressing the antigens CP39, FimA, PtfA, and ToxA of Pasteurella multocida and F1P2 of Bordetella bronchiseptica in an attenuated live Salmonella system to protect against progressive atrophic rhinitis (PAR). Sixty BALB/c mice were divided equally into 4 groups. The group A mice were vaccinated only at 12 wk of age, the group B mice received a primary vaccination at 9 wk of age and a booster at 12 wk of age, the group C mice received a primary vaccination at 6 wk of age and boosters at 9 and 12 wk of age, and the group D mice were inoculated intranasally with sterile phosphate-buffered saline as a control. The humoral and mucosal immune responses of groups A, B, and C increased significantly compared with those of the control group. Expression of the cytokines interleukin-4 and interferon-g in splenocytes also increased significantly. In addition, the group B mice exhibited significantly fewer gross lesions in lung tissue compared with the other vaccinated groups after challenge with a virulent P. multocida strain. These results indicate that a strategy of double intranasal vaccination can optimize protection against PAR.
Résumé Des souris furent inoculées par voie intra-nasale à différents temps pour optimiser la stratégie de vaccination avec un nouveau vaccin candidat vivant exprimant les antigènes CP39, FimA, PtfA, et ToxA de Pasteurella multocida et F1P2 de Bordetella bronchiseptica dans un système vivant atténué de Salmonella afin de protéger contre la rhinite atrophique progressive (PAR). Soixante souris BALB/c ont été divisées également en quatre groupes. Les souris du groupe A furent vaccinées seulement à 12 semaines d’âge, les souris du groupe B ont reçu une première vaccination à 9 sem d’âge et un rappel à 12 sem d’âge, les souris du groupe C ont reçu une première vaccination à 6 sem d’âge et des rappels à 9 et 12 sem d’âge, et les souris du groupe D (groupe témoin négatif) furent inoculées par voie intra-nasale avec uniquement de la saline tamponnée stérile. Les réponses immunes humorales et mucosales des groupes A, B et C augmentèrent de manière significative comparativement à celles du groupe témoin. L’expression des cytokines interleukine-4 et interféron-g dans les splénocytes augmenta également de manière significative. De plus, les souris du groupe B avaient significativement moins de lésions macroscopiques dans le tissu pulmonaire comparativement aux autres animaux des groupes vaccinés suite à une infection avec une souche virulente de P. multocida. Ces résultats indiquent qu’une stratégie de double vaccination intra-nasale peut optimiser la protection envers PAR. (Traduit par Docteur Serge Messier)
Introduction Pneumonic pasteurellosis, a swine respiratory disease, may be caused by toxigenic and nontoxigenic strains of types A and D Pasteurella multocida, which is the most frequent secondary pathogen in pigs and is responsible for significant losses on large pig farms (1). This organism is considered incapable of infecting the lung unless some predisposing damage has occurred (2). Primary infections with bacteria, including Bordetella bronchiseptica, predispose pigs to P. multocida pneumonia (3). Progressive atrophic rhinitis (PAR) is a highly prevalent, contagious swine respiratory disease that is also responsible for significant economic losses in the swine industry (4). Alone or in combination with B. bronchiseptica, P. multocida has been identified as one of the primary opportunistic pathogens that cause PAR (5). This disease is characterized by turbinate atrophy, facial distortion, nasal hemorrhage, and subsequent growth retardation.
Toxigenic strains of P. multocida produce a heat-labile exotoxin (PMT) that is responsible for the turbinate atrophy and growth retardation in animals with PAR (6). The pathogenicity of P. multocida is associated with virulence factors (7) that include diverse adhesins, toxins, siderophores, sialidases, and outer membrane proteins (OMPs) (8), which are ideal vaccine targets for preventing P. multocida infection (7). The PMT is highly immunogenic (7). The capsule-associated adhesin CP39 is a cross-protective antigen among P. multocida strains (7). The fimA gene encodes the FimA subunit protein of fimbriae, a potent target for host immunity (9). The fimbrial subunit protein PtfA, a prevalent virulence factor in P. multocida independent of the strain’s capsule serotype (8), exhibits considerable protection (10). The F1P2 antigen of B. bronchiseptica consists of an important immunodominant protective type I domain (F1) of filamentous hemagglutinin and a highly immunogenic region II domain (P2) of pertactin that serves
Veterinary Public Health, College of Veterinary Medicine, Chonbuk National University, Jeonju 561-756, Republic of Korea. Address all correspondence to Dr. John Hwa Lee; telephone: +82-63-270-2553; fax: +82-63-270-3780; e-mail: [email protected] Received November 18, 2013. Accepted February 18, 2014. 2014;78:297–303
The Canadian Journal of Veterinary Research
297
Table I. Bacterial strains and plasmids used for this study Strain/plasmid Description Source Escherichia coli JOL1136 BL21 with pET-CP39 This study JOL1234 BL21 with pET-FimA This study JOL1214 Top10 with pQE-PtfA This study JOL1135 BL21 with pET-ToxA This study JOL991 BL21 with pET-F1P2 This study Salmonella Typhimurium JOL1240 JOL912 with pBP244-CP39 This study JOL1251 JOL912 with pBP244-FimA This study JOL1247 JOL912 with pBP244-PtfA This study JOL1244 JOL912 with pBP244-ToxA This study JOL1074 JOL912 with pBP244-F1P2 This study Pasteurella multocida JOL976 P. multocida serotype A, wild type (PmA037) Lab stock JOL977 P. multocida (PDNT) serotype D, wild type Lab stock Bordetella bronchiseptica JOL978 B. bronchiseptica wild type Lab stock Plasmids pQE31 IPTG-inducible expression vector; Amr Qiagen pET28a IPTG-inducible expression vector; Kmr Novagen pBP244 pYA3493 derivative containing lepB, secA, and secB genes (12) IPTG — isopropyl b-D-1-thiogalactopyranoside. as a protective antigen against porcine bordetellosis in swine (11). The objective of this study was to optimize a vaccination strategy for a new vaccine candidate expressing CP39, FimA, PtfA, and ToxA of P. multocida and F1P2 of B. bronchiseptica in an attenuated live Salmonella system for protecting mice against pneumonic pasteurellosis and PAR.
Materials and methods Bacterial strains, plasmids, and growth conditions All the bacterial strains and plasmids used in this study are listed in Table I; JOL976 was the source of the gene encoding the FimA antigen, JOL977 was the source of the gene encoding the antigens of CP39, PtfA, and ToxA, and JOL978 was the source of the F1P2 antigen. The JOL977 was inoculated in mice and subsequently isolated from internal organs. In this way, the strain was passaged 3 times to increase the virulence of JOL977. After 3 passages the strain was renamed JOL1080 and was used as the virulent challenge strain. All strains were kindly supplied by the National Veterinary Research and Quarantine Service (Seoul, Korea). The attenuated Salmonella Typhimurium (Dlon DcpxR Dasd) mutant strain JOL912 (12) was used as a host for delivery of individual antigens. The pBP244 plasmid (12) was used as a vector for the expression and secretion of heterologous antigens in the delivery host (13).
Cloning of the genes for individual recombinant antigens According to the previously described method the CP39, FimA, PtfA, ToxA, and F1P2 proteins were prepared from JOL1136, JOL1234,
298
The Canadian Journal of Veterinary Research
Table II. Primers for polymerase chain reaction used in this study and their product sizes Primer Sequencea Size (bp) CP39-F CCGCGAATTCGCAACAGTTTACAATCAAGACCG 942 CP39-R CCGCAAGCTTTTAGAAGTGTACGCGTAAACC FimA-F CCGCGAATTCGATGGGGTAACAGACACT 972 FimA-R CCGCAAGCTTTTACTTGCTTAAGCAAGC ToxA-F CCGCGGATCCAAACATTTTTTTAACTCAGAT 591 ToxA-R CCGCAAGCTTATAAAGCTGAGCATATTTTT PtfA-F CCGCGAATTCGCCATTTTCTTTTCG 435 PtfA-R CCGCAAGCTTTGCGCAAAATCCTGCTGG F1-F TTTAAGAATTCCTGACTGCCCTGGACAAT 465 F1-R TTTAAGTCGACTCGCAGATCCGCGGCAAA a Underlining indicates the sites acted on by the restriction enzymes. bp — base pairs; F — forward; R — reverse. JOL1214, JOL1135, and JOL991, respectively (Table I), for enzymelinked immunosorbent assay (ELISA) and splenocyte stimulation in quantitative real-time polymerase chain reaction (RT-PCR) (12). Briefly, the genes for the proteins were amplified by PCR with the use of specific primer sets (Table II). The PCR fragments of each gene were digested with restriction enzymes and subsequently cloned into pQE31 (Qiagen, Valencia, California, USA) or pET28a (Novagen, Darmstadt, Germany). These plasmids were then transformed into Escherichia coli TOP10 or E. coli BL21 in order to create JOL1136, JOL1234, JOL1214, JOL1135, and JOL991 strains. The recombinant CP39, FimA, PtfA, ToxA, and F1P2 antigens were then prepared from JOL1136, JOL1234, JOL1214, JOL1135, and JOL991, respectively, by an affinity purification process with nickel–nitrilotriacetic acid–agarose
2000;64:0–00
Figure 1. Serum IgG and vaginal mucosal IgA antibody titers against FimA, CP39, PtfA, ToxA, and F1P2 antigens in mice intranasally inoculated with the vaccine candidate (groups A to C) or phosphate-buffered saline as a control (group D). Refer to Table III for the specific vaccination conditions of the groups. Data are means for all mice in each group; error bars indicate standard deviation. Arrowheads indicate primary and booster vaccinations at 6, 9, and 12 wk of age. Lower-case letters indicate a significant difference (P # 0.05) between the control group and the vaccinated groups (a — group A; b — group B; c — group C).
(Qiagen). The identities of the purified antigens were confirmed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis. All purified antigens were stored at 270°C until used.
saline (PBS) to approximately 1 3 107 colony-forming units (CFUs) per milliliter. Mice were vaccinated with the live vaccine on the day of preparation.
Preparation of the vaccine formulation
Vaccination, clinical changes, and sample collection
The genes for the CP39, FimA, PtfA, ToxA, and F1P2 antigens were prepared from the JOL1136, JOL1234, JOL1214, JOL1135, and JOL991 strains, respectively, after the expression of each protein had been confirmed. Each gene was then inserted in pBP244 for construction of the vaccine strains. Subsequently the plasmids were electroporated into JOL912 and the results designated as JOL1240 for CP39, JOL1251 for FimA, JOL1247 for PtfA, JOL1244 for ToxA, and JOL1074 for F1P2. The live vaccine formulations were prepared as described previously (12). Briefly, the bacterial vaccine candidates were grown individually in lysogeny broth. After centrifugation at 3400 3 g for 20 min the pellets were resuspended in sterile phosphate-buffered
2000;64:0–00
Sixty 5-week-old female BALB/c mice were divided equally into 4 groups. The animal experiments were conducted under ethics approval (CBU 2011-0017) from the Chonbuk National University Animal Ethics Committee in accordance with the guidelines of the Korean Council on Animal Care. All the mice were intranasally inoculated with approximately 1 3 105 CFU in 10 mL of an equalvolume mixture of the 5 live vaccine candidates (approximately 0.2 3 105 CFU of each strain) instilled into each nostril, for a total of 20 mL. The group A mice received a single vaccination at 12 wk of age. The group B mice received a primary vaccination at 9 wk of age
The Canadian Journal of Veterinary Research
299
presence of 4 mg/mL of PtfA or F1P2 antigen. The expression of interleukin (IL)-4 and interferon (IFN)-g mRNA was quantified with the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, California, USA) and the following cycle profile: 1 cycle at 95°C for 15 min and 40 cycles at 94°C for 15 s, 55°C for 30 s, and 72°C for 30 s. Commercial primer kits (Qiagen, Hilden, Germany) — QT00160678 for IL-4, QT01038821 for IFN-g, and QT01658692 for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) — were used to amplify IL-4, IFN-g, and GAPDH.
Challenge experiments
Figure 2. Relative levels of interferon-gamma (INF-g) and interleukin-4 (IL-4) mRNA induced by PtfA and F1P2 in the splenocytes of the 16-week-old mice, as determined by real-time polymerase chain reaction. Asterisks indicate a significant difference (P , 0.05) between the control group and the vaccinated groups.
and a booster at 12 wk of age. The group C mice received a primary vaccination at 6 wk of age and boosters at 9 and 12 wk of age. The group D mice were intranasally inoculated with 10 mL of sterile PBS as a control. The mice were monitored daily for depression, abnormal behavior, and death from day 1 after vaccination until the end of the study. Blood and vaginal wash samples were collected from all mice at 6, 8, 10, 12, 14, and 16 wk of age. All samples were prepared and stored as previously described (12).
Immune-response measurement by ELISA A modified ELISA was used to determine individual titers of protein-specific IgG antibody in the serum samples and mucosal IgA titers in the vaginal wash samples in a manner similar to that of a previous study (12). Briefly, 96-well, flat-bottomed ELISA plates (Microlon; Greiner Bio-One, Frickenhausen, Germany) were coated with each purified antigen (500 ng per well) and incubated overnight at 4°C. The serum was diluted 1:200 in PBS, and the vaginal wash samples were diluted 1:3 in PBS. The plates were treated with horseradish peroxidase-conjugated goat IgG or IgA antibody against mouse antigen (Southern Biotechnology Associates, Birmingham, Alabama, USA). Enzymatic reactions were produced through the addition of a substrate containing o-phenylenediamine (SigmaAldrich, St. Louis, Missouri, USA) and were measured with an automated ELISA spectrophotometer (TECAN, Salzburg, Austria) at 492 nm. A standard curve was generated to represent the relationship between the concentrations of the standards and their absorbance, as previously described (14), and the concentration of antibodies in each sample was determined by means of this curve.
Quantitative RT-PCR Spleens from 5 mice per group were aseptically collected at 16 wk of age, as previously described with a slight modification (15). Briefly, the splenocytes (5 3 106 cells per well) were cultured in 24-well tissue culture plates at 37°C with 5% CO2 for 72 h in the 300
The Canadian Journal of Veterinary Research
The wild-type P. multocida type D challenge strain JOL1080 was prepared as previously described (5). Briefly, the strain was grown on chocolate agar at 37°C for 16 h, resuspended in sterile PBS, and diluted to approximately 5 3 107 CFU in 20 mL. Ten mice per group were intranasally challenged with this strain at 16 wk of age. On day 2 after challenge, lung samples from euthanized mice (n = 5 per group) were immediately fixed in 10% neutral phosphate-buffered formalin and embedded in paraffin. The sections were stained with hematoxylin and eosin and examined under a light microscope (BX-51; Olympus Corporation, Tokyo, Japan). Photomicrographs were taken with digital imaging software (analysis TS; Olympus Corporation). The challenged mice were monitored daily for abnormal behavior and death for 14 d.
Statistical analysis Results were expressed as mean 6 standard deviation. The Mann– Whitney U-test (SPSS 16.0 program; SPSS, Chicago, Illinois, USA) was used to determine significant differences in the antibody titers of the serum and vaginal samples between the vaccinated and control groups. A P-value # 0.05 was considered significant.
Results The mice in groups A, B, and C were depressed for 2 d after intranasal inoculation but recovered at day 3 after vaccination. No other clinical signs were observed in any of the mice. Antibody responses to each antigen in the serum and vaginal samples from the mice are presented in Figure 1. In groups A to C the serum IgG titers increased significantly compared with those of control group D from 2 wk after the primary vaccination (except for FimA at 2 wk) until the end of the study (P # 0.05). The serum IgG titers of group B were significantly higher than those of group A from 1 wk after the primary vaccination until the end of the study (P # 0.05). The serum IgG titers of group C were significantly higher than those of group A from 4 wk after the primary vaccination. In addition, the vaginal IgA titers against the individual antigens were significantly higher in groups B and C than in group D from 2 wk after the last vaccination until the end of the study (P # 0.05). However, the mucosal IgA titers against all antigens were significantly higher in group A than in group D only at 4 wk after the last vaccination (P # 0.05). The levels of IL-4 and IFN-g mRNA induced by PtfA and F1P2 in the splenocytes of the 16-week-old mice, as measured by RT-PCR, were significantly higher in groups B and C than in group D (P # 0.05), whereas the levels in group A were only slightly increased
2000;64:0–00
20 mm
20 mm
20 mm
20 mm
Figure 3. Representative histologic appearance of formalin-fixed, paraffin-embedded sections of lung tissue from the mice in groups A to D after challenge with a wild-type Pasteurella multocida. Arrows indicate alveolar macrophages and lymphocytes. Hematoxylin and eosin; 3200.
Table III. Vaccination conditions and frequency of clinical signs of pneumonic pasteurellosis after challenge at 16 wk of age in the 4 groups of mice
the control mice showed severe congestion and accumulation of alveolar macrophages and lymphocytes, and most of the alveolar sacs were abnormal.
Age (wk) at inoculation; Number of mice inoculant with clinical signs Group 6 9 12 after challenge A VC 1/5 B VC VC 0/5 C VC VC VC 3/5 D PBS PBS PBS 5/5 VC — vaccine candidate; PBS — phosphate-buffered saline.
Discussion
compared with those in the control group except for those of IFN-g mRNA induced by PtfA (Figure 2). As shown in Table III and Figure 3, all the group B mice showed few or no histopathological changes in the lungs after challenge. Accumulation of alveolar macrophages and lymphocytes and abnormal alveolar sacs were found in the lungs of 1 mouse from group A and 3 mice from group C after challenge. However, the lungs of all
2000;64:0–00
Toxins and OMPs of various pathogenic bacteria have been recognized as immunodominant antigens (16). Recent studies have shown that the P. multocida toxin and several OMPs play an important role in immunogenicity and resistance to infection (17,18). In particular, adhesion factors are important among OMPs, as they allow colonization of bacteria in host cells (17). Adhesion of B. bronchiseptica to cilia is mediated by filamentous hemagglutinin, pertactin, and fimbriae (17). Usually PAR is clinically controlled by combined vaccination with B. bronchiseptica and P. multocida. The vaccines consist mainly of toxoid and/or somatic antigens of both bacteria. Although most vaccines that consist of killed bacteria induce high serum antibody titers, they do not always confer effective protection against infection (19). Vaccination has unquestionable beneficial effects; however, current vaccines do not efficiently eliminate the bacteria (17,19). Recombinant live Salmonella strains have been used as mucosal
The Canadian Journal of Veterinary Research
301
vaccine vectors to deliver pathogen-specific protective antigens to induce mucosal and systemic immune responses against both vector and foreign antigens (11,12). Vaccination with Salmonella vectors has been broadly used because it represents the natural infection route, and intranasal vaccination of mice with recombinant Salmonella is particularly efficient at inducing an antibody response in the respiratory tract (20,21). In this study the gene for FimA was amplified from P. multocida type A, and genes encoding CP39, PtfA, and ToxA were amplified from P. multocida type D. In addition, the gene for F1P2 antigen was prepared from B. bronchiseptica for protecting against PAR caused by P. multocida serotype D and B. bronchiseptica (5) and against pneumonic pasteurellosis caused by P. multocida serotype A (1). Live attenuated S. Typhimurium strains expressing CP39, FimA, PtfA, ToxA, and F1P2 were constructed as vaccine candidates. Booster vaccination may be important because a faster and stronger immune response is induced after re-exposure to the same antigen (22). Kharb and Charan (23) reported that boosting immunity via the mucosal route in mice prevaccinated with OMPs improves protection against P. multocida. The mice in this study were intranasally vaccinated at various inoculation times to optimize the vaccination strategy. In groups B (double administration) and C (triple administration) the serum IgG and vaginal IgA titers of antibody against individual antigens increased significantly compared with those of the control group from week 2 after the primary vaccination until the end of the study. In particular, the serum IgG titers of groups B and C were higher than those of group A (single administration). In addition, the levels of IL-4 and IFN-g mRNA in groups B and C were significantly higher than those in the control group, whereas the levels of IL-4 induced by PtfA and F1P2 and the levels of IFN-g induced by F1P2 in group A increased only slightly compared with those in the control group. After challenge, fewer or no histopathological changes were found in the lungs of all the group B mice, whereas the lungs of all the control mice showed severe congestion and accumulation of alveolar macrophages and lymphocytes and abnormal alveolar sacs. The lungs of 1 mouse in group A and 3 mice in group C were similar to those of the control mice. Although the serum IgG and vaginal IgA immune responses were greater in the mice given triple vaccination compared with those given a single or no vaccination, the vaccinated animals were not efficiently protected against pneumonic pasteurellosis and PAR. Optimal levels of serum IgG and mucosal IgA against the principal adhesins and toxin of B. bronchiseptica and P. multocida are important to protect against pneumonic pasteurellosis and PAR (15,19). The stronger protective immune responses can be induced through a booster (23). Our study showed that the mice receiving double or triple vaccination had higher protective levels of serum IgG, mucosal IgA, and cell-mediated immune responses than did the mice receiving a single vaccination. In addition, the double-vaccination group was completely protected against the challenge, whereas the protective efficacy of single and triple vaccination was lower. Thus, these results show that vaccination to protect against pneumonic pasteurellosis and PAR may be achieved through double intranasal inoculation with a candidate vaccine to optimally induce systemic and mucosal immunity.
302
The Canadian Journal of Veterinary Research
Acknowledgments This study was supported by the Technology Development Program for Agriculture and Forestry, Ministry for Food, Agriculture, Forestry and Fisheries, Republic of Korea.
References 1. Von Altrock A. [Occurrence of bacterial infectious agents in pathologically/anatomically altered lungs of pigs and compilation of resistance spectra.] Berl Munch Tierarztl Wochenschr 1998;111:164–172. 2. Ciprián A, Cruz TA, de la Garza M. Mycoplasma hyopneumoniae: Interaction with other agents in pigs, and evaluation of immunogens. Arch Med Res 1994;25:235–239. 3. Brockmeier SL, Palmer MV, Bolin SR, Rimler RB. Effects of intranasal inoculation with Bordetella bronchiseptica, porcine reproductive and respiratory syndrome virus, or a combination of both organisms on subsequent infection with Pasteurella multocida in pigs. Am J Vet Res 2001;62:521–525. 4. Dziva F, Muhairwa AP, Bisgaard M, Christensen H. Diagnostic and typing options for investigating diseases associated with Pasteurella multocida. Vet Microbiol 2008;128:1–22. 5. Sakano T, Okada M, Taneda A, Mukai T, Sato S. Effect of Bordetella bronchiseptica and serotype D Pasteurella multocida bacterin–toxoid on the occurrence of atrophic rhinitis after experimental infection with B. bronchiseptica and toxigenic type A P. multocida. J Vet Med Sci 1997;59:55–57. 6. Horiguchi Y. Swine atrophic rhinitis caused by Pasteurella multocida toxin and Bordetella dermonecrotic toxin. Curr Top Microbiol Immunol 2012;361:113–129. 7. Harper M, Boyce JD, Adler B. Pasteurella multocida pathogenesis: 125 years after Pasteur. FEMS Microbiol Lett 2006;265:1–10. 8. Ewers C, Lübke-Becker A, Bethe A, Kiebling S, Filter M, Wieler LH. Virulence genotype of Pasteurella multocida strains isolated from different hosts with various disease status. Vet Microbiol 2006;114:304–317. 9. Tang X, Zhao Z, Hu J, et al. Isolation, antimicrobial resistance, and virulence genes of Pasteurella multocida strains from swine in China. J Clin Microbiol 2009;47:951–958. 10. Adler B, Bulach D, Chung J, et al. Candidate vaccine antigens and genes in Pasteurella multocida. J Biotechnol 1999;73:83–90. 11. Zhao Z, Xue Y, Wu B, et al. Subcutaneous vaccination with attenuated Salmonella enterica serovar Choleraesuis C500 expressing recombinant filamentous hemagglutinin and pertactin antigens protects mice against fatal infections with both S. enterica serovar Choleraesuis and Bordetella bronchiseptica. Infect Immun 2008;76:2157–2163. Epub 2008 Feb 11. 12. Hur J, Lee JH. Immune responses to new vaccine candidates constructed by a live attenuated Salmonella Typhimurium delivery system expressing Escherichia coli F4, F5, F6, F41 and intimin adhesin antigens in a murine model. J Vet Med Sci 2011;73:1265– 1273. Epub 2011 May 30. 13. Kim SW, Kim YH, Yoo AY, et al. Development of a protein secretion system with the application of Sec-dependent protein secretion components. J Microbiol Biotechnol 2007;17:1316–1323.
2000;64:0–00
14. Yoon HA, Aleyas AG, George JA, et al. Correlation between the nature of immunity induced by different immunogens and the establishment of latent infection by wild-type pseudorabies virus. Res Vet Sci 2007;83:73–81. 15. Oliveria AF, Ruas LP, Cardoso SA, Soares SG, Roque-Barreira MC. Vaccination of mice with Salmonella expressing VapA: Mucosal and systemic Th1 responses provide protection against Rhodococcus equi infection. PLoS ONE 2010;5:1–12. 16. Gong Q, Qu N, Niu M, et al. Immune responses and protective efficacy of a novel DNA vaccine encoding outer membrane protein of avian Pasteurella multocida. Vet Immunol Immunopathol 2013;152:317–324. 17. Haesebrouck F, Pasmans F, Chiers K, Maes D, Ducatelle R, Decostere A. Efficacy of vaccines against bacterial diseases in swine: What can we expect? Vet Microbiol 2004;100:255–268. 18. Tan HY, Nagoor NH, Sekaran DD. Cloning, expression and protective capacity of 37 kDa outer membrane protein gene (ompH) of Pasteurella multocida serotype B:2. Trop Biomed 2010;27:430–441.
2000;64:0–00
19. Zhao Z, Xue Y, Tang X, et al. Immunogenicity of recombinant protective antigen and efficacy against intranasal challenge with Bordetella bronchiseptica. Vaccine 2009;27:2523–2528. 20. Nardelli-Haefliger D, Benyacoub J, Lemoine R, et al. Nasal vaccination with attenuated Salmonella typhimurium strains expressing the hepatitis B nucleotide: Dose response analysis. Vaccine 2001;19:2854–2861. 21. Roche JK, Rojo AL, Costa LB, et al. Intranasal vaccination in mice with an attenuated Salmonella enterica serovar 908htr A expressing Cp15 of Cryptosporidium: Impact of malnutrition with preservation of cytokine secretion. Vaccine 2013;31:912–918. 22. Dutton RW, Bradley LM, Swain SL. T cell memory. Annu Rev Immunol 1998;16:201–223. 23. Kharb S, Charan S. Mucosal immunization provides better protection than subcutaneous immunization against Pasteurella multocida (B:2) in mice prevaccinated with the outer membrane proteins. Vet Res Commun 2011;35:457–461.
The Canadian Journal of Veterinary Research
303
