Eur Spine J (2015) 24:1720–1728 DOI 10.1007/s00586-015-4000-4

ORIGINAL ARTICLE

Indian hedgehog contributes to human cartilage endplate degeneration Shaowei Wang1 • Kun Yang2 • Shuai Chen1 • Jiying Wang1 • Guoqing Du2 Shunwu Fan1 • Lei Wei2

•

Received: 2 November 2014 / Revised: 3 May 2015 / Accepted: 3 May 2015 / Published online: 10 May 2015 Ó Springer-Verlag Berlin Heidelberg 2015

Abstract Purpose To determine the role of Indian hedgehog (Ihh) signaling in human cartilage endplate (CEP) degeneration. Methods CEP-degenerated tissues from patients with Modic I or II changes (n = 9 and 45, respectively) and normal tissues from vertebral burst fracture patients (n = 17) were collected. Specimens were either cut into slices for organ culture ex vivo or digested to isolate chondrocytes for cell culture in vitro. Ihh expression and the effect of Ihh on cartilage degeneration were determined by investigating degeneration markers in this study. Results Ihh expression and cartilage degeneration markers significantly increased in the Modic I and II groups. The expression of cartilage degeneration markers was positively correlated with degeneration severity. Gain-offunction for Ihh promoted expression of cartilage degeneration markers in vitro, while loss-of-function for Ihh inhibited their expression both in vitro and ex vivo. Conclusions These findings demonstrated that Ihh promotes CEP degeneration. Blocking Ihh pathway has potential clinical usage for attenuating CEP degeneration. S. Wang and K. Yang contributed in equal measure as the first author.

Electronic supplementary material The online version of this article (doi:10.1007/s00586-015-4000-4) contains supplementary material, which is available to authorized users. & Shunwu Fan [email protected] 1

Department of Orthopaedics, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, NO.3 East Qingchun Road, Hangzhou 310016, China

2

Department of Orthopaedics, Warren Alpert Medical School of Brown University and Rhode Island Hospital, Providence, USA

123

Keywords Indian hedgehog  Cartilaginous endplate  Intervertebral disc degeneration  Low back pain

Introduction Low back pain is among the leading reasons for medical visits. Many studies indicate that lumbar intervertebral disc degeneration (IDD) is the primary source of Low back pain [1]. As the largest avascular organs in vertebrates, the cells in the intervertebral discs (IVD) center obtain nutrition from adjacent bony vertebrae by diffusion through the endplate [2]. Severe interference of the diffusion caused by cartilaginous endplate (CEP) calcification can result in reduced nutrient supply for disc cells, which induces IDD [3]. Increased calcification of CEP is now considered to be a key contributor to IDD [4]. The knowledge about the molecular structure of CEPs, mainly of articular cartilage, improved the ability to study the matrix turnover and pathological calcification. Among all the collage species, type X collagen (Col X) is thought to be the most important in the endplate since it is a marker of chondrocyte hypertrophy and is involved in calcification [5]. Furthermore, decrease of type II collagen (Col II) and Aggrecan has been shown to induce premature calcification in CEPs [6, 7]. Proteoglycans in the CEP matrix are the major source responsible for nutrition transportation through CEP to cells in the IVD [8]. Loss of proteoglycans in CEP often ultimately leads to IDD [9]. Various proinflammatory cytokines were shown to be critical in the disc degeneration process. For example, tumor necrosis factor alpha (TNF-a), which induced catabolic and anti-anabolic shifts in the nucleus pulposus (NP), is highly associated with IDD [10]. Toll-Like Receptor 4 (TLR4) is activated during IDD which promotes

Eur Spine J (2015) 24:1720–1728

the degeneration process [11]. These proinflammatory cytokines promote catabolic process of intervertebral matrix by promoting matrix degradation enzymes such as matrix metalloproteinases (MMPs) [7, 12]. A recent study about proinflammatory cytokine changes in CEPs which affect NP and promote IDD showed that interleukin-6 (IL-6) and interleukin-8 (IL-8) significantly upregulated in NP cells after triggered by CEP-conditioned medium [13]. This in turn leads to MMPs upregulation, including MMP-3 and MMP-13 that degraded type II collagen and aggrecan [13]. However, there is little knowledge about how CEP calcification initiated and what molecules upregulate MMPs to induce CEP degeneration. Indian hedgehog (Ihh) is demonstrated to be critical in knee joint cartilage degeneration [14]. It is activated in human and murine osteoarthritis (OA) tissues, while inhibiting it pharmacologically or genetically can attenuate OA progression [15, 16]. In the opposite, activating hedgehog signaling worsens the cartilage degeneration [17]. Ihh is reported to promote chondrocyte hypertrophy, which leads to cartilage calcification, and also upregulate MMP-13, which leads to cartilage degeneration [15, 18]. Previous studies have demonstrated that Ihh signaling can be detected in the CEP tissues of mice [19]. However, the role of Ihh signaling in CEP degeneration is still unknown. To further understand why the CEP calcifies and what cellular mechanism is involved in the degeneration of CEP, we investigated in this study the role of Ihh in CEP degeneration through both in vitro and ex vivo experiments.

Materials and methods Specimens The study was approved by the Institutional Review Board at Sir Run Run Shaw Hospital, and informed consent was obtained from each donor. The specimens were collected from Aug 2013 to Mar 2014. Degenerated CEP patients who underwent lumbar fusion surgery with Modic I or Modic II changes according to magnetic resonance imaging (MRI) were included in Modic I group [n = 9 (4 men and 5 women); mean ± SD age 54.0 ± 12.1 (range 25–64 years)] and Modic II group [n = 45 (28 men and 17 women); mean ± SD age 56.9 ± 11.0 (range 34–84 years)], separately. Vertebral burst fracture patients who underwent anterior vertebral body excision and fusion without degenerative change according to MRI while there was no Low back pain history were included in the normal control group [n = 17 (15 men and 2 women; mean ± SD age 37.7 ± 14.7 years (range 17–56 years)] (Fig. 1). The CEP tissues were carefully dissected under EZ4 microscope (Leica).

1721

Human endplate cartilage organ culture Human Modic CEP samples (n = 5) were obtained during vertebral body fusion surgery. The samples were cut into 5 9 5 mm2 discs. Ten discs from each patient were collected and cultured in 24-well plates, which were supplied with 1 ml of DMEM containing 10 % FBS. Those ex vivo cultured cartilage discs were treated with hedgehog signaling inhibitor cyclopamine (20 lM) (Santa Cruze sc221448) or dimethyl sulfoxide (DMSO) as the control at 37 °C under 5 % CO2 for 48 h. Human endplate chondrocyte isolation and primary culture Human CEP was minced with a scalpel and digested with pronase (2 mg/ml) (Roche, Basel, Switzerland) in HBSS solution (Invitrogen, Carlsbad, CA) for 30 min at 37 °C with shaking. After digestion and removal of the supernatant, the cartilage pieces were washed with DMEM, and digested with crude bacterial collagenase (Type IA, 1 mg/ ml) (Sigma-Aldrich, St Louis, MO) for 6–8 h at 37 °C with shaking. Residual multicellular aggregates were removed by filtering, and then the cells were washed three times with DMEM. Chondrocyte cells were cultured in vitro in DMEM containing 10 % FBS, L-glutamine (Invitrogen, Carlsbad, CA), and antibiotics (penicillin and streptomycin) (Sigma-Aldrich, St Louis, MO). Before experiments, chondrocytes were seeded in six-well culture plates (Becton–Dickinson Labware, Franklin Lakes, NJ) with 2 9 105 cells per well. At 90 % confluence, the chondrocytes were transfected with Ihh siRNA or scrambled siRNA control or exposed to recombinant human Ihh protein (5 lg/ml) (R&D, Minneapolis, MN). Two Duplex siRNAs that specifically targeted human Ihh mRNA as well as scrambled siRNA (Santa Cruz, Santa Cruz, CA and Invitrogen, Carlsbad, CA) were transfected by GenMute siRNA transfection reagent (SignaGen Laboratories, USA). After cultured for 48 h without medium changing, cells were collected for further experiments. RNA extraction and real-time quantitative PCR (qPCR) The CEP samples were ground with a mortar and pestle while liquid nitrogen was supplied. Total RNA was isolated from human CEP tissues or chondrocytes using an RNeasy isolation kit (Qiagen, Valencia, CA) according to manufacturer’s instruction. Total RNA was reverse transcribed using iScript cDNA synthesis kit (Bio-Rad). RTPCR was performed on a 96-well plate ABI Prism 7500 (Applied Biosystems, Foster City, CA) using SuperReal PreMix reagent (Qiagen, Valencia, CA). The total volume

123

1722

Eur Spine J (2015) 24:1720–1728

Fig. 1 MRI features in endplates. Control endplate showed isointense on both T1-weighted imaging (T1WI) (a) and T2-weighted imaging (T2WI) (b). Modic I changes were hypointense on T1WI

(c) and hyperintense on T2WI (d). Modic I changes were hyperintense on T1WI (e) and isointense or hyperintense on T2WI (f). White arrow MRI changes

Table 1 Oligonucleotide primers used for real-time PCR Forward (50 –30 )

Reverse (50 –30 )

Product size (bp)

Accession number

18S IHH

CGGCTACCACATCCAAGGAA CATTGAGACTTGACTGGGCAAC

GCTGGAATTACCGCGGCT AGAGCAGGCTGAGTTGGGAGTCGC

463 152

NM_006671.5 NM_002181.3

AGGRECAN

TCCCCTGCTATTTCATCGAC

CCAGCAGCACTACCTCCTTC

117

XM_006720419.1

COL1A1 (Col I)

GGCCCAGAAGAACTGGTACA

AATCCATCGGTCATGCTCTC

81

XM_006721703.1 XM_006719242.1

COL2A1 (Col II)

CTGGAAAAGCTGGTGAAAGG

GGCCTGGATAACCTCTGTGA

105

COL10A1 (Col X)

AATGCCCACAGGCATAAAAG

AGGACTTCCGTAGCCTGGTT

187

XM_006715333.1

MMP-13

TGCTGCATTCTCCTTCAGGA

ATGCATCCAGGGGTCCTGGC

183

NM_002427.3

GLI 1

GAACCCTTGGAAGGTGATATGTC

GGCAGTCAGTTTCATACACAGAT

136

XM_005268799.1

GLI 2

GCGTGTTTACCCAATCCTGT

GATGCTCCCTCAGAGTCCTG

265

XM_006712423.1

GLI 3

CTTTGCAAGCCAGGAGAAAC

TTGTTGGACTGTGTGCCATT

163

XM_005249704.1

RUNX2

TTTGCACTGGGTCATGTGTT

TGGCTGCATTGAAAAGACTG

156

XM_006715233.1

SOX9

GGACCAGTACCCGCACTTGCA

GTTCTTCTCCGACTTCCTCCGCCG

181

NM_000346.3

(20 ll) of each PCR reaction contained 10 ll SuperReal PreMix, 7 ll ddH2O, 2 ll cDNA, and 1ul with 10 lM of each of the forward and reverse primer (Table 1). Amplification conditions were as follows: 2-min preincubation at

123

50 °C; 10 min at 95 °C for enzyme activation; and 40 cycles at 95 °C denaturation for 10 s, 55 °C annealing for 30 s and 72 °C extension for 30 s. Gene expression was normalized with 18 s mRNA levels. The comparative

Eur Spine J (2015) 24:1720–1728

threshold cycle (Ct) method, that is, the 2-DDCt method was used to calculate fold amplification. DMMB assays For evaluation of matrix PG release, we used the metachromatic dye 1, 9-dimethylmethylene blue (DMMB) assay to quantify the amount of sulfated glycosaminoglycan (sGAG) in the medium. Supernatants from the CEP organ culture were assayed using the DMMB (SigmaAldrich, Gillingham, UK) method according to manufacturer’s instruction. Shark chondroitin sulfate (SigmaAldrich, Gillingham, UK) was used to fit standard curve (0–70 lg). DMMB solution (200 ll) was added to samples and standards (40 ll). The concentrations of sGAG were obtained from a spectrophotometric reader at 540 nm (Thermo Scientific Microplate Reader, UK). Histology staining CEP tissue discs were fixed in 4 % buffered p-formaldehyde for 24 h, decalcified in 10 % ethylene diamine tetraacetic acid for 1 month, and embedded in paraffin. Three serial sections (4-lm thick) per specimen embedded in paraffin were cut with a microtome. To observe cell morphology, cell density/numbers, and proteoglycans content, sections were stained with safranin-O/fast green or Hematoxylin and eosin (H&E) staining. Three pathologists blindly assigned with histology sections, counted numbers of total chondrocytes under microscope at 10x power (magnification 4009) for each specimen. The sections were recounted if the intraclass correlation coefficient was below 0.8. Immunohistochemistry staining Immunohistochemical staining was performed with a histostain SABC kit (CWBIO, Beijing, China) according to the manufacturer’s instructions. Primary antibody, goat anti–Col10a1 sc-323750 (Santa Cruz) and rabbit antiMMP-13 sc-30073 (Santa Cruz) were used for this study at an optimized dilution of 1:100. Secondary antibody mouse anti-goat IgG-B sc-2489 (Santa Cruz) and mouse antirabbit IgG-B sc-2491 (Santa Cruz) were used at the dilution of 1:300. Photography was performed with a Nikon microscope (Nikon, Tokyo, Japan). Statistical analysis One-way ANOVA was used to compare the Ihh mRNA expression in CEP tissues from different groups. A t test was also used to compare mRNA levels from CEP chondrocytes culture or organ culture, and concentration of

1723

sGAG in the organ culture medium. Nonparametric Spearman rank correlation coefficient was used to examine the relationships between relative Ihh mRNA level and endplate cartilage erosion. All data are expressed as mean ± SEM, and analyzed using SPSS 13.0 software (SPSS Inc., Chicago, IL, USA). p values less than 0.05 were considered statistically significant.

Results Magnetic resonance imaging showed different features of specimens in endplates among groups Patients in the control group showed isointense on both T1weighted imaging (T1WI) and T2-weighted imaging (T2WI) in MRI. The images from a 20-year-old male patient with L3 vertebral fracture in T1WI (Fig. 1a) and T2WI (Fig. 1b) were shown as representative. In contrast, patients with Modic I change displayed hypointense on T1WI and hyperintense on T2WI and patients with Modic II change displayed hyperintense on T1WI and isointense or slightly hyperintense on T2WI. A 59-year-old female patient with Modic I change in L4–L5 who displayed a low signal in T1WI (Fig. 1c) and a high signal in T2WI (Fig. 1d), and a 60-year-old female patient with Modic II change in L4–L5 who displayed a high signal in T1WI (Fig. 1e) and T2WI (Fig. 1f) were shown. Both cartilage degeneration and Ihh expression increased in patients with Modic changes To investigate the degeneration of cartilaginous endplate (CEP), specimens were isolated from patients who underwent lumbar fusion surgery with Modic I or Modic II changes. The CEP tissues were located between intervertebral discs and lumbar endplate bones (Supplemental Fig. 1a). We observed cell density significantly decreased in degenerative tissues from both H&E staining (Supplemental Fig. 1b, c) and Safranin-O/fast green staining (Fig. 2a). Furthermore, chondrocyte exhibited hypertrophy morphology (cell enlargement), clustering, and shape variation (e.g., spindle-like structure), especially for Modic II group (Fig. 2b). Furthermore, Safranin-O which stains extracellular matrix, proteoglycan (indicated by red color), showed obvious cartilage degeneration in patients with Modic I and II groups with cell hypertrophy (enlarged cell morphology), clustering, and shape variation (e.g., spindlelike structure) (Fig. 2a). Consistent with previous finding, Ihh was detected in human ECP tissues (Fig. 2b). Real-time qPCR results indicate that Ihh increased by 256 and 267 % in the Modic I and II groups, respectively, compared to control group

123

1724

Eur Spine J (2015) 24:1720–1728

Fig. 2 Ihh was highly expressed in the CEP with Modic changes. The decrease of proteoglycan staining (Safranin-O staining) was more obvious in Modic II group than Modic I group and normal control (a) in the CEP tissues. Ihh mRNA levels were significantly increased in the Modic I and II groups compared with the normal control (p = 0.003 and 6.42E-7, respectively), although there was no

statistical difference (p = 0.289) between Modic I and II groups (mean ± SEM) (b). There was a correlation between Ihh mRNA level and Modic I group (r = 0.726; p \ 0.01), and Modic II group (r = 0.553; p \ 0.01), respectively, but consistently no correlation between Modic I and II groups (c)

(p = 0.003 and p = 6.42E-7, respectively). Furthermore, the correlation between Ihh mRNA level and CEP degradation is greatly significant, with Modic I change (r = 0.726; p \ 0.01) and Modic II change (r = 0.553; p \ 0.01) (Fig. 2c). There was no statistical difference (p = 0.289) between Modic I and II groups (Fig. 2b, c) though. Cartilage degeneration markers, Col X (Fig. 3a) and MMP-13 (Fig. 3b), also increased significantly in degenerated CEP specimens. Their expression was positively correlated with degeneration severity, showing more expression in Modic II patients than Modic I patients (Fig. 3a, b).

related transcription factors Gli1, 2, 3, Runx2 and matrix metalloproteinase MMP13. To achieve loss-of-function study, siRNAs were utilized to inhibit Ihh expression. It was shown that more than 65 % human CEP-isolated chondrocytes were transfected, which was indicated by GFP coexpression level (Fig. 4a). Realtime qPCR of Ihh mRNA expression demonstrated that Ihh was knocked down to 49 % compared to scrambled siRNA (Fig. 4b). Gain-of-function study was utilized by treating chondrocytes with recombinant human Ihh protein. Real-time qPCR results indicated that upregulated Ihh significantly enhanced the levels of Gli1, 2, 3, and Runx2, MMP-13, Col I, Col X expression by 614, 218, 249, 397, 1622, 425 and 261 %, respectively. In the meantime, it suppressed Col II expression by 43 % (p \ 0.01) while there was no significant change of Aggrecan (Fig. 4c). In contrast, after siRNA silencing of Ihh expression, transcription factors Gli1, 2, 3, Runx2, matrix metalloproteinase MMP-13, matrix protein Col I and Col X decreased, while Col II expression increased (Fig. 4d), being exactly to the

Ihh signaling contributes to human endplate cartilage degeneration To understand the underlying mechanism about the correlation between Ihh and CEP degradation, we studied the influence of Ihh on cartilage matrix proteins Col I, Col II, Col X and Aggrecan, as well as cartilage degradation-

123

Eur Spine J (2015) 24:1720–1728

1725

Fig. 3 ColX and MMP-13 protein expression in CEP tissues. Immunohistochemistry staining showed Col X expression (a) and MMP-14 expression (b) in CEP tissues. 94 magnification images are shown in the left with enlarged 920 magnification on the right. Blue arrow positive staining

Fig. 4 Ihh induced degenerative enzymes in human endplate chondrocytes culture. More than 65 % of chondrocytes were transfected with siRNA, as determined by immunofluorescence microscopy 48 h after transfection (a) and Ihh mRNA level decreased by 49 % (b). After 48 h treatment of recombinant human Ihh protein (5 lg/ml),

mRNA levels of Gli1, 2, 3 and Col I, Runx2, MMP-13, ColX were significantly increased (c), whereas Col II mRNA level was decreased, but there was no significant difference of the aggrecan mRNA levels. Knockdown Ihh by siRNA showed the opposite pattern (d). Data are mean ± SEM (n = 5), *p \ 0.01

123

1726

Fig. 5 Attenuation of CEP degeneration via blockade of Ihh signaling pathway in CEP organ culture. The mRNA levels of Gli1, Runx2, MMP-13, ColX were significantly decreased by 68, 65, 75 and 56 %, respectively, after inhibiting Hh pathway with cyclopamine in the cyclopamine-treated group compared with DMSO group (*p \ 0.01, #p \ 0.001) (a). Meanwhile, GAG concentrations in the culture medium were also decreased in the cyclopamine-treated group (170.38 ± 11.3 lg/ml) compared with DMSO group (252.73 ± 61.3 lg/ml) (p = 0.045) (b). Data are mean ± SEM (n = 5)

opposite of gain-of-function result. These data reveal that Ihh promotes cartilage degeneration by upregulating the expression of catabolic factors, which results in decreased cartilage matrix component Col II and increased cartilage hypertrophic or calcification markers Col X and Col I. A similar result was observed in the CEP organ culture incubated with hedgehog signaling inhibitor, cyclopamine. Gli1, Runx2, MMP-13 and ColX significantly decreased by 68, 65, 75 and 56 %, respectively, after inhibiting hedgehog pathway by cyclopamine compared with DMSO control group (p \ 0.01) (Fig. 5a). Meanwhile, GAG concentrations in the culture medium also decreased in the cyclopaminetreated group (170.38 ± 11.3 lg/ml) compared with DMSO group (252.73 ± 61.3 lg/ml) (p = 0.045) (Fig. 5b).

Discussion It has been shown by previous studies that CEP calcification and degeneration, which prevents the transport route for nucleus cell nutrition, plays a crucial role in the pathogenesis of IDD [4, 8]. The expression of type X

123

Eur Spine J (2015) 24:1720–1728

collagen, a calcium-binding collagen, which is a marker of chondrocyte hypertrophy and thought to be involved in cartilage calcification, is positively correlated with IDD [5]. On the opposite, type II collagen and Aggrecan, which are the major components of cartilage matrix to keep it well functional, prevent IDD [6, 7]. A recent study about conditioned CEP medium-induced NP cells pathogenesis showed that matrix metalloproteinase family members, MMP-3 and MMP-13, were increased while type II collagen and Aggrecan were decreased [13]. However, underlying mechanisms for the progression of CEP calcification and degeneration are still not clear. Ihh signaling has been well studied in osteoarthritis progression [16, 18]. DiPaola et al. [19] first discovered that Ihh is expressed in condensing chondrocytes of the vertebral bodies and later becomes confined to the vertebral endplate. However, little has yet been known about the functions of Ihh in the endplate cartilage. In this study, we observed that human CEP specimens with Modic changes underwent severe degeneration with decreased chondrocyte numbers (Fig. 2a and supplemental Fig. 1b, c), and altered extracellular matrix protein expression (Fig. 2a). We discovered, for the first time, that CEP specimens from patients with Modic changes had significantly elevated Ihh expression (Fig. 2b, c). Col X and MMP13 protein expression were upregulated in degenerative CEP tissues shown by immunohistochemistry (Fig. 3a, b). Their expression level was positively correlated with the severity of degeneration with more protein expression in Modic II than Modic I group (Fig. 3a, b). Ihh, as the major Hh ligand in chondrocytes, binds with its cell membrane receptor Patched-1 (Ptch1) to activate the glioma-associated oncogene homolog (Gli) family members, including Gli1, Gli2 and Gli3. Gli family members, which are transcription factors, further activate the transcription of hedgehog signaling downstream target genes, including Ptch1, hedgehog-interacting protein (HHIP) and Runt-related transcription factor 2 (Runx2). Runx2 is a key transcription factor associated with osteogenesis, which also expresses in chondrocytes and activates the expression of MMP-13 and Col X (Fig. 6). It was suggested that hedgehog signaling is a silent pathway during adult life after development; however, under pathological conditions, such as ischemia, tissue injury and harmful mechanical loading, it will be activated [20, 21]. In this study, we found that all three Gli family members were upregulated in addition to Ihh protein in CEP chondrocytes in vitro (Fig. 4c). In the opposite, they were inhibited when CEP chondrocytes were transfected with Ihh siRNAs (Fig. 4d). Gli2 and Gli3 have been shown to be the major signaling molecules in the Ihh pathway that promote Runx2 expression [22]. As a downstream target of the Ihh pathway, Gli1 is proposed to be regulated by Gli2 and Gli3

Eur Spine J (2015) 24:1720–1728

1727

References

Fig. 6 Schematic diagram shows Ihh signaling pathways in CEP tissues indicated by this study

[23]. Our results showed that Gli2 and Gli3 were also upregulated in addition to Ihh protein in CEP chondrocytes (Fig. 4c) while inhibited when transfected with Ihh siRNAs (Fig. 4d). Downstream targets Gli1, MMP-13, Col X were upregulated in addition to Ihh in CEP chondrocytes (Fig. 4c). In contrast, Gli1, MMP-13, and Col X were inhibited in both CEP organ culture treated with Ihh inhibitor cyclopamine (Fig. 5a) and chondrocytes transfected with Ihh siRNAs (Fig. 4d). Interestingly, we noticed that Col II was inhibited by Ihh signaling while Aggrecan was not affected (Fig. 4c, d). GAG staining is used to detect anabolic activity in chondrocytes. We also discovered that GAG quantity released by chondrocytes in the supernatants of cell culture medium is much lower when Ihh signaling was blocked by cyclopamine in the human CEP organ cultures (Fig. 5b). This further demonstrated that inhibition of Ihh signaling inhibited cartilage anabolic activity which attenuates cartilage degeneration. These evidences suggest that blocking Ihh pathway had a chondroprotection effect in the degenerative CEP. In summary, we propose that CEP degeneration process was associated with Ihh signaling upregulation, which promotes CEP calcification and extracellular matrix degradation. Hedgehog signaling inhibitors may be further investigated in future for the potential clinical usage to attenuate CEP degeneration which may further prevent IDD and lower back pain in patients. Acknowledgments This study is supported by the Chinese National Natural Science Foundation (81201435, 81301585, 81301587); Zhejiang Provincial Natural Science Foundation of China (LQ13H060002). Conflict of interest of interest.

The authors declare that they have no conflict

1. de Schepper EI, Damen J, van Meurs JB, Ginai AZ, Popham M, Hofman A, Koes BW, Bierma-Zeinstra SM (2010) The association between lumbar disc degeneration and low back pain: the influence of age, gender, and individual radiographic features. Spine 35:531–536. doi:10.1097/BRS.0b013e3181aa5b33 2. Du H, Ma SH, Guan M, Han B, Yang GF, Zhang M, Liu M (2011) Dynamic contrast enhanced-magnetic resonance imaging study of the nutrition pathway for lumbar intervertebral disk cartilage of normal goats. Orthop Surg 3:106–112. doi:10.1111/j. 1757-7861.2011.00123.x 3. Kang R, Li H, Ringgaard S, Rickers K, Sun H, Chen M, Xie L, Bunger C (2014) Interference in the endplate nutritional pathway causes intervertebral disc degeneration in an immature porcine model. Int Orthop 38:1011–1017. doi:10.1007/s00264-014-2319-9 4. Jackson AR, Huang CY, Gu WY (2011) Effect of endplate calcification and mechanical deformation on the distribution of glucose in intervertebral disc: a 3D finite element study. Comput Methods Biomech Biomed Engin 14:195–204. doi:10.1080/ 10255842.2010.535815 5. Aigner T, Gresk-otter KR, Fairbank JC, von der Mark K, Urban JP (1998) Variation with age in the pattern of type X collagen expression in normal and scoliotic human intervertebral discs. Calcif Tissue Int 63:263–268 6. Sahlman J, Inkinen R, Hirvonen T, Lammi MJ, Lammi PE, Nieminen J, Lapvetelainen T, Prockop DJ, Arita M, Li SW, Hyttinen MM, Helminen HJ, Puustjarvi K (2001) Premature vertebral endplate ossification and mild disc degeneration in mice after inactivation of one allele belonging to the Col2a1 gene for Type II collagen. Spine 26:2558–2565 7. Roughley P, Martens D, Rantakokko J, Alini M, Mwale F, Antoniou J (2006) The involvement of aggrecan polymorphism in degeneration of human intervertebral disc and articular cartilage. Eur Cell Mater 11:1–7 discussion 7 8. Roberts S, Urban JP, Evans H, Eisenstein SM (1996) Transport properties of the human cartilage endplate in relation to its composition and calcification. Spine 21:415–420 9. Lipson SJ, Muir H (1981) Experimental intervertebral disc degeneration: morphologic and proteoglycan changes over time. Arthritis Rheum 24:12–21 10. Purmessur D, Walter BA, Roughley PJ, Laudier DM, Hecht AC, Iatridis J (2013) A role for TNFalpha in intervertebral disc degeneration: a non-recoverable catabolic shift. Biochem Biophys Res Commun 433:151–156. doi:10.1016/j.bbrc.2013.02.034 11. Rajan NE, Bloom O, Maidhof R, Stetson N, Sherry B, Levine M, Chahine NO (2013) Toll-Like Receptor 4 (TLR4) expression and stimulation in a model of intervertebral disc inflammation and degeneration. Spine 38:1343–1351. doi:10.1097/BRS. 0b013e31826b71f4 12. Haro H, Takahashi M (2001) The role of MMP in intervertebral disc tissues–from disc degeneration to herniated disc. Ryumachi [Rheumatism] 41:44–50 13. Neidlinger-Wilke C, Boldt A, Brochhausen C, Galbusera F, Carstens C, Copf F, Schultheiss M, Lazary A, Brayda-Bruno M, Ignatius A, Wilke HJ (2014) Molecular interactions between human cartilaginous endplates and nucleus pulposus cells: a preliminary investigation. Spine 39:1355–1364. doi:10.1097/ BRS.0000000000000372 14. Razzak M (2012) Osteoarthritis: the hedgehog and the bony spur. Nat Rev Rheumatol 8:123. doi:10.1038/nrrheum.2012.5 15. Lin AC, Seeto BL, Bartoszko JM, Khoury MA, Whetstone H, Ho L, Hsu C, Ali SA, Alman BA (2009) Modulating hedgehog signaling can attenuate the severity of osteoarthritis. Nat Med 15:1421–1425. doi:10.1038/nm.2055

123

1728 16. Zhou J, Chen Q, Lanske B, Fleming BC, Terek R, Wei X, Zhang G, Wang S, Li K, Wei L (2014) Disrupting the Indian hedgehog signaling pathway in vivo attenuates surgically induced osteoarthritis progression in Col2a1-CreERT2; Ihhfl/fl mice. Arthritis Res Ther 16:R11. doi:10.1186/ar4437 17. Kim SY, Im GI (2011) The expressions of the SOX trio, PTHrP (parathyroid hormone-related peptide)/IHH (Indian hedgehog protein) in surgically induced osteoarthritis of the rat. Cell Biol Int 35:529–535. doi:10.1042/CBI20100251 18. Wei F, Zhou J, Wei X, Zhang J, Fleming BC, Terek R, Pei M, Chen Q, Liu T, Wei L (2012) Activation of Indian hedgehog promotes chondrocyte hypertrophy and upregulation of MMP-13 in human osteoarthritic cartilage. Osteoarthritis Cartilage 20:755–763. doi:10.1016/j.joca.2012.03.010 19. DiPaola CP, Farmer JC, Manova K, Niswander LA (2005) Molecular signaling in intervertebral disk development. J Orthop Res 23:1112–1119. doi:10.1016/j.orthres.2005.03.008

123

Eur Spine J (2015) 24:1720–1728 20. VanHook AM (2011) Focus issue: fine-tuning Hedgehog signaling in development and disease. Sci Signal 4:eg10. doi: 10. 1126/scisignal.2002653 21. Bailey EC, Scott MP, Johnson RL (2000) Hedgehog signaling in animal development and human disease. In: Nu¨sslein-Volhard C, Kra¨tzschmar J (eds) Of Fish, Fly, Worm, and Man. Ernst Schering Research Foundation Workshop, vol 29. Springer, Berlin, Heidelberg, pp 211–235. doi:10.1007/978-3-662-04264-9_12 22. Shimoyama A, Wada M, Ikeda F, Hata K, Matsubara T, Nifuji A, Noda M, Amano K, Yamaguchi A, Nishimura R, Yoneda T (2007) Ihh/Gli2 signaling promotes osteoblast differentiation by regulating Runx2 expression and function. Mol Biol Cell 18:2411–2418. doi:10.1091/mbc.E06-08-0743 23. Sasaki H, Nishizaki Y, Hui C, Nakafuku M, Kondoh H (1999) Regulation of Gli2 and Gli3 activities by an amino-terminal repression domain: implication of Gli2 and Gli3 as primary mediators of Shh signaling. Development 126:3915–3924